Rice panicle type and / or plant height related protein, and coding gene and application thereof
By overexpressing or silencing the OsGNA protein and its encoding gene in rice, the panicle type and plant height of rice can be regulated, solving the problems of rice yield and lodging resistance, and realizing the cultivation of large-panicle rice and the improvement of lodging resistance.
Patent Information
- Application Number
- CN202410826455.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-25
- Publication Date
- 2026-02-17
- Estimated Expiration
- 2044-06-25
AI Technical Summary
How to regulate the panicle type and/or plant height of rice to improve rice yield and lodging resistance.
By expressing or inhibiting the OsGNA protein and its encoding gene, and using DNA recombination technology to overexpress or silence the OsGNA gene in rice, combined with different promoters and terminators, the panicle type and plant height of rice can be regulated.
Increase the size and number of grains per panicle in rice, improve rice yield, enhance lodging resistance, simplify the breeding process, and reduce costs.
Smart Images

Figure HDA0004910637080000011 
Figure HDA0004910637080000012
Abstract
Description
Technical Field
[0001] This invention relates to a rice panicle type and / or plant height related protein, its encoding gene, and its applications in the field of biotechnology. Background Technology
[0002] Rice, as one of the most important food crops, feeds one-third of the world's population. With the deterioration of the global environment, the reduction of arable land, and the increase in population, it faces enormous challenges in ensuring food security. Rice yield is mainly affected by the number of effective panicles per unit area, the number of grains per panicle, and the weight of 1,000 grains. Differences in the length and number of branches lead to differences in panicle morphology, which in turn affect the number of grains per panicle and yield. Therefore, it is of great significance to discover and utilize genes that regulate the number of grains per panicle in rice.
[0003] Transcription factors, as trans-acting factors, can specifically bind to the cis-acting elements of eukaryotic genes, participating in various physiological and biochemical processes during rice growth and development by activating or inhibiting gene transcription. The activity of transcription factors is also influenced by interactions with other proteins; complexes formed by different proteins may affect the DNA-binding ability, binding mode, and location of transcription factors within the cell, thereby enabling precise and complex regulation of downstream genes under specific conditions. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to regulate the panicle type and / or plant height of rice.
[0005] This invention provides a protein, named OsGNA, which is a protein as follows (A1), (A2), or (A3):
[0006] A1) The amino acid sequence is that of the protein listed as SEQ ID No. 2 in the sequence listing;
[0007] A2) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein in A1) has more than 90% identity with the protein shown in A1) and has the activity of regulating panicle type and / or plant height in rice.
[0008] A3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0009] Of these, SEQ ID No. 2 in the sequence listing consists of 578 amino acid residues.
[0010] The aforementioned proteins can be derived from rice, more specifically japonica rice.
[0011] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.
[0012] In the aforementioned proteins, the protein tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0013] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0014] In the aforementioned proteins, the 90% or more identity can be at least 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0015] Biomaterials related to the protein OsGNA are also within the scope of protection of this invention.
[0016] The biomaterial related to the protein OsGNA provided by this invention is any one of B1) to B5) below:
[0017] B1) The nucleic acid molecule that encodes the protein;
[0018] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0019] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B1);
[0020] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);
[0021] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3).
[0022] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0023] In the above-mentioned biological materials, the nucleic acid molecule described in B1) is a gene as shown in b1) or b2) below:
[0024] b1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 1 in the sequence listing;
[0025] b2) The nucleotide is the cDNA molecule or DNA molecule of SEQ ID No. 3 in the sequence listing.
[0026] Of these, SEQ ID No. 1 in the sequence listing consists of 1737 nucleotides and encodes the protein shown in SEQ ID No. 2 in the sequence listing.
