A suspension concentrate containing Trichoderma oil and its application in corn lodging resistance

Abstract

The present invention discloses a Trichoderma oil suspension and its application in corn lodging resistance; the present invention separates and purifies a Trichoderma WXH‑CF001 from the soil of corn fields in protective cultivated land of Kalaqin Banner, Chifeng City, Inner Mongolia Autonomous Region, and is deposited in the China Typical Microorganism Collection Management Center with a deposit number of CCTCC NO: M20232107. The present invention also discloses a Trichoderma oil suspension, which is prepared by uniformly mixing Trichoderma spore concentrate, biological synergist, adjuvant, etc. It is verified by experiments that the Trichoderma has a significant inhibitory effect on Fusarium graminearum and Rhizoctonia solani that cause corn stalks to fall. After the prepared oil suspension is treated with corn seeds, the height of corn plants can be reduced, the strength of the stalks can be enhanced, and the lodging of corn can be effectively reduced. It has application potential in corn production in northern regions such as the Yanshan Hilly Area.

Description

Technical Field

[0001] The invention belongs to the field of agricultural microorganisms, and relates to Trichoderma harzianum and the preparation of its oil suspension, in particular to an oil suspension containing Trichoderma and the application of the oil suspension in corn lodging resistance. Background Art

[0002] Corn is an important food crop, feed crop and industrial raw material in my country, and it plays a pivotal role in the national economy and agricultural production. In recent years, the planting area has gradually increased, and improving corn yield and quality is of great significance to ensuring my country's food security. Corn lodging is mainly caused by corn neck diseases, such as stalk rot and sheath blight, which are also the main corn diseases at present. Corn stalk rot is mainly caused by a variety of fungi such as Fusarium and Pythium, and sheath blight is caused by Rhizoctonia solani. After the occurrence, it not only affects the transmission of nutrients, but also makes the corn stalks fragile in severe cases. Under the influence of complex infection or strong winds, the stalks will be broken. It is common in my country's main corn producing areas, and the incidence rate in severe areas is more than 70%, resulting in incomplete grain filling, a decrease in thousand-grain weight, and a reduction in yield. The lodging rate of plants infected with stalk rot and sheath blight exceeds 30%, resulting in a yield loss of more than 50%. The disease is aggravated in rainy weather, and in severe cases, it can lead to a total crop failure.

[0003] At present, the main methods used in production are breeding of resistant varieties, chemical seed coating, and spraying of systemic chemical pesticides to prevent and control corn stalk rot and sheath blight, thereby reducing the lodging rate of plants and achieving the goal of reducing corn damage and stabilizing yield. Breeding and planting resistant varieties is a relatively effective means of preventing and controlling corn diseases, but it requires a lot of manpower and material resources, and has the defects of long cultivation cycle, unclear composite resistance, and genetic instability. Although the use of systemic chemical agents is a special prevention and control method that can reduce the incidence of plants, chemical seed coating only has a prevention and control effect on the early growth of jointing, and has a poor prevention and control effect on the occurrence of diseases in the middle and late stages; the effective period of spraying chemical agents is easily affected by special weather. In the case of long-term rainy weather and plants soaked in water, it is very easy to fail and cause the outbreak of stalk rot and sheath blight; and the large-scale use of systemic chemical agents will pollute the environment, harm non-target organisms, and enhance the drug resistance of pathogens. Biological seed dressing agent (seed dressing agent) is a new type of agent with live microorganisms or natural substances of biological origin as active ingredients. It contains live microorganisms, metabolites, and natural extracts that can inhibit bacteria and kill insects and induce plant resistance, such as Trichoderma, Metarhizium anisopliae, Bacillus, and Polygonum cuspidatum extracts. Biological control is not only environmentally friendly, but can also reduce the use of pesticides and increase efficiency, greatly reducing the impact of pesticide application on the environment and people's health. In addition, microorganisms have a short growth cycle and can be fermented in large quantities in a short period of time. Therefore, it is a very feasible means to isolate and screen biocontrol strains and process them into commercial preparations and apply them to the prevention and control of corn lodging. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a suspension containing Trichoderma oil and its application in corn lodging resistance.

[0005] To achieve the purpose of the present invention, the following technical solutions are provided:

[0006] <First aspect>

[0007] The invention provides a Trichoderma sp. WXH-CF001, whose preservation number is CCTCC NO: M20232107; the Trichoderma sp. is Trichoderma harzianum.

