Method for creating a new strain of fish resistant to viral infection

Abstract

The application discloses a method for creating a new strain of Carassius auratus gibelii with resistance to Cyprinid herpesvirus 2 (CyHV2) infection, and the method is characterized in that a gene editing technology is used to target knockout gsdf-a a gene and gsdf-b a gene, and an experimental animal infection model of a homozygous knockout strain of the gene obtained by the technology is established. gsdf Results of the experimental animal infection model show that gsdf the CyHV2 infection resistance of the CyHV2 gene knockout Carassius auratus gibelii is significantly enhanced, the histopathological damage of the Carassius auratus gibelii after being infected with the virus is reduced, the expression of a virus protein ORF47 in liver tissue of the Carassius auratus gibelii is reduced, and the transcription level of a virus gene orf46r is significantly reduced. The new strain of Carassius auratus gibelii created by the method can avoid exogenous gene pollution, and has the advantages that the CyHV2 infection resistance of the Carassius auratus gibelii is significantly enhanced.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of fish disease-resistant breeding, and particularly relates to a method for creating a new strain of Carassius auratus gibelio resistant to Carassius auratus gibelio herpesvirus 2 infection. BACKGROUND

[0002] Gsdf (Gonadal Soma-Derived Factor) is a member of the TGF-beta family, which plays an important role in regulating gonadal development and germ cell differentiation. This gene family is mainly found in many animals, including fish, reptiles and mammals.

[0003] Currently, research on Gsdf has mainly focused on its reproductive-related functions. On the one hand, the gsdf gene plays a crucial role in gonadal development. Gonads are important organs in the reproductive system of organisms, responsible for the production of germ cells and the regulation of sex hormone secretion. The gsdf gene directly affects the reproductive capacity of individuals by regulating the formation and development of gonads. In many fish, the expression of the gsdf gene is closely related to the determination of male and female sex, providing an important molecular regulatory mechanism for sex determination; on the other hand, the gsdf gene also plays a key regulatory role in germ cell differentiation. Germ cells are an indispensable part of the reproduction process, and their differentiation process is regulated by multiple factors. The gsdf gene affects the fate and function of germ cells by participating in the signaling pathways of germ cell differentiation. This is crucial for successful reproduction and provides important molecular support for the continuation of life.

[0004] In addition, the study of the gsdf gene has far-reaching significance for understanding the mechanisms of sex determination, sex-related diseases, and the regulation of the reproductive process. By studying the gsdf gene and its regulatory network in depth, scientists can better understand the molecular mechanisms of biological sex development, providing new theoretical foundations and practical guidance for the development of biology, medicine and biotechnology. As an important member of the biological gene family, the gsdf gene plays an indispensable role in gonadal development and germ cell differentiation. In-depth study of the gsdf gene not only helps to reveal the molecular mechanisms of biological sex development, but also provides an important basis for scientific research and application research in related fields. However, the current research on the function of the gsdf gene in the process of antiviral immunity is relatively limited, and the influence of Gsdf on the antiviral process of fish is still unclear. SUMMARY

[0005] In order to solve the problem of Cyprinus carpio herpesvirus type Ⅱ (CyHV2) infection in Carassius auratus, the application provides a method for creating a new strain of Carassius auratus resistant to CyHV2 infection. After knocking out the gsdf gene, the survival rate model of experimental animals proves that the method plays a significant protective role in Carassius auratus infected with CyHV2.

[0006] To achieve the above-mentioned purpose, the application adopts the following technical solutions:

[0007] A method for creating a new strain of fish resistant to viral infection, comprising targeted knockout of gsdf-A gene and gsdf-B gene. The specific method comprises the following steps:

[0008] (1) Mix Cas protein and sgRNA targeting gsdf-A gene and gsdf-B gene, and inject into mature fish eggs of Carassius auratus, and artificially fertilize the injected fish eggs with Xingguo red carp sperm, and obtain F0 generation by gynogenesis;

[0009] (2) Select individuals with knockout of gsdf-A gene and gsdf-B gene for gynogenesis for two consecutive generations, and screen to obtain a homozygous mutant line of gsdf gene;

[0010] Preferably, the sgRNA sequence targeting the gsdf-A gene is shown as SEQ ID NO. 1, and the sgRNA sequence targeting the gsdf-B gene is shown as SEQ ID NO. 2.