[0027] In the aforementioned biological materials, the expression cassette (OsGNA gene expression cassette) containing the nucleic acid molecule described in B2) refers to a nucleic acid molecule capable of expressing OsGNA in host cells. This nucleic acid molecule may include not only a promoter to initiate OsGNA gene transcription but also a terminator to terminate OsGNA transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to: constitutive promoters, tissue-, organ-, and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to: the rice actin Act1 promoter Actin; the constitutive promoter 35S of cauliflower mosaic virus; the wound-inducible promoter from tomato; and leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology). 120:979-992); chemically inducible promoters from tobacco; pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiohydroxy acid S-methyl ester)); tomato protease inhibitor II promoter (PIN2) or LAP promoter (both can be induced by jasmonic acid methyl ester); heat shock promoter (US Patent 5,187,267); tetracycline-inducible promoter (US Patent 5,057,422); seed-specific promoters, such as millet seed-specific promoter pF128 (CN101063139B (Chinese Patent 200710099169.7)), and seed storage protein-specific promoters (e.g., promoters of bean globule protein, napin, oleosin, and soybean beta conglycin (Beachy et al. (1985) EMBO J.4:3047-3053)). They can be used alone or in combination with other plant promoters. All references cited herein are cited in full. Suitable transcription terminators include, but are not limited to: Agrobacterium carmine synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and carmine and octopine synthase terminator (see, for example, Odell et al. (I)). 985Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res. 15:9627.
[0028] Recombinant vectors containing the OsGNA-encoding gene or the OsGNA-encoding gene expression cassette of the aforementioned protein can be constructed using existing plant expression vectors. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pCAMBIA2300, pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1305, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pGWB18, pBI121, pCAMBIA1391-Xa, or pCAMBIA1391-Xb. When constructing recombinant vectors using OsGNA, any enhancing, constitutive, tissue-specific, or inducible promoter can be added before the transcription initiation nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter or the ubiquitin gene Ubiqutin promoter (pUbi). These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.
[0029] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants that encode enzymes or luminescent compounds that produce color changes (GUS gene, luciferase gene, etc.), antibiotic resistance markers (gentamicin marker, kanamycin marker, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes).
[0030] In the above-mentioned biological materials, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi; for example, the bacteria may be Agrobacterium LBA4404 strain.
[0031] The present invention also provides the application of substance A, which increases the content of the protein OsGNA, or substance A, which promotes or enhances the expression of the gene encoding the protein OsGNA, wherein the application is any one of the following:
[0032] P1. Application in increasing the panicle size of rice or in the preparation of products with increased panicle size of rice;
[0033] P2. Application in increasing rice panicle length or in the preparation of products that increase rice panicle length;
[0034] P3. Application in increasing the number of branches in rice panicles or in the preparation of products that increase the number of branches in rice panicles;
[0035] P4. Application in increasing the number of grains per rice panicle or in the preparation of products that increase the number of grains per rice panicle.
[0036] In the above applications, substance A is the protein OsGNA or the biomaterial related to the protein OsGNA.
[0037] The present invention also provides substance B for reducing the content of the protein OsGNA or substance B for inhibiting or reducing the expression of the gene encoding the protein OsGNA, wherein the application is any one of the following:
[0038] Q1. Application in the cultivation of dwarf rice or in the preparation of dwarf rice products;
[0039] Q2. Application in the cultivation of lodging-resistant rice or in the preparation of lodging-resistant rice products;
[0040] Q3. Application in reducing rice tillering or in the preparation of products that reduce rice tillering;
[0041] Q4. Application in reducing the size of rice panicles or in the preparation of products with reduced rice panicle size;
[0042] Q5. Application in shortening rice panicle length or in the preparation of products with shortened rice panicle length;
[0043] Q6. Application in reducing the number of branches in rice panicles or in the preparation of products that reduce the number of branches in rice panicles;
[0044] Q7. Application in reducing the number of grains per panicle in rice or in the preparation of products that reduce the number of grains per panicle in rice.
[0045] In the above applications, substance B can be a substance that knocks out or silences the gene encoding the protein OsGNA.
[0046] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.
[0047] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.
[0048] In the above applications, substance B may be a reagent for RNA interference against the gene encoding the protein OsGNA, and the reagent contains the following F1), F2), or F3):
[0049] F1) RNA interference fragments targeting the gene encoding OsGNA;
[0050] F2) Generates DNA molecules containing RNA interference fragments targeting the gene encoding OsGNA;
[0051] F3) generates an RNA interference vector targeting the gene encoding OsGNA.