[0008] The invention separates and purifies a Trichoderma sp. from the soil of a corn field in a protective cultivated land of Harqin Banner, Chifeng City, Inner Mongolia Autonomous Region, and the strain number is WXH-CF001.

[0009] The colony cultured at 28℃ for 24h on nutrient agar medium (200g potato, 20g glucose, 20g agar, distilled water to 1L, neutral pH) is translucent, white hyphae can be seen on the front of the colony, which is fluffy to felt-like, thick and fluffy, radially extending outward, protruding on the surface of the plate, and can cover a 9cm culture dish in about 48h. The color changes from dark to light from the center to the edge. After 3d, spores begin to appear on the plate from the center to the edge. After 5d, a large number of bright yellow spores grow, with more edges and orange-brown on the back. The main axis of the conidiophore is uniform in thickness, with few side branches, and the shape of the conidiophore is nearly round, the color is consistent with the main stem, white or light yellow, and the overall structure is dendritic.

[0010] The Trichoderma WXH-CF001 strain was amplified and sequenced by PCR, and compared with the data in the DNA sequence database established by NCBI Gen Bank. The similarity between the sequence segment of WXH-CF001 and that of Trichoderma harzianum reached 99%.

[0011] The strain was deposited in the China Center for Typical Microorganisms Collection on November 1, 2023, with the deposit address: Wuhan University, China, and the deposit number: CCTCC NO: M20232107. Only the genus name was provided during the deposit, namely Trichoderma sp. WXH-CF001. The evolutionary tree of the strain is as follows Figure 3 As shown; combined with the phylogenetic tree, it can be identified and confirmed that Trichoderma sp. WXH-CF001 is Trichoderma harzianum.

[0012] <Second Aspect>

[0013] The invention also provides a Trichoderma oil-containing suspension, the components of which include Trichoderma sp. WXH-CF001.

[0014] As an embodiment of the present invention, the preparation composition of the oil suspension comprises: Trichoderma WXH-CF001 fermentation concentrate, a biological enhancer and an adjuvant.

[0015] As an embodiment of the present invention, the bio-enhancer is quercetin.

[0016] As an embodiment of the present invention, the auxiliary agent includes at least one of an oil base, an emulsifier, a dispersant, and a protective agent.

[0017] As an embodiment of the present invention, the oil base includes one or more of the following: camellia oil, rapeseed oil, soybean oil, and peanut oil.

[0018] As an embodiment of the present invention, the emulsifier includes one or more of the following: sodium lauryl sulfate, fatty alcohol polyoxyethylene ether, sodium lauroyl glutamate, sodium carboxymethyl cellulose.

[0019] As an embodiment of the present invention, the dispersant is one or more of the following: poloxamer, sodium lignin sulfonate, SP-2836, GY-D10, and saponin powder.

[0020] As an embodiment of the present invention, the protective agent is one or more of the following: trehalose, xanthan gum, humic acid, dextrin, and sodium fluorescein.

[0021] As an embodiment of the present invention, the oil suspension is composed of Trichoderma WXH-CF001 fermentation spore concentrate, biological synergist quercetin, oil base, emulsifier, dispersant, and protective agent in a ratio of 3-6: 0.01-0.2: 5-8: 1-4: 1-6: 1-4. In some embodiments, the ratio of Trichoderma WXH-CF001 fermentation concentrate, biological synergist quercetin, oil base, emulsifier, dispersant, and protective agent is 5: 0.1: 7: 1: 1.5: 2.

[0022] In some embodiments, the preparation method of Trichoderma WXH-CF001 is as follows: inoculate the Trichoderma WXH-CF001 strain on a PDA plate and culture it at 25°C-30°C for 72-96 hours, scrape the conidia on the plate with a sterile inoculation needle, and transfer it to a triangular flask containing 500 mL PDB, and then use a hemocytometer and sterile distilled water (SDW) to adjust the content of the spore liquid to 1-2×10 per milliliter. 6Place on a shaker at 28°C and 200r / min for 168-192h. Centrifuge the fermentation broth at 1000-3000r / min, remove the precipitate and take the supernatant, further centrifuge at 5000-8000r / min to obtain the bacterial slurry and supernatant respectively, and store them in a 4°C-8°C refrigerator. Prepare the Trichoderma spore concentrate with the bacterial slurry and supernatant, and the number of viable spores should reach 8-10×10 8 cfu / mL.