[0011] Preferably, the primer sequence for detecting the gsdf-A gene is shown as SEQ ID NO. 3 and 4, and the primer sequence for detecting the gsdf-B gene is shown as SEQ ID NO. 5 and 6.

[0012] The reagent for constructing Carassius auratus resistant to Cyprinus carpio herpesvirus type Ⅱ infection comprises Cas protein and specific sgRNA targeting gsdf gene. Preferably, the sgRNA sequence targeting the gsdf-A gene is shown as SEQ ID NO. 1, and the sgRNA sequence targeting the gsdf-B gene is shown as SEQ ID NO. 2.

[0013] gsdf gene knockout Carassius auratus (gsdf-A - / - / - + gsdf-B - / - / -The anti-CyHV2 infection ability of the gsdf gene knockout gibel carp: the survival rate of the gibel carp infected with CyHV2 is significantly improved from 0% to 100% compared with the wild type gibel carp; the pathological damage of the tissues of the wild type and the gsdf gene knockout gibel carp after infection is detected, and it is found that the pathological damage of the gsdf gene knockout gibel carp is significantly reduced; further detection of the virus replication in the tissues of the wild type and the gsdf gene knockout gibel carp after infection shows that the expression amount of the virus protein (ORF47) in the liver, spleen and head kidney of the gsdf gene knockout gibel carp is significantly reduced, and the transcription level of the virus gene ORF46R is significantly inhibited.

[0014] The present application has the advantages of:

[0015] The gibel carp is an important mass freshwater aquaculture fish, and the present application knocks out the original gene gsdf (gsdf-A+gsdf-B) based on gene editing technology, does not introduce exogenous genes, avoids gene pollution, and thus obtains a gibel carp with strong anti-CyHV2 infection ability, which has important significance in fish disease-resistant breeding. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 The peak graph for F0 generation gibel carp gsdf gene knockout detection.

[0017] Figure 2 The schematic diagram for constructing a gsdf gene homozygous knockout strain.

[0018] Figure 3 The wild type gibel carp and the gsdf-A - / - / - +gsdf-B - / - / - The survival rate of the gibel carp after being infected with CyHV2.

[0019] Figure 4 The wild type gibel carp and the gsdf-A - / - / - +gsdf-B - / - / - The tissue pathological section of the gibel carp after being infected with CyHV2.

[0020] Figure 5 The wild type gibel carp and the gsdf-A - / - / - +gsdf-B - / - / - The expression level of the virus protein ORF47 in the tissue of the gibel carp after being infected with CyHV2.

[0021] Figure 6 The wild type gibel carp and the gsdf-A - / - / - +gsdf-B - / - / - The transcription level of the virus gene ORF46R in the tissue of the gibel carp after being infected with CyHV2. DETAILED DESCRIPTION

[0022] Example 1: Method for establishing a gsdf gene homozygous knockout strain

[0023] 1 Obtaining two duplicated gsdf paralog gene sequences (gsdf-A and gsdf-B)

[0024] 1.1 Full-length cloning of Carassius auratus gsdf cDNA (gsdf-A and gsdf-B)

[0025] According to the genomic sequence of the reference triploid Carassius auratus (GCA_019843895.2), six gsdf transcripts were cloned from the mature testis of Carassius auratus DA line by RACE PCR technology, and clustered into two paralogous genes gsdf-A and gsdf-B. The gsdf-A gene and the gsdf-B gene have three sequence highly consistent alleles, respectively.

[0026] 1.2 Target site design

[0027] According to the sequence difference of gsdf-A and gsdf-B in the exon, the knockout target specific to gsdf was designed, and the sequence of gsdf-A target site was ACAGCAGATGCCTCAGGTGT, and the sequence of gsdf-B target site was GCAAGGGAGACCTGGAAATC.

[0028] 1.3 Preparation of sgRNA

[0029] The primers specific to the target sites of gsdf-A and gsdf-B were synthesized, and the sequences were as follows: gsdf-A-gRNA-F: 5'-GTAATACGACTCACTATAGACAGCAGATGCCTCAGGTGTGTTTTAGAGCTA GAAATAGC-3', gsdf-B-gRNA-F: 5'-GTAATACGACTCACTATAGGCAAGGGAGACCTGGAAATCGTTTTAGAGCT AGAAATAGC-3', and gsdf-A / B-gRNA-R: 5'-AAAAGCACCGACTCGGTGCC-3'.