[0052] In the above application, the RNA interference fragments targeting the encoding gene of OsGNA are SEQ ID No. 4 and SEQ ID No. 5, and RNA interference is performed on positions 512-748 of SEQ ID No. 2.
[0053] To address the aforementioned technical problems, the present invention also provides a method for cultivating large-panicle rice, comprising introducing a nucleic acid molecule encoding the protein OsGNA into recipient rice to obtain large-panicle rice; wherein the panicle of the large-panicle rice is larger than that of the recipient rice.
[0054] In the above method, the nucleic acid molecule can be modified as follows before being introduced into the recipient rice to achieve better expression:
[0055] 1) Modify the gene sequence adjacent to the initiation methionine to enable efficient translation initiation; for example, by using a sequence known to be effective in plants.
[0056] 2) Linked to promoters of various plant expression to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-selective, and tissue-specific promoters; the selection of promoters will vary with the time and space requirements of expression, and also depends on the target species; for example, tissue or organ-specific expression promoters, depending on the stage of development of the target receptor; although it has been shown that many promoters derived from dicotyledons are functional in monocotyledons and vice versa, ideally, dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters are selected for expression in monocotyledons;
[0057] 3) Linking with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; for example, tml from CaMV, E9 from rbcS; any available terminator known to function in plants can be linked with the gene of the present invention.
[0058] 4) Introduce enhancer sequences, such as intron sequences (e.g., derived from Adhl and Bronzel) and viral leader sequences (e.g., derived from TMV, MCMV, and AMV).
[0059] The nucleic acid molecules described can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).
[0060] In the above method, the large-panicle type rice can be a transgenic plant or a plant obtained through conventional breeding techniques such as hybridization.
[0061] In the above method, the transgenic plant is understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. The transgenic plant includes seeds, callus tissue, complete plants, and cells.
[0062] The present invention also provides a method for reducing rice plant height, comprising the step of inhibiting the expression of the gene encoding the protein OsGNA in recipient rice to obtain rice with a shorter plant height than the recipient rice; wherein the recipient rice is rice containing the encoding gene.
[0063] The present invention also provides a method for improving lodging resistance of rice, comprising the step of inhibiting the expression of the gene encoding the protein OsGNA in recipient rice to obtain rice with higher lodging resistance than the recipient rice; wherein the recipient rice is rice containing the encoding gene.
[0064] In the above method, the inhibition of the expression of the gene encoding the protein OsGNA in the recipient rice is achieved by gene interference on the gene encoding the protein OsGNA in the recipient rice.
[0065] Experiments using the OsGNA gene demonstrated that transgenic rice overexpressing the OsGNA protein exhibited larger panicles and more grains per panicle compared to the recipient rice; conversely, transgenic rice with OsGNA gene interference showed smaller panicles, fewer grains per panicle, and shorter plant height compared to the recipient rice. This indicates that the OsGNA protein is a gene associated with panicle shape and plant height. The method of this invention is simple to operate, low in cost, and greatly accelerates the breeding process, possessing broad application prospects. Attached Figure Description
[0066] Figure 1 This study compared the main spike phenotype and OsGNA expression levels of wild-type Kitaake (Kit) plants with OsGNA overexpression in OsGNA-positive transgenic plants (OE1, OE2, and OE3). Data shown in the figure are mean ± standard deviation, with 3 replicates. ** indicates a significant difference compared to the wild-type (P < 0.01).
[0067] Figure 2 This study compares the main spike phenotype and OsGNA expression levels of wild-type Kitaake plants with OsGNA gene interference (RNAi-1, RNAi-2, and RNAi-3). Data shown in the figure are mean ± standard deviation, with 3 replicates. ** indicates a significant difference compared to the wild-type (P < 0.01). Detailed Implementation
[0068] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0069] In the quantitative experiments described below, three replicate experiments were conducted, and the average value of the results was taken.