[0023] <Third Aspect>

[0024] The present invention also provides a use of Trichoderma sp. WXH-CF001 or the aforementioned Trichoderma-containing oil suspension in corn lodging resistance. Trichoderma sp. WXH-CF001 has an inhibitory effect on Fusarium graminearum and Rhizoctonia solani, the pathogen of corn sheath blight, and reducing the incidence or severity of stem rot and sheath blight is also one of the main measures to reduce the corn stalk breakage and plant lodging rate. In addition, after the oil suspension containing the Trichoderma sp. is processed by the formulation to treat corn seeds, it is proved by field experiments that the corn plants are dwarfed and the stalk strength is enhanced, which can effectively reduce the lodging of corn.

[0025] As an embodiment of the present invention, by treating corn seeds with a fermentation product of Trichoderma harzianum WXH-CF001, or a suspension containing Trichoderma oil, the height of corn plants can be reduced, the strength of corn stalks can be enhanced, and the lodging resistance of corn can be improved.

[0026] In the present invention, Trichoderma sp. WXH-CF001 was deposited in the China Center for Type Microorganism Collection on November 1, 2023, with the deposit address: Wuhan University, China, and the deposit number CCTCC NO: M20232107.

[0027] Compared with the prior art, the present invention has the following effects:

[0028] 1) The Trichoderma WXH-CF001 of the present invention has a protective effect of 59.18% against Fusarium graminearum and 63.16% against Rhizoctonia solani Kuhn. These two pathogens are the main pathogens of corn stalk rot and corn sheath blight, respectively, and are also one of the main factors leading to corn lodging.

[0029] 2) Trichoderma WXH-CF001 can not only prevent diseases, but also contain the oil suspension of Trichoderma 10 6 After corn seeds are treated with CFU, plant height can be reduced, stem strength can be improved, and lodging resistance can be increased.

[0030] 3) Oil suspension is a stable and uniform dispersion system formed by dispersing the main active ingredients or substances that are insoluble or poorly soluble in water into the oil phase under the action of auxiliary agents, which is conducive to the survival and stability of living microorganisms, and has the advantages of low cost, good environmental compatibility, and good lasting effect. The present invention selects the optimal auxiliary agent and develops a suitable dosage form oil suspension, which lays a foundation for the large-scale production of Trichoderma WXH-CF001 and the development of commercial preparations.

[0031] 4) In order to exert the efficacy of the preparation, increase its stability and convenience of use, various adjuvants must be added therein to configure it into a suitable dosage form. Compared with ordinary chemical pesticides, the dosage form processing of live fungus biocides is more difficult. When screening various adjuvants, it is necessary not only to consider whether the physicochemical properties of various adjuvants meet the requirements of the preparation, but also to ensure that they are highly compatible with the biocontrol bacteria. Trehalose in the oil suspension adjuvant of the present invention is a non-reducing disaccharide, which can be used as a storage sugar in fungi and as a protective substance. It can stabilize proteins and cell membranes under a variety of adverse environments and is an excellent bioprotectant.

[0032] 5) The biological enhancer quercetin is a plant flavonol, which belongs to the flavonoids in polyphenols. It is widely present in fruits, vegetables, flowers, leaves and fruits of Chinese herbal medicines. It has a strong antioxidant effect. When combined with the Trichoderma harzianum of the present invention, it can affect plant growth through hormone signals and play a synergistic role.

[0033] 6) The main active ingredient used in the present invention is a biological agent, which is non-toxic and harmless, easily degradable, with little residue, and will not damage the ecological environment after long-term use. It is suitable for promotion and application in corn producing areas in my country. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0035] Figure 1 This is a morphological photo of a PDA plate inoculated with Trichoderma for 5 days;

[0036] Figure 2 The electron microscope photographs of the conidiophores and conidia of Trichoderma of the present invention are shown;

[0037] Figure 3 is a phylogenetic tree of Trichoderma of the present invention;

[0038] Figure 4 The antibacterial effect on Fusarium graminearum in the embodiment of the present invention;

[0039] Figure 5 This is the antibacterial effect against Rhizoctonia solani in the examples of the present invention. DETAILED DESCRIPTION

[0040] The present invention is described in detail below in conjunction with embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those of ordinary skill in the art, some adjustments and improvements can also be made without departing from the concept of the present invention. These all belong to the protection scope of the present invention.

[0041] Example 1

[0042] This embodiment provides a Trichoderma that is isolated and purified from the soil of a corn field in a protective cultivated land in Harqin Banner, Chifeng City, Inner Mongolia Autonomous Region.