[0030] Using pUC19-gRNA plasmid as a template, the sgRNA was amplified by PCR with the primers of gsdf-A / B-gRNA-F and gsdf-A / B-gRNA-R. PCR amplification was performed using Max DNA Polymerase (Takara) high-fidelity DNA polymerase. The 50 μL PCR amplification system consisted of: 25 μL PrimeSTAR Max Premix (2×), 1 μL gsdf-A / B-sgRNA-F primer (10 μM), 1 μL gsdf-A / B-sgRNA-R primer (10 μM), 1 μL pUC19 gRNA plasmid template, and 22 μL sterile water. The PCR amplification program was: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 58℃ annealing for 20 s, 72℃ extension for 10 s, 37 cycles; and a final extension at 72℃ for 10 min.

[0031] The presence of a single PCR band of approximately 120 bp was confirmed by electrophoresis of 2 μL of PCR product in 1.5% agarose gel with Gel-Red DNA staining. The PCR product was then purified and recovered by gel extraction using a Gel Extraction Kit (Omega). Finally, the purified gsdf-A-sgRNA and gsdf-B-sgRNA transcription templates were obtained by eluting the product in 25 μL of nuclease-free water into nuclease-free EP tubes.

[0032] The templates were transcribed in vitro using the TranscriptAid T7 High Yield Transcription Kit (Thermo Fish Scientific), and the transcribed products were purified and recovered using lithium chloride precipitation to obtain gsdf-A-sgRNA and gsdf-B-sgRNA, the sequences of which are shown in SEQ ID NO.1 and 2.

[0033] The concentrations of gsdf-A-sgRNA and gsdf-B-sgRNA were determined using a Nanodrop 2000c (Thermo Fish Scientific). 200 ng of sgRNA was stained with Gel-Red on a 1.5% agarose gel for RNA detection. The remaining sgRNA sample was aliquoted and stored at -80°C for later use.

[0034] 1.4 Microinjection and fertilization of mature fish eggs

[0035] Mix 2 μL gsdf-A-sgRNA (500 ng / μL), 2 μL gsdf-B-sgRNA (500 ng / μL), 0.5 μL Cas9 protein, and 0.5 μL nuclease-free water in a 0.2 mL nuclease-free EP tube. Place the nuclease-free EP tube containing the mixture on ice for temporary storage, and wait to transfer it to a microinjection needle for microinjection. 5 μL of the mixture can be injected into approximately 1500 mature silver carp eggs.

[0036] Approximately 300 mature DA strain silver carp eggs were spread evenly in a 10cm sterile culture dish. The mixture was injected into the mature silver carp eggs using a nitrogen-pressurized PLI100 quantitative microinjection instrument (Harvard), with each injection volume being 1-2 nL. Sperm from Xingguo red carp (Cyprinus carpio) was mixed with the microinjected mature eggs for artificial insemination. The fertilized eggs were then transferred to an incubation tank at a water temperature of 22-23℃ for hatching to obtain the F0 generation (gsdf gene knockout chimera).

[0037] In the F0 generation, to detect the mutation efficiency of the target sites, the detection primers for the gsdf-A target site were designed as Detect-FA: 5′-GCCAGTGTAGATAAATCCCTGC-3′ and Detect-RA: 5′-GTCAGACGAGCACGATGAGGTCA-3′, and the detection primers for the gsdf-B target site were designed as Detect-FB: 5′-CTGGATATCTTCATAAAGCTTGTC-3′ and Detect-RB: 5′-CATCTTCGACATGGACACACGAGG-3′.

[0038] Twelve gene-edited F0 generation silver carp fry and four wild-type silver carp fry were randomly selected. Genomic DNA was extracted from each fry individually using a magnetic bead-based animal tissue genomic DNA purification kit (Hangzhou Bigefei Biotechnology Co., Ltd.). The genomic DNA from each fry was used as a template for PCR amplification using gsdf-A and gsdf-B target site detection primers. The 50 μL PCR amplification system consisted of: 25 μL PrimeSTAR Max Premix (2×), 1 μL Detect-FA / B (10 μM) primer, 1 μL genomic DNA template, and 22 μL sterile water. The PCR amplification program was: 94℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 58℃ annealing for 20 s, 72℃ extension for 30 s, 35 cycles; and a final extension at 72℃ for 10 min.

