An Arabidopsis thaliana MAP4K9 gene and its application in regulating the high-temperature tolerance of plants

Abstract

The present invention relates to an Arabidopsis thaliana MAP4K9 gene and its application in regulating the high-temperature tolerance of plants, belonging to the technical field of plant gene breeding. This gene has a nucleotide sequence as shown in SEQ ID NO.1, and the encoded protein of this gene has an amino acid sequence as shown in SEQ ID NO.2. By analyzing the MAP4K9 gene deletion mutant and the MAP4K9 overexpression transgenic Arabidopsis thaliana plants, the present invention finds that the MAP4K9 gene has a positive regulatory effect on the high-temperature tolerance of Arabidopsis thaliana plants, providing important theoretical significance and application value for regulating the high-temperature tolerance of plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic breeding, and particularly relates to an Arabidopsis thaliana MAP4K9 gene and its application in regulating the high-temperature tolerance of plants. Background Art

[0002] The frequent occurrence of global extreme high temperatures caused by climate change has a profound impact on plant ecology and seriously threatens the growth and development process of plants. At present, how plants perceive high-temperature signals, the transduction pathway of high-temperature signals, and the response mechanism of plants have become hot issues in the scientific community.

[0003] The mitogen-activated protein kinase (MAPK) cascade signaling pathway is a highly conserved and important signal transduction pathway that participates in regulating plant growth and development, biotic stress, and abiotic stress. The MAP4K protein family, as a new member of the MAPK pathway, participates in signal cascade transmission. The Arabidopsis thaliana MAP4K family has a total of 10 members, and a few reports show that it plays an important regulatory role in processes such as plant growth and development and immune response. However, there are few reports on whether this family participates in plant response to high-temperature stress. Summary of the Invention

[0004] The purpose of the present invention is to provide an Arabidopsis thaliana MAP4K9 gene and its application in regulating the high-temperature tolerance of plants in order to solve the above problems.

[0005] The present invention achieves the above purpose through the following technical solutions:

[0006] The present invention provides an Arabidopsis thaliana MAP4K9 gene, which has the nucleotide sequence shown in SEQ ID NO.1.

[0007] The present invention also provides an application of the above Arabidopsis thaliana MAP4K9 gene in regulating the high-temperature tolerance of plants.

[0008] As a further optimized scheme of the present invention, the MAP4K9 gene has a positive regulatory effect on the high-temperature tolerance of Arabidopsis thaliana plants.

[0009] The present invention also provides a coding protein of the above Arabidopsis thaliana MAP4K9 gene, which has the amino acid sequence shown in SEQ ID NO.2.

[0010] The present invention also provides a plasmid vector, which is obtained by inserting the above Arabidopsis thaliana MAP4K9 gene into a vector with an Arabidopsis thaliana gene overexpression vector as the backbone.

[0011] As a further optimized solution of the present invention, the Arabidopsis gene overexpression vector is the pCambia1300 vector.

[0012] The present invention also provides a genetically engineered host cell, which is an Agrobacterium competent cell containing the above plasmid vector.

[0013] The beneficial effects of the present invention are as follows:

[0014] By analyzing the MAP4K9 gene deletion mutants and MAP4K9 overexpressing transgenic Arabidopsis plants of the present invention, it is found that the MAP4K9 gene has a positive regulatory effect on the high temperature tolerance of Arabidopsis plants, providing important theoretical significance and application value for regulating the high temperature tolerance of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is an evolutionary tree analysis of the Arabidopsis MAP4K protein family;

[0016] Figure 2 It is the identification result of map4k7 and map4k9 mutants;

[0017] Figure 3 It is the phenotypic identification of map4k7 and map4k9 single mutants under high temperature stress treatment (A: Survival phenotypic diagram of map4k7 single mutant under high temperature stress; B: Survival statistical chart of map4k7 single mutant under high temperature stress, the number of experimental statistical samples exceeds 50, ns indicates no significant difference detected by T-test; C: Survival phenotypic diagram of map4k9 single mutant under high temperature stress; D: Survival statistical chart of map4k9 single mutant under high temperature stress, the number of experimental statistical samples exceeds 50, ** indicates that the t-test result < 0.01, there is a significant difference);

[0018] Figure 4 It is a schematic diagram of the construction of the MAP4K9 overexpression vector;

[0019] Figure 5 It is the phenotypic identification of the MAP4K9 overexpressing line under high temperature stress treatment (A: Observation of the growth and development phenotype of the MAP4K9 overexpressing line; B: Statistical chart of the number of flowering leaves of the MAP4K9 overexpressing line, that is, the statistical result of the total number of leaves under normal conditions, the number of experimental statistical samples exceeds 20; C: Survival phenotypic diagram of the MAP4K9 overexpressing line under high temperature stress treatment; D: Survival statistical chart of the MAP4K9 overexpressing line before and after high temperature stress treatment, the number of experimental statistical samples exceeds 50, ** indicates that the t-test result < 0.01, there is a significant difference);

[0020] Figure 6 It is the tissue pattern expression analysis of MAP4K9. Detailed implementation manners

[0021] The following further describes the present application in detail. It is necessary to point out here that the following specific implementation manners are only used to further illustrate the present application and cannot be construed as limiting the protection scope of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application according to the above application content.

