Molecular markers related to body weight or wool traits of Tan sheep and their application

Abstract

The present invention provides a molecular marker site on chromosome 15 of Tan sheep related to body weight or wool traits, wherein the molecular marker site is a SNPs mutation on chromosome 15 of Tan sheep. The present invention can increase the frequency of the dominant allele from generation to generation by optimizing the dominant allele of the marker, improve the body weight or wool traits of Tan sheep, accelerate the genetic improvement process of Tan sheep, and thus effectively improve the economic benefits of Tan sheep breeding.

Description

[0001] Application technology

[0002] The invention belongs to the field of biotechnology breeding, and in particular relates to molecular markers on Tan sheep chromosomes related to Tan sheep weight or wool traits and applications thereof. Background Art

[0003] Tan sheep are an excellent local sheep breed in my country, mainly distributed in the central and northern regions of Ningxia Hui Autonomous Region, as well as adjacent areas such as Inner Mongolia, Gansu, and Shaanxi. They are named after the beach grasslands on the southern foot of the Helan Mountains in Ningxia. They live in high plains and low mountain and hilly areas with an altitude of 1,000-2,000 meters. They adapt to the natural environment of drought and desertification, have a solid physique and are resistant to roughage, and graze all year round. Tan sheep meat is tender, fat is evenly distributed, and there is almost no smell of mutton, making it a very popular food ingredient. In addition, Tan sheep are also famous for their high-quality fur, especially their two-hair skin (that is, the first wool skin cut after birth). It has a soft texture and a light and strong leather board. It is the preferred material for making high-end leather clothes and leather goods. This is why Tan sheep are called "fur sheep breeds." In certain areas, such as Yanchi County in Ningxia, Tan sheep have been listed as geographical indication products. Their unique quality and breeding environment have endowed them with a high reputation. They are one of Ningxia's famous specialties and are known as one of the "Five Treasures of Ningxia". They have a long history and cultural value. Their narrow ecological breeding has endowed Tan sheep with unique germplasm resources, but their slow growth rate has restricted the development of the Tan sheep industry. So far, through the in-depth study of conventional Tan sheep breeding combined with molecular marker-assisted breeding, the growth traits of Tan sheep have been greatly improved. The genomic breeding value obtained by calculation is an estimate, not a true value. The accuracy of the estimate is related to many factors, such as the number of phenotypic records, the choice of model, the setting of prior distribution, etc. Studies have shown that integrating functional genes or markers with large genetic effects related to complex traits into information will improve the accuracy of genomic selection. Therefore, it is an important issue to be solved in the genetic improvement of Tan sheep to explore and verify new functional genes and QTLs for weight or wool traits of Tan sheep and provide genetic markers for molecular breeding. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides molecular markers that are significantly correlated with the weight or wool traits of Tan sheep, which are identified through genotyping and correlation analysis strategies, and are used in molecular marker-assisted selection and genomic selection to select favorable genotypes for seed retention, thereby increasing the gene frequency of dominant alleles from generation to generation, which can accelerate the process of genetic breeding and improvement of Tan sheep and bring huge economic benefits to local Tan sheep breeding.

[0005] The primary purpose is to determine the SNPs molecular markers that affect the weight or wool traits of Tan sheep. The molecular markers are located on chromosome 15 of the Tan sheep genome (reference sequence is NC_056068.1), and the specific SNP information is as follows:

[0006] Table 1 SNP site information

[0007]

[0008] The above pos position is the position of the Tan sheep genome measured by our laboratory, which is different from the published sheep reference genome (NC_056068.1).