[0039] The size of the target band was verified by electrophoresis of 2 μL of PCR product on a 1.5% agarose gel with Gel-Red DNA staining. The PCR product was then purified and recovered using a Gel Extraction Kit (Omega). The purified PCR product was sent to a sequencing company (Wuhan Aikon Biotechnology Co., Ltd.) for sequencing. The results showed a double peak at the designed knockout target site, indicating successful knockout. Figure 1 ).

[0040] Eggs from successfully knocked-out F0 generation chimeras were artificially fertilized with Xingguo red carp and hatched via gynogenetic reproduction to produce the F1 generation. Fin DNA was extracted from the F1 fry, and PCR amplification was performed using gsdf-A and gsdf-B target site detection primers. The purified PCR products were then analyzed using pMD... TM Ligation was performed using the 18-T Vector Cloning Kit (Takara). The ligation system consisted of 1 μL pMD18-T Vector, 1 μL (200-300 ng) of purified PCR product, 5 μL Solution I, and 3 μL sterile water; the reaction was carried out at 16°C for 60 min. 5 μL of the ligation product was added to 50 μL of DH5α competent cells, mixed, and incubated on ice for 20 min, followed by a 42°C water bath for 90 s and then an ice bath for 30 min. 50 μL of the mixture was then plated on an agarose plate containing Amp and incubated overnight at 37°C. Single colonies were selected and sent to a sequencing company for sequencing. Homozygous deletion mutants of *G. spp. gsdf* were screened. Eggs from the homozygous F1 strain obtained through screening underwent gynogenesis to form the *G. spp. gsdf* homozygous deletion mutant line F2.

[0041] Example 2: Effect of gsdf gene knockout on the survival rate of crucian carp infected with CyHV2

[0042] The experiment was conducted in an aquarium measuring 70.5cm × 48cm × 38cm, with daily water changes and the water temperature maintained at approximately 22℃. Approximately 5g of healthy silver carp were injected intraperitoneally with a CyHV2 virus suspension (5 × 10⁻⁶). 7 TCID 50 Artificial infection models were established using *gsdf* ( / mL) and wild-type silver crucian carp (WT) and *gsdf* knockout silver crucian carp (gsdf-A). - / - / - +gsdf-B - / - / - WT group fish were injected intraperitoneally with 5 μl of virus suspension per fish, with 30 fish in each group. Mortality was recorded daily after infection, up to 10 days post-infection (dpi), and survival rate was analyzed using Mantel-Cox. The results showed that the survival rate of WT group fish infected with CyHV2 was 0 on day 7, while gsdf-A... - / - / - +gsdf-B - / - / - No deaths were observed in the group of silver carp, and the survival rate increased to 100%, which shows that gsdf-A - / - / - +gsdf-B - / - / - Silver carp have a significant ability to resist crucian carp herpesvirus infection. Figure 3 ).

[0043] Example 3: Effect of gsdf gene knockout on pathological damage in crucian carp infected with CyHV2