[0022] 1. Materials

[0023] All reagents used in this experiment are conventional reagents without special instructions and are prepared with deionized water. All instruments used are conventional laboratory instruments.

[0024] All wild-type materials used in this experiment are Arabidopsis thaliana (L.) Columbia wild type (Col-0). The genetic backgrounds of T-DNA insertion mutants and overexpression plants are also Columbia type. The T-DNA insertion mutants were purchased from the ABRC seed bank in the United States.

[0025] The Q-PCR mix reagent used in this experiment is SYBR qPCR Master Mix from Novoprotein.

[0026] 1. Methods

[0027] 2.1. Phylogenetic tree analysis of Arabidopsis MAP4K protein family and identification of mutants

[0028] 2.1.1 Phylogenetic tree analysis of Arabidopsis MAP4K protein family

[0029] The Arabidopsis MAP4K family contains a total of 10 members. Sequence alignment analysis was performed on them and a phylogenetic tree was drawn using MEGA7 software. It was found that MAP4K1 and MAP4K2, MAP4K4 and MAP4K8, MAP4K5 and MAP4K6, and MAP4K7 and MAP4K9 are closer in evolution and have higher homology ( Figure 1 ).

[0030] 2.1.2 Identification of Arabidopsis MAP4K protein family mutants

[0031] To verify the function of the MAP4K9 gene, T-DNA insertion single mutants map4k7-2, map4k7-3 and map4k9-1, map4k9-2 of MAP4K9 and its closest relative MAP4K7 gene were obtained from the ABRC seed bank in the United States. Their T-DNA insertion sites are as Figure 2 shown. Enter the serial number of the mutant to be identified on the T-DNA primer design website ( http: / / signal.salk.edu / tdnaprimers.2.htmL), primers LP (forward primer), RP (reverse primer) and BP (middle primer) for identifying mutants were obtained, and the mutants were genotyped by PCR amplification using LP (forward primer), RP (reverse primer) and BP (middle primer). The results showed that these mutants were all homozygous mutants with T-DNA insertion ( Figure 2 ). Then, semi-quantitative PCR analysis was performed on the identified homozygous mutants to identify the gene expression levels in each mutant and determine whether they were loss-of-function mutants. The results of gene transcription levels showed that when the brightness of the internal reference gene UBQ10 was consistent, the mutants could not amplify the full-length transcripts of the corresponding genes, indicating that these mutants were all homozygous loss-of-function mutants ( Figure 2 ).

[0032] 2.2 Functional identification of the role of MAP4K9 gene in regulating plant response to high temperature stress

[0033] Four single mutants of map4k7 and map4k9 were respectively treated with high temperature stress. The treatment method was to subject Arabidopsis thaliana seedlings that had been growing normally on 1 / 2 MS antibiotic-free medium for 7 days to a constant temperature water bath at 45 °C for 15 min, and then culture them under normal conditions at 22 °C for observation.

[0034] The results showed that the survival rates of the two map4k7 (map4k7-2 and map4k7-3) single mutants were close to that of the wild type after high temperature stress treatment, both between 45% and 55% ( Figure 3 A and Figure 4 B), indicating that MAP4K7 may not be involved in plant response to high temperature stress. However, the two MAP4K9 (map4k9-1 and map4k9-2) single mutants were more sensitive to high temperature stress than the wild type after high temperature stress treatment, and their survival rates were both less than 30% ( Figure 3 C and Figure 3 D), indicating that MAP4K9 is involved in the regulation of plant response to high temperature stress.

[0035] 2.3 Obtaining and identification of MAP4K9 overexpressing plants

[0036] 2.3.1 Obtaining T1 generation materials and T3 generation homozygous materials of MAP4K9 overexpression

[0037] According to the published MAP4K9 (accession number At1g23700, whose nucleotide sequence and amino acid sequence are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively) sequence, the full-length sequence of the MAP4K9 gene was cloned from Arabidopsis thaliana. XbaI and BglII restriction enzyme sites were introduced at both ends of the MAP4K9 gene fragment. The vector with pCambia1300 as the backbone and the MAP4K9 gene fragment containing the above restriction enzyme sites were digested with XbaI and BglII for double enzyme linearization. The target gene fragment was ligated to the vector with pCambia1300 as the backbone. The GFP gene was tandemly linked to the N-terminus of MAP4K9 and the MAP4K9 gene was driven by the CaMV35S promoter to obtain the p35S::MAP4K9-GFP overexpression vector( Figure 4 ).

