A shRNA targeting vitronectin gene and its application in treating ATTR-CA

Abstract

The present invention belongs to the field of biomedicine technology, and discloses a shRNA sequence targeting the vitronectin gene and its application in treating ATTR-CA. The present invention uses mice as a model and designs a shRNA targeting the vitronectin gene. The shRNA can significantly knock down the VTN expression level in the heart of the model mice, and significantly improve the heart failure condition of the ATTR-CA model mice. It is of great significance for treating ATTR-CA, and is convenient for further developing the shRNA sequence into a clinical therapeutic drug, which will have broad market application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a shRNA targeting vitronectin gene and an application thereof in treating ATTR-CA. Background Art

[0002] Transthyretin amyloidosis (ATTR-CA) is a disease in which the monomers formed by the depolymerization of transthyretin (TTR) synthesized in the liver are misfolded and then amyloid substances are deposited in the myocardial interstitium, causing myocardial lesions and eventually leading to severe heart failure. According to the presence or absence of TTR gene mutation, transthyretin amyloidosis (ATTR) can be divided into hereditary / mutant type (ATTRm) and wild type (ATTRwt).

[0003] Previous studies have shown that the prevalence of ATTR-CA in the general population is less than 0.5‰, making it a rare disease. With the continuous development of related diagnostic and treatment technologies, the academic community has a deeper understanding of it. A number of epidemiological studies have found that ATTRwt-CA may not be rare in specific populations such as patients with heart failure with preserved ejection fraction, patients with left ventricular hypertrophy, and patients with aortic valve disease. However, due to its lack of specificity in clinical manifestations and high misdiagnosis rate, the prevalence is greatly underestimated. In terms of its treatment, although the academic community has proposed some possible treatment methods or targets, such as liver transplantation, liver-heart combined transplantation, and stabilization of the tetramer structure of TTR protein, both surgical treatment and drug treatment still have certain limitations. Although liver-heart combined transplantation can improve patient symptoms, it faces problems such as lack of donors, inability to tolerate surgery in the late stage of the disease, lifelong immunosuppressive treatment after transplantation, and new deposition in the patient's myocardial tissue leading to new disease progression. In terms of drug treatment, although my country has approved the TTR tetramer stabilizer clofazodone soft capsules for the treatment of ATTR-CA in 2020, its annual treatment cost is high and the patient's symptoms improve slowly, bringing a huge economic burden to patients and their families.

[0004] Vitronectin (VTN) is a common component in the extracellular matrix. Previous proteomic studies of cardiac tissues of ATTR-CA patients have shown that VTN expression is significantly increased in areas of cardiac amyloid lesions. Our study also revealed the pathological value of VTN in amyloid deposition, indicating that VTN directly interacts with TTR amyloid fibers and may be involved in promoting ATTR-CA disease progression. Summary of the invention

[0005] The present invention provides a shRNA sequence targeting the vitronectin gene based on the direct interaction between vitronectin and TTR amyloid fibers. The shRNA sequence is used for the first time as a mouse model and can significantly knock down the VTN expression level in the heart of the model mice. The shRNA sequence can be used as a clinical drug for the treatment of human transthyretin cardiac amyloidosis (ATTR-CA).

[0006] The present invention provides a shRNA targeting vitronectin gene, wherein the shRNA sequence is shown as SEQ ID NO.1.

[0007] Furthermore, the shRNA sequence is used to silence the vitronectin gene.

[0008] Furthermore, the target sequence of the shRNA sequence is shown in SEQ ID NO.2.

[0009] Furthermore, the oligonucleotide sequence for cloning the shRNA sequence includes four oligonucleotide sequences as shown in p1 to 4:

[0010] Said p1:

[0011] GACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTAT GCTG;

[0012] Said p2:

[0013] GTCAGTCAGTGGCCAAAACATCTACGTCACTGGCTCCTTACAGCATACA GCCTTCAG;

[0014] Said p3:

[0015] TTTGGCCACTGACTGACATCTACGTCTGGCTCCTTACAGGACACAAGGC CTGTTACTAG;

[0016] Said p4:

[0017] ATCCAGAGGTTGATTAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGT AACAGGCCTT.