[0070] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0071] In the following examples, the japonica rice variety kitaake is described in the non-patent literature "Wu Yan, Tang Ning, Zhang Bianjiang. Effects of nitrogen deficiency on photosynthetic characteristics of different japonica rice varieties [J]. Hubei Agricultural Sciences, 2014(8):1762-1764.", which can be obtained by the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, to replicate the experiments of this application.
[0072] In the following embodiments, the overexpression vector pCAMBIA2300 is described in the non-patent literature “Ren,Y.,Wang,Y.,Pan,T.,Wang,Y.,Wang,Y.,Gan,L.,Wei,Z.,Wang,F.,Wu,M.,Jing,R.,Wang,J.,Wan,G.,Bao,X.,Zhang,B.,Zhang,P.,Zhang,Y.,Ji,Y.,Lei,C.,Zhang,X.,Cheng,Z.,Lin,Q.,Zhu,S.,Zhao,Z.,Wang,J.,Wu,C.,Qiu,L.,Wang,H.and Wan,J.(2020)GPA5Encodes a Rab5aEffector Required for Post-Golgi Trafficking of Rice Storage Proteins.PlantCell”. 32:758-777.”, which is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, for the purpose of replicating the experiments described in this application.
[0073] In the following examples, the RNAi interference vector pCUbi1390-△FAD2 is described in the non-patent literature “Tan, J., Tan, Z., et al. A novel chloroplast-localized pentatricopeptide repeat protein involved in splicing effects chloroplast development and abiotic stress response in rice. Mol. Plant, 2014, 7: 1329–1349.”, which is available to the public from the Institute of Crop Science, Chinese Academy of Agricultural Sciences, to replicate the experiments of this application.
[0074] The following examples use SPSS statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The Student t-test is used. P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.
[0075] Example 1: Application of OsGNA protein and its encoding gene
[0076] Total RNA was extracted from leaves of the rice variety Kitaake, and the total RNA was reverse transcribed into first-strand cDNA. The obtained cDNA was used as a template for PCR amplification using primer pairs consisting of F0 and R0, and the amplified product was obtained and sequenced.
[0077] Primer sequences:
[0078] F0: 5'-GTTCATCACTCCCTCCCCAT-3' (identical to the sequence of SEQ ID No. 3, positions 1-20);
[0079] R0: 5'-AGCAAGATAATTCAGCTAAA-3' (inverse complementary to the sequence of positions 2151-2170 of SEQ ID No. 3).
[0080] Sequencing results showed that the OsGNA gene cloned by the inventors is 2170 bp in length, with the nucleotide sequence SEQ ID No. 3, where positions 1-270 are the 5'-UTR, positions 271-2007 are the first exon, and positions 2008-2170 are the 3'-UTR. The CDS sequence (SEQ ID No. 1) is 1737 bp in length, encoding the OsGNA protein with the amino acid sequence SEQ ID No. 2. The OsGNA protein consists of 578 amino acid residues.
[0081] SEQ ID No.1
[0082]
[0083] SEQ ID No.2
[0084] MAYMCADSGNLMAIAQQVIQQQQQQQQQQQRHHHHHHLPPPPPPQSMAPHHHQQKHHHHHQQMPAMPQAPPSSHGQIPGQLAYGGGAAWPAGEHFFADAFGASAGDAVFSDLAAAADFDSDGWMESLIGDAPFQDSDLERLIFTTPPPPVPSPPPTHAAATATATAATAAPRPEAAPALLPQPAAATPVACSSPSPSSADASCSAPILQSLLSCSRAAATDPGLAAAELASVRAAATDAGDPSERLAFYFADALSRRLACGTGAPPSAEPDARFASDELTLCYKTLNDACPYSKFAHLTANQAILEATGAATKIHIVDFGIVQGIQWAALLQALATRPEGKPTRIRITGVPSPLLGPQPAASLAATNTRLRDFAKLLGVDFEFVPLLRPVHELNKSDFLVEPDEAVAVNFMLQLYHLLGDSDELVRRVLRLAKSLSPAVVTLGEYEVSLNRAGFVDRFANALSYYRSLFESLDVAMTRDSPERVRVERWMFGERIQRAVGPEEGADRTERMAGSSEWQTLMEWCGFEPVPLSNYARSQADLLLWNYDSKYKYSLVELPPAFLSLAWEKRPLLTVSAWR
[0085] SEQ ID No.3
[0086]
[0087] 1. Construction of overexpression vectors
[0088] A double-stranded DNA fragment encoding the OsGNA gene (one strand of the double strand is shown in SEQ ID No. 2) was inserted into the SalI single-restriction site of the pCAMBIA2300 vector. The resulting recombinant vector with the correct sequence was designated pCAMBIA2300-OsGNA. pCAMBIA2300-OsGNA contains the DNA fragment shown in SEQ ID No. 2 and the rice actin Act1 promoter Actin inherent in the pCAMBIA2300 vector, and can express the OsGNA protein shown in SEQ ID No. 1. The expression of this protein is driven by the rice actin Act1 promoter Actin.