[0038] The primers used to clone the full-length sequence of the MAP4K9 gene from Arabidopsis thaliana are as follows:

[0039] F: ATGGATGAACTATAC AGATCT ATGACGAGTTCACCGGAAACGAGA

[0040] R: GTGATTTTTGCGGAC TCTAGA CTAGCTGAGCATTTTCTGTTTTGT

[0041] The underlined parts are the introduced restriction enzyme sites.

[0042] The p35S::MAP4K9-GFP overexpression vector was transferred into Agrobacterium tumefaciens and transformed into wild-type Arabidopsis thaliana by the floral dip method. The harvested seeds were screened on 1 / 2 MS medium containing Hyg antibiotic, and a total of 25 positive seedlings were obtained, which were then transplanted into soil. Subsequently, leaf samples were taken from these 25 positive seedlings, and the content of MAP4K9-GFP protein in the plants was detected by Western Blot experiment. The results showed that protein bands appeared at 81.7KDa in 4 positive seedlings, while no protein bands appeared at this position in the wild type, indicating that the protein expression level of overexpressed MAP4K9 was relatively high in these 4 plants.

[0043] To obtain stable homozygous materials with overexpression of MAP4K9, in this example, 2 positive seedlings with the highest protein content expression, namely 13# and 16#, were selected from the above 4 plants for screening in the T2 generation. The obtained T1 generation seeds were spread on 1 / 2 MS medium containing Hyg antibiotic, and the surviving T2 generation plants were transplanted into soil. Then, single-plant harvesting and homozygous screening were carried out on the T2 generation positive seedlings to obtain the T3 generation overexpression homozygous lines of MAP4K9, p35S::MAP4K9-GFP13# and p35S::MAP4K9-GFP16#.

[0044] 2.3.2. Phenotypic identification and heat tolerance analysis of MAP4K9 overexpression homozygous lines

[0045] To observe whether there are phenotypic differences between MAP4K9 transgenic overexpressing plants and the wild-type Col-0 under normal growth and development conditions, p35S::MAP4K9-GFP13# and p35S::MAP4K9-GFP16# were grown together with the wild-type under normal conditions. The results showed that under normal growth conditions, there were no obvious differences in phenotype and flowering time between the MAP4K9 overexpressing plants and the wild-type ( Figure 5 A and Figure 5 B). This indicates that overexpression of MAP4K9 does not change the normal growth and development of plants.

[0046] To further confirm whether MAP4K9 is involved in the high-temperature stress response, p35S::MAP4K9-GFP13# and p35S::MAP4K9-GFP16# were subjected to high-temperature stress treatment. Arabidopsis seedlings that had been growing normally on 1 / 2 MS antibiotic-free medium for 7 days were treated in a constant-temperature water bath at 45 °C for 15 min, and then cultured and observed under normal conditions at 22 °C. The results showed that the survival rate of the overexpressing plants was between 70% and 85%, indicating that overexpression of the MAP4K9 gene can significantly improve the heat tolerance of plants ( Figure 5 C and Figure

[0047] 5D). The above results indicate that MAP4K9 does not affect the growth and development of plants, but can enable plants to resist high-temperature stress.

[0048] 2.4. Tissue expression pattern of MAP4K9 gene

[0049] To explore the expression levels of the MAP4K9 gene in different tissue parts of Arabidopsis thaliana, tissues in the roots, leaves, flowers, fruit pods and seedlings of Arabidopsis thaliana were sampled, and RNA was extracted from these parts and reverse transcribed into cDNA. Q-PCR experiments were used to detect the expression levels of MAP4K9 in each tissue.

[0050] It was found that MAP4K9 was expressed in various tissues of plants, but the expression level was the highest in flowers ( Figure 6 ). This result indicates that MAP4K9 is likely to promote heat resistance during the reproductive growth period of plants, thereby reducing the impact of high temperature stress on plant fruiting.

[0051] 3. Conclusions

[0052] ① MAP4K9 is involved in the regulation process of plant response to high temperature stress;

[0053] ② Overexpression of MAP4K9 can significantly improve the high temperature tolerance of Arabidopsis plants;

[0054] ③ Tissue pattern expression analysis found that MAP4K9 was expressed in the roots, leaves, flowers, fruit pods and seedlings of plants, but the expression level was the highest in flowers.

[0055] The above-described embodiments only express several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention.

Claims

1. Overexpression MAP4K9 Application of the gene in positively regulating the high temperature tolerance of Arabidopsis thaliana plants, characterized in that The nucleotide sequence of this gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by this gene is shown in SEQ ID NO.2; The said MAP4K9 Overexpression of the gene improves the high-temperature tolerance of Arabidopsis plants.

Images