Application of GDF5OS gene as a molecular marker for acute myeloid leukemia

Abstract

The present invention relates to a specific primer pair for detecting the level of GDF5OS RNA, the specific primer pair comprising a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3, and the GDF5OS sequence is shown in SEQ ID NO.1. The present invention provides a more accurate judgment method for the diagnosis of acute myeloid leukemia based on the RNA level of the novel biomolecular marker GDF5OS in combination with other clinical indicators.

Description

Technical Field

[0001] The present invention relates to the field of tumor molecular biology, and in particular to a detection method and application of biological molecular markers. Background Art

[0002] Tumors are one of the main causes of death in humans. Their incidence has a significant age difference, but in recent years, there has been a trend of younger age. Tumors can be divided into two categories: benign and malignant according to their degree of malignancy. During the research process, the main focus is on tumor prevention, early detection, early diagnosis and early treatment. At present, tumors are one of the main diseases that endanger national health. Therefore, many diseases, including blood system tumors, urgently need to be studied and explored.

[0003] Acute myeloid leukemia (AML) is a highly heterogeneous clonal disease that arises from uncontrolled proliferation, limited apoptosis, and impaired differentiation / maturation of hematopoietic stem / progenitor cells in the bone marrow. The etiology of AML is complex, and clinical outcomes vary. The diagnosis of AML requires comprehensive consideration of multiple factors. In addition to clinical symptoms, signs, morphology, and immunological characteristics, cytogenetics and molecular biology are also good reference indicators. In addition, biomarkers have a vital reference value in predicting the prognosis of AML patients and stratifying treatment risks. With the development of molecular diagnostic technology and new drug chemotherapy in recent years, leukemia can now be cured in 35% to 40% of adult patients under 60 years old and 5% to 15% of patients over 60 years old, but relapse is still a common condition of AML. Therefore, the correct identification of new and reliable molecular markers is still a clinical need for precise individualized treatment of AML, which helps to achieve more accurate diagnosis, evaluate the clinical prognosis of patients, and promote the formulation of more reasonable and effective treatment plans, provide new molecular markers for auxiliary diagnosis and prognosis judgment of AML patients, lay the foundation for the development of new molecular targeted treatment methods, and provide the possibility of guiding individualized stratified treatment of patients.

[0004] GDF-5 belongs to the TGFβ superfamily, which is essential for cartilage development and homeostasis. Lack of GDF-5 may be one of the factors leading to the occurrence and development of osteoarthritis. After GDF-5 binds to BMPR-IB, BMPR-II and activin type II receptor, it activates the downstream Smad pathway. Phosphorylated Smad 1 / 5 / 8 forms a complex with Smad 4 and translocates to the nucleus, thereby regulating cell growth and development processes, such as proliferation, differentiation and synthesis of extracellular matrix. In addition, it also participates in the occurrence and development of tumors by regulating tumor cell proliferation and differentiation. GDF5OS (GDF5-AS1) is the reverse sequence of GDF-5. As a long non-coding RNA, its clinical significance remains to be elucidated. Summary of the invention

[0005] The present invention is mainly based on the RNA level of GDF5OS in acute myeloid leukemia (AML), and detects the level difference of GDF5OS in AML and normal control by quantitative PCR technology, so as to use it as a new biomolecular marker for AML patients and provide support for auxiliary diagnosis of AML in clinical practice.

[0006] The present invention will achieve the above-mentioned invention object through the following technical solutions:

[0007] A first aspect of the present invention provides a specific primer pair for detecting the level of GDF5OS RNA, the specific primer pair comprising a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3, and the GDF5OS sequence is shown in SEQ ID NO.1.

[0008] Preferably, the sequence of SEQ ID NO.1 is as follows:

[0009] agggatctattttggagacaacaaacttgactaaggaatctcaagaagaaaatataattctgctgccaggccccaatggagcaaatagag

[0010] ctcgggacccaggggcctttggaaggaacaggaatgcggttagaggagtgcaggaaggggctcttggggatgtgccacccaggaaga

[0011] cagagggccagtgctgctacctgcagccacacgactccacgaccatgtcctcatactgcttatacaccacgttgttggcagagtcaatga

[0012] agaggatgctgatgggactcagccgcgtgggcacacagcaggtgggtggtgtggactcggggtccatggagttcatcagggtctggat

[0013] gactgcatgattcgtgggctccaggtgggagcgcaatgggaactcgcacagcccctcgcagtggaaagcctcgtactcaaggggtgc

[0014] gatgatccagtcgtcccagcccatgtccttgaagttgacatgcagtgccttccgactgcagcgagccttaaggttcttgctgggtcgcttgc