[0018] The present invention also provides the use of the above-mentioned shRNA targeting vitronectin gene in treating transthyretin amyloid cardiomyopathy.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The present invention discloses an shRNA sequence targeting the vitronectin gene. The shRNA sequence uses mice as a model and can significantly reduce the protein expression level of vitronectin in cardiomyocytes, thereby significantly improving the heart failure condition of ATTR-CA model mice. This is of great significance for the treatment of ATTR-CA, facilitates the further development of the shRNA sequence into a clinical therapeutic drug, and will have broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram showing the effect of using shRNA targeting vitronectin gene to silence vitronectin expression in Example 3 of the present invention, wherein A is a diagram showing the results of protein immunoblotting analysis, and B is a diagram showing the quantitative analysis of protein blotting analysis;

[0022] Figure 2 This is a statistical graph of the echocardiographic imaging results of the improvement effect of shRNA targeting the vitronectin gene on ATTR-CA mice in Example 4 of the present invention, wherein A is a quantitative analysis graph of the left ventricular ejection fraction of mice, B is a quantitative analysis graph of the thickness of the left ventricular free wall of mice, C is a quantitative analysis graph of the ratio of the peak-to-peak velocity of the mitral blood flow E in early diastole to the peak-to-peak velocity of the mitral blood flow A in late diastole of mice, and D is a quantitative analysis graph of the ratio of the peak-to-peak velocity of the mitral blood flow E in early diastole to the peak velocity of the mitral valve annulus e' in early diastole. DETAILED DESCRIPTION

[0023] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0024] Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art can make similar generalizations without violating the connotation of the present invention, so the present invention is not limited to the specific implementation disclosed below.

[0025] Example 1 Construction of sequence vector

[0026] The nucleotide sequence information of mouse vitronectin (Vtn) gene (NM_011707.2) was obtained through the GenBank database (http: / / www.ncbi.nlm.nih.gov / genbank), and then according to the design principles of shRNA, the shRNA sequence for mouse Vtn gene was designed, denoted as sh-Vtn, for silencing mouse Vtn gene. The target sequence of sh-Vtn is TAAGGAGCCAGTGACGTAGAT (SEQ ID NO.2), and four oligonucleotide sequences as shown in p1 to 4 were designed according to the target sequence to clone the sh-Vtn sequence:

[0027] p1:

[0028] GACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTAT GCTG;

[0029] p2:

[0030] GTCAGTCAGTGGCCAAAACATCTACGTCACTGGCTCCTTACAGCATACA GCCTTCAG;

[0031] p3:

[0032] TTTGGCCACTGACTGACATCTACGTCTGGCTCCTTACAGGACACAAGGC CTGTTACTAG;

[0033] p4:

[0034] ATCCAGAGGTTGATTAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGT AACAGGCCTT.

[0035] The above four oligonucleotide sequences were added to the same PCR amplification system to obtain a complete miRNA155 backbone sh-Vtn product containing homologous recombination arms, as shown below, namely SEQ ID NO.1:

[0036] GACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGTAAGGAGCCAGTGACGTAGATGTTTTGGCCACTGACTGACATCTACGTCTGGCTCCTTACAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAAGCTTAATCAACCTCTGGAT.

[0037] At the same time, the Scramble sequence was used as a control group, and a control shRNA sequence for the scramble sequence (labeled as sh-scrmb) was designed, and its target sequence was TTCTCCGAACGTGTCACGT. Four oligonucleotide sequences were designed for the target sequence and used to clone the sh-scrmb coding sequence into the adeno-associated virus vector GV683 (purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd.). The four oligonucleotide sequences designed for the Scramble target sequence are as follows:

[0038] P1:GACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGC TGTATGCTG;

[0039] P2:TCAGTCAGTGGCCAAAACTTCTCCGAACGTGTCACGTCAGCATA CAGCCTTCAG;

[0040] P3:TTTGGCCACTGACTGACTTCTCCGAGTGTCACGTCAGGACACAA GGCCTGTTACTAG;

[0041] P4:ATCCAGAGGTTGATTAAGCTTGGGCCATTTGTTCCATGTGAGTG CTAGTAACAGGCCTT.