[0044] Three days after CyHV2 challenge in Example 2, silver carp were anesthetized with an ice bath. The abdominal skin was cut open, and liver, spleen, and head and kidney tissues were removed sequentially. Each tissue was fixed overnight at room temperature in 1 mL of Born's solution for subsequent H&E staining. The next day, the tissue blocks were removed from Born's fixative, rinsed three times with PBS, and placed in a dehydration box. Gradient ethanol was used in a dehydrator for dehydration in the following order: 75% ethanol for 4 h, 85% ethanol for 2 h, 90% ethanol for 2 h, 95% ethanol for 1 h, anhydrous ethanol for 30 min, benzene treatment for 10 min, xylene treatment for 10 min, xylene treatment for 10 min, molten paraffin I at 65°C for 1 h, molten paraffin II at 65°C for 1 h, and molten paraffin III at 65°C for 1 h. The paraffin-impregnated tissue blocks were embedded using an embedding machine. The paraffin blocks were cut into 5 μm thick sections using a paraffin sectioner. The sections were then placed on a slide spreader with a brush and stained at 4... After the tissue is flattened in 0℃ warm water, it is lifted with a glass slide and placed in a 60℃ oven to bake. After the paraffin block is completely melted, it is removed and stored at room temperature for later use. The sections are then treated sequentially with xylene I for 20 min, xylene II for 20 min, anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, and 75% ethanol for 5 min, and rinsed with water. The sections are then stained with hematoxylin for 3-5 min, rinsed with water, differentiated with differentiation solution, rinsed with water, blued with dilute ammonia, and rinsed with water. The sections are then dehydrated sequentially with 85% and 95% ethanol concentration gradients for 5 min, and stained with eosin for 5 min. The sections are then permeabilized sequentially with anhydrous ethanol I for 5 min, anhydrous ethanol II for 5 min, anhydrous ethanol III for 5 min, and xylene for 5 min. Finally, the sections are mounted with neutral resin and examined under a microscope to observe histopathological changes. The results showed that after WT group silver carp were infected with CyHV2, numerous necrotic lesions appeared in the liver, spleen, and head kidney tissues, with loose tissue structure and indistinct cell boundaries. - / - / - +gsdf-B - / - / - The silver carp group had a dense tissue structure, with cells arranged evenly and neatly, and no obvious pathological damage was observed. Figure 4 ).

[0045] Example 4: Detection of viral load in tissues of wild-type and gsdf knockout crucian carp infected with CyHV2

[0046] The expression of the viral protein ORF47 in different tissues of wild-type and gsdf-knockout crucian carp infected with CyHV2 was examined. Wild-type crucian carp and gsdf-A in Example 2 were also examined. - / - / - +gsdf-B - / - / -Three days after infection, silver carp were anesthetized with an ice bath, and liver, spleen, and head kidney samples were harvested. The tissues were lysed using an appropriate amount of RIPA weak lysis buffer. One-quarter volume of 5×SDS Sample Buffer was added to the tissue samples, vortexed, and incubated in a boiling water bath at 100°C for 15 min. The samples were then placed on ice for later use. Western blotting was used to detect the expression level of the viral protein ORF47 in gsdf knockout and wild-type silver carp (two biological replicates per group). The results showed that the expression of the viral protein ORF47 in the tissues (liver, spleen, and head kidney) of gsdf knockout silver carp was significantly reduced. Figure 5 ).

[0047] Example 5: Detection of viral gene transcription levels in tissues of wild-type and gsdf knockout crucian carp infected with CyHV2

[0048] The transcriptional levels of the viral gene ORF46R were detected in different tissues of wild-type and gsdf-knockout crucian carp infected with CyHV2. Wild-type crucian carp and gsdf-A in Example 2 were also examined. - / - / - +gsdf-B - / - / - Three days after infection, silver carp were anesthetized in an ice bath, and liver samples were dissected to extract total RNA. The RNA was reverse transcribed and then detected by qPCR (primer sequences FP: 5′-GTGGTTGTCTGAGCCTGTG-3′, RP: 5′-GCTGCTTGGGTAGCTTGT-3′). The results showed that the transcription level of the viral gene ORF46R was significantly reduced in silver carp tissues knocked out by gsdf. Figure 6 ).

Claims

1. A method for creating a new strain of Carassius auratus gibelio resistant to infection by Herpesvirus carassius type II, characterized by, Including targeted knockout gsdf-A gene and gsdf-B gene, the sgRNA sequence of the targeted gsdf-A gene is shown as SEQ ID NO. 1, the sgRNA sequence of the targeted gsdf-B gene is shown as SEQ ID NO. 2; after mixing Cas 9 protein and sgRNA targeting gsdf-A gene and gsdf-B gene, the sgRNA sequence of the targeted gsdf-A gene is shown as SEQ ID NO. 1, the sgRNA sequence of the targeted gsdf-B gene is shown as SEQ ID NO. 2; after mixing Cas 9 protein and sgRNA targeting gsdf gene and gsdf-A gene, the primer sequence of the targeted gsdf-B gene is shown as SEQ ID NO. 5 and 6.

2. A reagent for constructing a silver crucian carp resistant to infection with a herpesvirus type II of the crucian carp, characterized in that, comprising a Cas 9 protein and a specific sgRNA targeting gsdf a gene, the sgRNA sequence targeting gsdf-A a gene, the sgRNA sequence targeting gsdf-B a gene, the sgRNA sequence targeting

Images