[0015] cctggcgagtggccagtggggcccgccgttttcgccgctggctgaacaggtactcatacacggtctttatcgtcctggccagagcgggcc

[0016] ttaatctcattaaagaacaggtcccgtttcttggtgcggccaaacaccaggaacagggctttctcgtggacctgccgggcggcgcggtcg

[0017] aagcccaggccacggaggtccacggccctgccccgttcccaggcctccagctccaggcacagctgggccgagttcttaaagtttcgga

[0018] agagcttccagatgtcgaacacctcccagccagatccgtccaggcctggcacggagcgcacatccagcaaggcggccggctgccgg

[0019] ccgctggggcagctggacagcttcagctgggcagcccgcccgcctccgg(Homo sapiensGDF5antisense RNA 1

[0020] (GDF5-AS1), long non-coding RNA, NCBI Reference Sequence:NR_161326.1).

[0021] Preferably, the sequence of SEQ ID NO.2 is as follows: ACAGGAATGCGGTTAGAGG, and the sequence of SEQ ID NO.3 is as follows: CAACGTGGTGTATAAGCAGTATG.

[0022] A second aspect of the present invention provides a kit for detecting GDF5OS RNA levels, the kit comprising the above-mentioned specific primer pair and an internal reference ABL1 primer pair.

[0023] Preferably, the forward primer in the internal reference ABL1 primer pair is shown as SEQ ID NO.4, and the reverse primer is shown as SEQ ID NO.5.

[0024] Preferably, the sequence of SEQ ID NO.4 is as follows: TCCTCCAGCTGTTATCTGGAAGA, and the sequence of SEQ ID NO.5 is as follows: TCCAACGAGCGGCTTCAC.

[0025] The third aspect of the present invention provides the use of the above-mentioned specific primer pair or the above-mentioned kit in the preparation of a reagent for auxiliary diagnosis or screening of acute myeloid leukemia, and the GDF5OS gene sequence is shown in SEQ ID NO.1.

[0026] The fourth aspect of the present invention provides the use of the GDF5OS gene in preparing a leukemia molecular marker.

[0027] Preferably, the leukemia is acute myeloid leukemia.

[0028] The fifth aspect of the present invention is to provide a method for detecting the expression level of GDF5OS based on quantitative PCR, comprising the following steps:

[0029] (1) Extracting total RNA from human tissue or cell samples and performing quality testing on the extracted RNA samples;

[0030] (2) reverse transcribing the total RNA from step (1) into cDNA;

[0031] (3) The cDNA in step (2) is amplified using the above-mentioned specific primer pair and the above-mentioned internal reference ABL1 primer pair, respectively, and the RNA level of GDF5OS in the sample is analyzed by quantitative PCR to obtain relevant data.

[0032] Preferably, the method is for non-diagnostic and non-therapeutic purposes.

[0033] The present invention relates to a method for detecting the GDF5OS gene and its application as a novel biomolecular marker to assist in the diagnosis of AML. Compared with the prior art, the present invention provides a more accurate judgment method for the diagnosis of AML based on the RNA level of the novel biomolecular marker GDF5OS in combination with other clinical indicators. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The following is a brief introduction to the drawings used in this embodiment, so as to provide a more clear supplementary explanation of the technical solutions of the embodiments of the present invention. It should be understood that the following drawings only show certain embodiments of the present invention, and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can also be obtained based on these drawings without creative work.

[0035] Figure 1 Schematic diagram of quantitative PCR detection showing down-regulation of GDF5OS expression in newly diagnosed AML patients and its diagnostic value. DETAILED DESCRIPTION

[0036] Example 1: Method for detecting GDF5OS expression level based on quantitative PCR

[0037] (1) Total RNA extraction

[0038] ① Bone marrow mononuclear cell separation: add 5 ml of lymphocyte separation solution and red blood cell lysis solution to the obtained bone marrow specimen, mix them upside down, centrifuge at 1000×rpm for 5 minutes, and discard the supernatant.

[0039] ② Add 1 ml of TRIZOL to the above precipitate and mix thoroughly by pipetting.

[0040] ③ Add 200 μl of chloroform, vortex thoroughly for 30 seconds, let stand at room temperature for 5 minutes, and centrifuge at 12000×rpm for 10 minutes.

[0041] ④ Take 400μl of supernatant and place it into a new sterile 1.5ml EP tube, add 400μl of isopropanol, cover the lid tightly, mix by inverting 50 times, let stand at room temperature for 10 minutes after thorough mixing, centrifuge at 12000×rpm for 10 minutes, carefully discard the supernatant, and the white precipitate at the bottom of the EP tube is RNA.

[0042] ⑤ Add 1 ml of 75% ethanol, invert to mix and rinse the precipitate, centrifuge at 12000×rpm for 5 min, and carefully discard the supernatant.