[0042] The above four oligonucleotide sequences were added to the same PCR amplification system to obtain the complete miRNA155 backbone sh-scrmb product containing homologous recombination arms, as shown below:

[0043] GACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGACGTGACACGTTCGGAGAAGTTTTGGCCACTGACTGACTTCTCCGAGTGTCACGTCAGGACACAAGGCCTGTTACTAGCACTCACATGGAACAAATGGCCCAAGCTTAATCAACCTCTGGAT.

[0044] The above product was purified by DNA and constructed into the adeno-associated virus vector GV683 (purchased from Shanghai JiKai Gene Chemistry Technology Co., Ltd.) by In-fusion cloning method. After virus packaging, the shRNA adeno-associated virus was injected into the tail vein to infect ATTR-CA mice and evaluate its silencing effect.

[0045] Example 2: Construction of animal model

[0046] The mixture of the targeting vector, gRNA targeting the safe site and Cas9 mRNA was injected into the fertilized oocytes of 0.5-day-old C57BL / 6J mice, and then transplanted into the bodies of 0.5-day-old pseudo-pregnant female mice. After the mice were born, the targeted mice (F0) were screened by gene identification. The targeting vector contained the human wild-type TTR gene sequence:

[0047] GGCC CTACGG GCACCG GTGAAT CCAAGT GTCCTC TGATGGTCAAAG TTCTAG ATGCTGTCCGAG GCAGTC CTGCCA TCAATGTGGCCG TGCATG TGTTCA GAAAGG CTGCTG ATGACACCTGGGAGCCAT TTGCCT CTGGGA AAACCA GTGAGT CTGGAG AGCTGCATGGGC TCACAA CTGAGGAGGAAT TTGTAG AAGGGA TATACAAAGTGG AAATAG ACACCA AATCTT ACTGGA AGGCACTTGGCATCTCCC CATTCC ATGAGC ATGCAG AGGTGG TATTCA CAGCCAACGACT CCGGCC CCCGCCGCTACA CCATTG CCGCCC TGCTGAGCCCCT ACTCCT ATTCCA CCACGG CTGTCG TCACCAATCCCAAGGAAT GA

[0048] The safety site is Gm16090. Gm16090 is located on mouse chromosome 18 and is a safety site for inserting foreign genes.

[0049] The target sequence of the gRNA includes:

[0050] gRNA1: TCACAGGATCACTCACCGCGGGG;

[0051] gRNA2:GCTGAGTCTCTCAATTCTGGGGG.

[0052] The F0 generation was crossed with wild-type mice to obtain positive heterozygous animals of the F1 generation. The hTTR gene was identified in the F1 generation, and the heterozygous F1 mice with positive hTTR gene were multiplied and interbred to obtain ATTR-CA humanized homozygous mice. When the mice grew up to 6 months old, sh-scrmb and sh-Vtn were injected into the tail vein.

[0053] Example 3 Determination of Vtn protein expression in mouse myocardium

[0054] To clarify the expression of myocardial Vtn protein in ATTR-CA mice after infection with sh-Vtn, western blotting analysis was performed as follows: Mouse heart tissue lysate was homogenized in RIPA lysis buffer containing 1% protease phosphatase inhibitors. After centrifugation of the homogenate at 12,000 × g for 30 min at 4°C, we collected the supernatant and determined the protein concentration using a BCA protein assay kit. The supernatant was mixed with loading buffer and heated in a boiling water bath for 10 min. Equal amounts of prepared proteins were subjected to SDS-PAGE and blotted onto polyvinylidene difluoride membranes. The membranes were blocked with 5% skim milk and incubated with anti-Vtn (dilution concentration 1:1000) (Abcam), and anti-GAPDH (dilution concentration 1:1000) (CST) antibodies overnight at 4°C. The membranes were then incubated with HRP-conjugated secondary antibodies (1:5000) for 1 h at room temperature. The immunoreactive bands were detected using an enhanced chemiluminescence (ECL) system (Millipore, MA, USA). The results showed that the expression of Vtn protein in ATTR-CA mice after sh-Vtn infection was significantly reduced compared with that in sh-scrmb infected mice (***p < 0.0001). Figure 1 shown.