[0043] Classification and identification of Trichoderma:

[0044] Figure 1 This is a photo of the PDA plate morphology after 5 days of Trichoderma inoculation. Figure 2 The electron microscope photograph of the conidiophores and conidia of Trichoderma of the present invention is shown in FIG. Figure 1 and Figure 2 It can be seen that the above-mentioned Trichoderma strain can produce aerial hyphae on nutrient agar medium PDA (potato 200g, glucose 20g, agar 20g, distilled water fixed to 1L, pH neutral), the front of the colony is fluffy to felt-like, white, thick and fluffy, protruding from the surface, radially, and the color has a significant gradient from the center to the edge. After 5 days, the culture medium is covered with a large number of bright yellow spores, with more edges and orange-brown on the back. The main axis of the conidiophore is uniform in thickness, with few side branches, and the shape of the conidiophore is nearly round, the color is consistent with the main stem, white or light yellow, and the overall structure is dendritic.

[0045] Molecular biological identification of Trichoderma species:

[0046] The DNA of WXH-CF001 was amplified using primers ITS4 (TCCTCCGCTTATTGATATGC) and ITS5 (GGAAGTAAAAGTCGTAACAAGG), and compared with the data in the DNA sequence database established by NCBI Gen Bank. The similarity between the sequence of WXH-CF001 and that of Trichoderma harzianum reached 99%.

[0047] The complete ITS sequence of WXH-CF001 is as follows (SEQ ID NO.1):

[0048] .

[0049] The above-mentioned Trichoderma was deposited in the China Center for Typical Microorganisms Collection on November 1, 2023, with the deposit address: Wuhan University, China, and the deposit number CCTCC NO: M20232107. Only the genus name was provided during the deposit, namely Trichoderma sp. WXH-CF001. The evolutionary tree of the strain is as follows Figure 3 As shown; combined with the phylogenetic tree and the above sequence comparison, it can be clearly identified and confirmed that Trichoderma sp. WXH-CF001 is Trichoderma harzianum. In the following examples, the Trichoderma sp. is referred to as Trichoderma harzianum WXH-CF001.

[0050] Example 2

[0051] This embodiment provides a suspension containing Trichoderma oil and a preparation method thereof. The specific contents are as follows:

[0052] Trichoderma harzianum WXH-CF001 was inoculated on a PDA plate and cultured for 96 h. The conidia on the plate were scraped with a sterile inoculation needle and transferred to a triangular flask containing 500 mL of PDB. The spore solution was then fixed to 1×10 per ml using a hemocytometer and sterile distilled water (SDW). 6 The culture medium was placed on a shaker at 28°C and 200 r / min for 168 h, and the supernatant was obtained by centrifugation at 3000 r / min, and then centrifuged at 8000 r / min to obtain the bacterial slurry and the supernatant, respectively. The spore concentrate was prepared in a certain proportion so that the number of viable spores of Trichoderma in the concentrate reached 8 × 10 8 cfu / mL or more. Place the fermented spore solution in a 6℃ cold storage.

[0053] The preparation method of the oil suspension is as follows: 50 parts of Trichoderma harzianum WXH-CF001 spore concentrate, 1 part of quercetin, 70 parts of camellia oil, 10 parts of sodium dodecyl sulfate, 15 parts of poloxamer, and 20 parts of trehalose are mixed evenly and stored at 4°C.

[0054] Example 3

[0055] This embodiment provides a suspension containing Trichoderma oil, but does not contain a bio-enhancer, and the rest of the preparation method is the same as that of Example 2.

[0056] Example 4

[0057] This embodiment provides a suspension containing Trichoderma oil, in which the biosynergist is replaced by kaempferol, and the rest of the preparation method is the same as that of Example 2.

[0058] Example 5

[0059] This embodiment provides a suspension containing Trichoderma oil, wherein the oil base in Example 2 is replaced by soybean oil, the emulsifier is replaced by sodium carboxymethyl cellulose, the dispersant is replaced by saponin powder, and the protective agent is replaced by humic acid. The rest of the preparation method is the same as that of Example 2.

[0060] Example 6

[0061] This embodiment provides a suspension containing Trichoderma oil, wherein the Trichoderma harzianum in Example 2 is replaced by Trichoderma harzianum T22, and the rest of the preparation method is the same as that of Example 2.

[0062] Example 7

[0063] In this example, the samples prepared in the above examples 2 and 5 were analyzed for preparation quality.