[0043] ⑥ Add 1 ml of 100% ethanol, invert to mix and rinse the precipitate, centrifuge at 12000×rpm for 10 min, carefully discard the supernatant, and open the lid on a positive pressure clean bench to air dry.

[0044] ⑦ Add appropriate amount (10-20 μl) DEPC and dissolve RNA on ice.

[0045] ⑧After mixing, take 2 μl RNA and use NanoDrop spectrophotometer to detect the concentration and purity of the extracted sample RNA and adjust it to a uniform concentration.

[0046] (2) cDNA reverse transcription

[0047] ① Prepare Master Mix on ice. The reagents and usage are as follows: 2μl 5×gDNA Eraser Buffer, 1μl gDNA Eraser, 2μl Total RNA, and RNase Free dH2O up to 10μl (TaKaRa TM ), prepare the amount according to the reaction number + 2, and then distribute it into each 0.2ml EP tube and place it in a common PCR instrument (37℃, 5min).

[0048] ② Add 1 μl PrimeScript RT Enzyme Mix I, 1 μl RTPrimerMix*4, 4 μl 5× PrimeScript Buffer 2 (for Real Time) and 4 μl RNase Free dH2O (TaKaRa TM ) and placed in a common PCR instrument (37℃15min, 85℃5sec).

[0049] ③After the reaction is completed, store the product cDNA at -20℃ for future use.

[0050] (3) Real-time quantitative PCR detection

[0051] ① Using ABL1 as the internal reference, the reaction system of GDF5OS and ABL1 was: TB Green Premix Ex Taq II (TliRNaseH Plus) (2×) 10.0μl, 0.8μl of upstream and downstream primers, 0.4μl of ROX Reference Dye or Dye II (50×), 6.0μl of ddH2O, 2.0μl of cDNA template, and the total reaction volume was 20μl.

[0052] ②Specific detection primer sequences are shown in the table below.

[0053]

[0054] ③GDF5OS reaction conditions: pre-denaturation (95℃, 5min), denaturation (95℃, 10sec), annealing (58℃, 30sec), extension (72℃, 30sec), fluorescence collection (75℃, 30sec), the number of cycles is 40 cycles; ABL1 reaction conditions: pre-denaturation (95℃, 5min), denaturation (95℃, 10sec), annealing (58℃, 30sec), extension (72℃, 30sec), fluorescence collection (75℃, 30sec), the number of cycles is 40 cycles. Detection was completed on ABI 7500 real-time fluorescence quantitative PCR instrument.

[0055] (4) Quantitative analysis of results

[0056] GDF5OS gene expression level was based on 2 -ΔΔCT The specific calculation formula is as follows: N GDF5OS =2 ΔCT GDF5OS(control-sample) ÷2 ΔCTABL1(control-sample) (2 -ΔΔCT ). Each parallel experiment was repeated 3 times.

[0057] Example 2: Verification of GDF5OS gene expression and its diagnostic efficacy in newly diagnosed AML patients and healthy subjects

[0058] 62 healthy subjects and 121 AML samples were collected, and each sample was treated with the same treatment method as in Example 1, and the GDF5OS RNA level in each sample was calculated. Figure 1 a As shown in the results, GDF5OS was downregulated in acute myeloid leukemia patients (AML group) compared with healthy controls (control group). The receiver operating characteristic curve (ROC curve) was used to analyze its diagnostic efficacy in AML (see Figure 1 b), and the AUC value was 0.788. The analysis results showed that GDF5OS level can be used as a new molecular marker for auxiliary diagnosis of AML.

[0059] In summary, the method for detecting the expression level of GDF5OS based on quantitative PCR established in the present invention is used as a biomarker for AML patients to provide support for clinical prevention of AML, auxiliary diagnosis and prognosis assessment.

[0060] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and the embodiments. It can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily realized. Therefore, without departing from the general concept defined by the claims and equivalent scope, the present invention is not limited to the specific details and the illustrations shown and described here.

Claims

1. Use of a kit in preparing a reagent for auxiliary diagnosis or screening of acute myeloid leukemia, characterized in that: The kit comprises a specific primer pair for detecting the level of GDF5OS RNA and an internal reference ABL1 primer pair, wherein the specific primer pair comprises a forward primer as shown in SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3, the forward primer in the internal reference ABL1 primer pair is shown in SEQ ID NO.4, the reverse primer is shown in SEQ ID NO.5, and the GDF5OS sequence is shown in SEQ ID NO.

1.

2. A use of the GDF5OS gene in preparing a leukemia molecular marker, characterized in that: The GDF5OS gene sequence is shown in SEQ ID NO.1, and the leukemia is acute myeloid leukemia.

Images