[0055] Example 4 Determination of heart failure in mice

[0056] Western blot analysis was performed to determine the improvement of heart failure in ATTR-CA mice after infection with sh-Vtn. Transthoracic echocardiography of mice was performed using a VisualSonics Vevo2100 system equipped with an MS400 transducer (Visual Sonics). LVEF and other systolic function indices were obtained from short-axis M-mode scans at the mid-ventricle level. Pulsed Doppler and tissue Doppler imaging at the level of the mitral valve was obtained in the apical four-chamber view for diastolic function measurements. Anesthesia was induced with 5% isoflurane and maintained at 1%-2% concentrations, with a heart rate maintained at 400-500 beats / min. Parameters collected included heart rate, LVEF, ratio of peak velocity of early diastolic mitral flow E to peak velocity of late diastolic mitral flow A, and ratio of peak velocity of early diastolic mitral flow E to peak velocity of early diastolic mitral annulus e'. The results showed that the ejection fraction of ATTR-CA mice infected with sh-Vtn was significantly improved compared with that of ATTR-CA mice infected with sh-scrmb, the ventricular wall thickness was significantly reduced, the ratio of the peak velocity of the mitral blood flow E in early diastole to the peak velocity of the mitral blood flow A in late diastole, and the ratio of the peak velocity of the mitral blood flow E in early diastole to the peak velocity of the mitral annulus e' in early diastole were significantly reduced (**p < 0.01), indicating that the diastolic function of ATTR-CA mice infected with sh-Vtn was significantly improved. Figure 2Therefore, the shRNA sequence targeting vitronectin gene provided by the present invention is expected to be developed into a drug molecule for treating ATTR-CA.

[0057] The preferred embodiments of the present invention disclosed above are only used to help illustrate the present invention. The preferred embodiments do not describe all the details in detail, nor do they limit the invention to the specific implementation methods described. Obviously, many modifications and changes can be made according to the content of this specification. This specification selects and specifically describes these embodiments in order to better explain the principles and practical applications of the present invention, so that those skilled in the art can understand and use the present invention well. The present invention is limited only by the claims and their full scope and equivalents.

Claims

1. Use of shRNA targeting vitronectin gene in the preparation of a drug for treating transthyretin amyloid cardiomyopathy, characterized in that: The shRNA sequence is shown in SEQ ID NO.

1.

2. Use of the shRNA according to claim 1 in the preparation of a drug for treating transthyretin amyloid cardiomyopathy, characterized in that: The shRNA sequence is used to silence the human vitronectin gene.

3. Use of the shRNA according to claim 1 in the preparation of a drug for treating transthyretin amyloid cardiomyopathy, characterized in that: The target sequence of the shRNA sequence is shown in SEQ ID NO.

2.

4. Use of the shRNA according to claim 2 in the preparation of a drug for treating transthyretin amyloid cardiomyopathy, characterized in that: The shRNA sequence cloned includes four oligonucleotide sequences as shown in p1 to 4: p1: GACGAGCTGTACAAGGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTG; p2: GTCAGTCAGTGGCCAAAACATCTACGTCACTGGCTCCTTACAGCATACAGCCTTCAG; The p3: TTTGGCCACTGACTGACATCTACGTCTGGCTCCTTACAGGACACAAGGCCTGTTACTAG; Said p4: ATCCAGAGGTTGATTAAGCTTGGGCCATTTGTTCCATGTGAGTGCTAGTAACAGGCCTT.

Images