[0064] 1. Determination of viable count

[0065] The samples prepared in Example 2 and Example 5 were diluted 100 times, 500 μL was aspirated and spread on a PDA plate, and the number of viable bacteria was calculated after 24 hours. This was repeated three times.

[0066] Through counting, it was found that the average number of viable bacteria in the preparations could reach 32×10 5 cfu / ml and 30×10 5 cfu / ml, which can fully meet the requirements of field disease prevention and control.

[0067] 2. Suspension rate determination

[0068] Refer to GBT 14825-2006 Pesticide Suspension Rate Determination Method. The samples prepared in Example 3 and Example 4 were treated three times each. The suspension rate w (%) of the sample was calculated as follows:

[0069] W(%)=m2 / (m1+m2)×10 / 9×100……(1)

[0070] Where:

[0071] m1: The dry mass of the 10% fermentation broth remaining at the bottom of the measuring cylinder.

[0072] m2: dry mass of 90% fermentation liquid sucked out.

[0073] 10 / 9: Conversion factor.

[0074] The analysis revealed that the suspension rates of the samples prepared in Example 2 and Example 5 were 91.7% and 93.5% respectively, and the suspension rate reached 90%, so the suspension rate of the preparation was very good.

[0075] Example 8

[0076] This example provides the antibacterial effects of Trichoderma harzianum WXH-CF001 and Trichoderma harzianum T22 on Fusarium graminearum and Rhizoctonia solani.

[0077] The corn pathogens Fusarium graminearum and Rhizoctonia solani preserved in the laboratory were transferred from the glycerol tube to PDA for activation and cultured at 28°C. After the mycelium covered the plate, a puncher was used to punch a 4mm diameter cake. The cakes of Trichoderma harzianum WXH-CF001 and Trichoderma harzianum T22 were transferred to both sides of the PDA plate with Fusarium graminearum and Rhizoctonia solani, respectively. The two cakes were 5cm apart and cultured at a constant temperature of 28°C for 72h. The colony radius of Trichoderma and pathogens was observed and recorded. The plates inoculated with Fusarium graminearum and Rhizoctonia solani alone without Trichoderma were used as controls. Five plates were repeated for each treatment. The colony growth rate was measured to calculate the mycelium inhibition rate.

[0078] Calculation method of colony inhibition rate:

[0079] Inhibition rate = (colony diameter of control pathogens - colony diameter of treated pathogens) / (colony diameter of control pathogens - 0.5 cm) × 100%.

[0080] Figure 4 is the antibacterial effect on Fusarium graminearum in the embodiment of the present invention, Figure 5 is the antibacterial effect on Rhizoctonia solani in the embodiment of the present invention; Figure 4 , Figure 5 The test results show that Trichoderma harzianum WXH-CF001 has a good inhibitory effect on Fusarium graminearum and sheath blight. The inhibition rates after 72 hours of culture reached 59.18% and 63.16%, respectively, which are higher than the inhibitory effect of the control Trichoderma harzianum T22.

[0081] Table 1 The inhibitory effects of two kinds of Trichoderma harzianum on Fusarium graminearum and Rhizoctonia solani

[0082] deal with Inhibitory effect on Fusarium graminearum (%) Inhibitory effect on Rhizoctonia solani (%) Trichoderma harzianum WXH-CF001 59.18 63.16 Trichoderma harzianum T22 46.50 47.35

[0083] Example 9

[0084] This embodiment provides an application of treating corn seeds with a suspension containing Trichoderma oil to reduce plant height and increase stalk strength.

[0085] 1. Test materials

[0086] (1) Seed preparation: Select the appropriate corn variety Zhengdan 958 and perform seed treatment to ensure seed quality.

[0087] (2) Suspension concentrate containing Trichoderma oil: The products prepared in Examples 2-6 were diluted 100 times to prepare solutions that can be used for seed coating.

[0088] (3) Chemical treatment: Manshijin (1:500) + Ruisheng (20g:100kg).

[0089] 2. Test content

[0090] (1) Seed coating: The diluted Trichoderma oil suspension was evenly sprayed on the surface of corn seeds for 24 hours. The coated seeds needed to be dried before use. The blank control was replaced with clean water. Each treatment was repeated 3 times.

[0091] (2) Sowing and field management: The treated seeds are sown and managed in the field under appropriate conditions. Location:

[0092] Shanghai Jiaotong University Research Base. Plot design: row width 0.6m, row length 10m, 30 plants per row, two rows for one treatment. Field management: Fertilization on March 30, 40kg / 667m 2 ; Sow on April 7 and spray herbicide after sowing.