[0089] 2. Construction of RNAi interference vector
[0090] The sense fragment interfering with OsGNA gene expression (one strand of the double-stranded vector, as shown in SEQ ID No. 4, is identical to positions 512-748 of SEQ ID No. 2 and positions 782-1018 of SEQ ID No. 3) was inserted into the Kpn 1 single enzyme restriction site of the pCUbi1390-△FAD2 vector. The antisense fragment interfering with OsGNA gene expression (one strand of the double-stranded vector, as shown in SEQ ID No. 5, is reverse complementary to positions 512-748 of SEQ ID No. 2 and positions 782-1018 of SEQ ID No. 3) was inserted into the BamH 1 single enzyme restriction site of the pCUbi1390-△FAD2 vector. The resulting correctly sequenced interference vector was designated pCUbi1390-△FAD2-OsGNA.
[0091] SEQ ID No. 4
[0092] CTCGACCTGAGGCTGCACCGGCTTTGCTCCCCCAGCCTGCTGCTGCCGACCCCGGTGGCGTGTTCGTCTCCGAGTCCGAGTTCCGCGGACGCCTCCTGCCGCTCCCATCCTCCAGTCCCTCCTGTCCTGCTCCCGCGCGGCGGCGACCGACCCTGGCCTCGCCGCCGCGGAGCTCGCCAGCGTCCGCGCCGCCGCGACTGACGCCGGGGACCCATCTGAGCGCTTGGCCTTCTACT
[0093] SEQ ID No. 5
[0094] AGTAGAAGGCCAAGCGCTCAGATGGGTCCCCGGCGTCAGTCGCGGCGGCGCGGACGCTGGCGAGCTCCGCGGCGGCGAGGCCAGGGTCGGTCGCCGCCGCGCGGGAGCAGGACAGGAGGGACTGGAGGATGGGAGCGGAGCAGGAGGCGTCCGCGGAACTCGGACTCGGAGACGAACACGCCACCGGGGTCGCAGCAGCAGGCTGGGGGAGCAAAGCCGGTGCAGCCTCAGGTCGAG
[0095] 3. Construction and identification of OsGNA transgenic plants
[0096] 3.1. The pCAMBIA2300-OsGNA obtained in step 1 was introduced into Agrobacterium EHA105 strain (American Jungle Company) to obtain recombinant Agrobacterium EHA105 / / pCAMBIA2300-OsGNA.
[0097] The pCUbi1390-△FAD2-OsGNA obtained in step 2 was introduced into Agrobacterium EHA105 strain (American Jungle Company) to obtain recombinant Agrobacterium EHA105 / / pCUbi1390-△FAD2-OsGNA.
[0098] 3.2 The recombinant Agrobacterium EHA105 / / pCAMBIA2300-OsGNA and recombinant Agrobacterium EHA105 / / pCUbi1390-△FAD2-OsGNA obtained in 3.1 were transformed into the japonica rice variety kitaake (wild type), respectively. The specific steps are as follows:
[0099] (1) Take the recombinant Agrobacterium cells obtained in step 3.1, resuspend them in N6 liquid medium (Sigma, C1416) and adjust the OD600nm of the bacterial solution to 0.5.