[0093] (3) Determination of plant height: At the early stage of corn growth, the plant heights of the treatment group and the control group were measured.

[0094] (4) Determination of stalk strength: In the middle and late stages of corn filling, 10 corn stalks were randomly selected from each treatment area, with 3 replicates for a total of 30 samples per treatment. The strength of the second and third sections of the corn stalks were measured using a microcomputer stalk strength measuring instrument (model YYD-1).

[0095] 3. Results Analysis

[0096] (1) Effects of different sample treatments on corn plant height

[0097] Table 2 Effects of the products of each embodiment on corn plant height

[0098]

[0099]

[0100] (2) Effects of different sample treatments on corn stalk strength

[0101] Table 3 Effect of the products of each embodiment on the strength of corn stalks

[0102] deal with Average strength of the second section of corn stalk (N) Average strength of the third section of corn stalk (N) Example 2 465.38 303.29 Example 3 449.12 301.29 Example 4 415.98 293.45 Example 5 474.29 311.78 Example 6 446.51 285.71 Chemical control 408.8 288.49 Blank control 434.05 285.54

[0103] From the above content, it can be seen that after the samples prepared in Examples 2 and 5 of the present invention were used to treat corn seeds, the height of corn plants in the early stage of corn tasseling was less than that of the chemical seed dressing agent, Examples 3, 4, 6 and the blank control; the strength of the second and third nodes of the stalks in the middle and late stages of corn filling was higher than that of the chemical seed dressing agent, Examples 3, 4, 6 and the blank control. The above indicators show that the corn seeds treated with the samples of the embodiments of the present invention can reduce the height of corn plants, enhance the strength of stalks, and reduce the lodging rate of corn plants in special weather conditions such as continuous rain and strong winds.

[0104] In summary, the present invention separates and purifies a strain of Trichoderma harzianum WXH-CF001 from the soil of a corn field in a protected cultivated land in Harqin Banner, Chifeng City, Inner Mongolia Autonomous Region. The present invention also discloses a suspension containing Trichoderma oil, which is prepared by uniformly mixing a Trichoderma spore concentrate, a biological enhancer, an adjuvant, and the like. It has been verified by experiments that the Trichoderma harzianum has a significant inhibitory effect on Fusarium graminearum and Rhizoctonia solani, which cause corn stalks to fall. After the prepared oil suspension is treated with corn seeds, the height of the corn plant can be reduced, the strength of the stalks can be enhanced, and the corn lodging can be effectively reduced, which has application potential in corn production in northern regions such as the Yanshan hilly area.

[0105] The above description is only a preferred embodiment of the present invention, and does not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the contents of the specification and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. A suspension concentrate containing Trichoderma oil, characterized in that: The Trichoderma sp. is Trichoderma sp. WXH-CF001, whose preservation number is CCTCC NO: M20232107, and the Trichoderma sp. is Trichoderma harzianum; the preparation composition of the oil suspension comprises: Trichoderma sp. WXH-CF001 spore concentrate, a biological synergist and an adjuvant; and the biological synergist is quercetin.

2. The Trichoderma oil-containing suspension according to claim 1, characterized in that The auxiliary agent includes at least one of an oil base, an emulsifier, a dispersant, and a protective agent.

3. The Trichoderma oil-containing suspension according to claim 1, characterized in that The oil suspension comprises the following components: fermentation spore concentrate of Trichoderma WXH-CF001, biological enhancer quercetin, oil base, emulsifier, dispersant and protective agent, and the ratio is 3-6: 0.01-0.2: 5-8: 1-4: 1-6: 1-4.

4. The Trichoderma oil-containing suspension according to claim 2 or 3, characterized in that: The oil base includes at least one of camellia oil, rapeseed oil, soybean oil and peanut oil; the emulsifier includes at least one of sodium lauryl sulfate, fatty alcohol polyoxyethylene ether, sodium lauroyl glutamate and sodium carboxymethyl cellulose.

5. The Trichoderma oil-containing suspension according to claim 2 or 3, characterized in that: The dispersant is at least one of poloxamer, sodium lignin sulfonate, SP-2836, GY-D10 and saponin powder.

6. The Trichoderma oil-containing suspension according to claim 2 or 3, characterized in that: The protective agent is at least one of trehalose, xanthan gum, humic acid, dextrin and sodium fluorescein.

7. Use of the Trichoderma oil-containing suspension concentrate as claimed in any one of claims 1 to 6 in corn lodging resistance.

Images