[0100] (2) The mature embryonic callus of the japonica rice variety kitaake (wild type, WT) that has been cultured for one month was infected in the bacterial solution obtained in step (1) for 30 min. After the bacterial solution was dried by filter paper, the callus was transferred into solid N6 medium (Sigma, C1416) containing 10 g / L agar and cultured at 24℃ for 3 days.
[0101] (3) The callus cultured in step (2) was inoculated on solid screening N6 solid medium containing 10 g / L agar and 100 mg / L hygromycin and cultured for 16 days (first screening).
[0102] (4) The healthy callus cultured in step (3) was inoculated on solid screening N6 medium containing 10 g / L agar and 100 mg / L hygromycin and cultured for 15 days (second screening).
[0103] (5) The healthy callus cultured in step (4) was inoculated on solid screening N6 medium containing 10 g / L agar and 100 mg / L hygromycin and cultured for 15 days (third screening).
[0104] (6) The healthy callus tissue cultured in step (5) was inoculated on differentiation medium (Phyto Technology Laboratories, M524) for differentiation culture to obtain T0 generation OsSP2 gene transgenic plants. The T0 generation plants were self-crossed to obtain T1 generation plants.
[0105] 4. The expression level of the OsGNA gene was detected in the T1 generation transgenic OsGNA plants obtained in step 2, with the japonica rice variety kitaake used as a control. Total RNA was extracted from the leaves of the test plants and reverse transcribed into cDNA. Quantitative PCR was performed using cDNA as a template. Primers 5 and 6 were used to detect the OsGNA gene expression level, and primers 7 and 8 were used to detect the Ubiquitin gene (internal control) expression level.
[0106] Primer 5: 5'-ATTGCTTACTGTGTCTGCTTGGA-3';
[0107] Primer 6: 5'-TTGGAGGAAACTACAACAAAAGC-3';
[0108] Primer 7: 5'-AGGCAACAGGTGGTCGCAAATC-3';
[0109] Primer 8: 5'-GCTTCTTCTTGAGGCAGCTGTTCC-3'.
[0110] Plants transgenic with the pCAMBIA2300-OsGNA gene showing significantly higher OsGNA gene expression levels than the control were identified as positive OsGNA transgenic plants. Three T1 generation positive OsGNA transgenic plants (OE1, OE2, and OE3) were selected for pot cultivation.
[0111] See results Figure 1Compared with wild-type plants, OsGNA-positive transgenic plants (OE1, OE2, and OE3) showed significantly increased plant height, panicle length, primary branch number, secondary branch number, and spikelet number.
[0112] Plants with significantly lower OsGNA gene expression levels than the control were identified as positive OsGNA gene interference plants. Three T1 generation positive OsGNA gene interference plants (RNAi-1, RNAi-2, and RNAi-3) were selected for pot cultivation.
[0113] See results Figure 2 Compared with wild-type plants, OsGNA gene-interference plants (RNAi-1, RNAi-2, and RNAi-3) showed significantly reduced plant height, tiller number, panicle length, primary branch number, secondary branch number, and spikelet number.
[0114] In summary, the OsGNA gene can regulate plant height and panicle type in rice.
[0115] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of substance A, which increases the content of protein OsGNA, or substance A, which promotes or enhances the expression of the gene encoding said protein OsGNA, characterized in that, The application is any one of the following: P1. Application in increasing the number of branches in rice panicles or in the preparation of products that increase the number of branches in rice panicles; P2. Application in increasing the number of grains per panicle in rice or in the preparation of products that increase the number of grains per panicle in rice; The protein OsGNA is a protein that is either A1) or A2): A1) The amino acid sequence is that of the protein listed as SEQ ID No. 2 in the sequence listing; A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1); The substance A is the protein or a biological material related to the protein, and is any one of B1) to B4) below: B1) The nucleic acid molecule that encodes the protein; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B1); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3).
Citation Information
Patent Citations
Seed specificity highly effective promoter and its application
CN101063139A
Seed specific highly effective promoter and its application
CN101063139B
Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells
US5057422A
Plant proteins, promoters, coding sequences and use
US5187267A