[0009] The molecular marker SNP1 C>T is located in the following sequence (SEQ ID NO.1):

[0010] 5'-TTCCTGCACTGTTCACCCAGATCCGGAGCCTTGGGGTCCGAGGGGCCAGCATGGCTGGGTGACGG[C / T]GGGC TCCTTTGGCTTCAGCTCCTCTCTCTCTGCCCAGTCCCTCCGGGTGCATCCAGCACGGGGGACAGACAGCAGGATGGG GGCTCCTCGCACCCAGGGAAAGGCGAGGC-3'

[0011] The molecular marker SNP2 C>T is located in the following sequence (SEQ ID NO.2):

[0012] 5'-GTACCCAGGGACATGGGCTATCTCGGCTCCAGGAGAGTGAGGAAAGGGAGGCCTAGGAAAGCCTGTGGCCTGGC T[C / T]GCTGCTGGGCGGGCCCAGGCTTGGAGCAGAAGGCGGAGGCCACAGCACAAGGAGGCCTGAGAGGGAGGAAGCA GCCGCCTCTGCAGGGCAGGTTGAGGGGCGTCAGGACGGCACTCAGCCCCAGACGC-3'

[0013] The molecular marker SNP3 C>T is located in the following sequence (SEQ ID NO.3):

[0014] 5'-CGCTGAGCCCACGTGCGGCAAGTACTGAAGCCAAGGTGCCCTGGAGCCTGGACTCCACCACCAGAGGGGCCACCA CAACGAGAAGC[C / T]CGTACACCGCAAGGCTTACATTCAGACCTCACCAGTTTCTCTGCCCTCAGACTCACCACGCTC CACTACAACCAGAGACAGTGTCTAAGACACACTCTCTGGGTCTAGGCCA-3'

[0015] Another object of the present invention is to provide a primer and probe set for detecting the above-mentioned molecular marker, characterized in that the base sequence of the primer is as follows:

[0016] Table 2 Amplification primer sequence information

[0017]

[0018]

[0019] Another object of the present invention is to provide a kit for detecting the above-mentioned molecular markers, wherein the kit comprises the above-mentioned primer set.

[0020] Another object of the present invention is to provide the use of the above-mentioned molecular markers in screening Tan sheep individuals with excellent body weight or wool traits.

[0021] Specifically, the genotype of the SNP1 and / or SNP3 loci of the Tan sheep genome is detected. In a preferred embodiment, individuals with heterozygous TC type at the SNP1 locus on chromosome 15 of the Tan sheep are eliminated from the core Tan sheep resource population, so as to increase the CC and TT genotype frequencies of the locus from generation to generation, thereby increasing the birth weight and side curvature of the wool of the offspring Tan sheep;

[0022] In another preferred embodiment, individuals with heterozygous TC type at SNP3 site on chromosome 15 of Tan sheep are eliminated from the core group Tan sheep resource population to increase the TT genotype frequency of the site generation by generation, thereby increasing the side hair length of the wool of the offspring Tan sheep;

[0023] In another preferred embodiment, individuals with heterozygous TT type at SNP3 site on chromosome 15 of Tan sheep are eliminated from the core group of Tan sheep resource population to increase the TC genotype frequency of the site generation by generation, thereby improving the lateral curvature of the wool of the offspring Tan sheep.

[0024] Another object of the present invention is to provide an application of the above primer or detection kit in identifying the genotype of a locus related to the weight or wool traits of Tan sheep. Specifically, the above primer or kit is used to detect the genotype of the SNP1 and / or SNP3 loci on chromosome 15 of Tan sheep.

[0025] In a preferred embodiment, individuals with heterozygous TC type at SNP1 site on chromosome 15 of Tan sheep are eliminated from the core group Tan sheep resource population to increase the CC and TT genotype frequencies of the site generation by generation, thereby increasing the birth weight and side curvature of wool of the offspring Tan sheep;

[0026] In another preferred embodiment, individuals with heterozygous TC type at SNP3 site on chromosome 15 of Tan sheep are eliminated from the core group Tan sheep resource population to increase the TT genotype frequency of the site generation by generation, thereby increasing the side hair length of the wool of the offspring Tan sheep;

[0027] In another preferred embodiment, individuals with heterozygous TT type at SNP3 site on chromosome 15 of Tan sheep are eliminated from the core group of Tan sheep resource population to increase the TC genotype frequency of the site generation by generation, thereby improving the lateral curvature of the wool of the offspring Tan sheep.

[0028] Furthermore, the primers or detection kits are used to improve the weight or wool traits of Tan sheep. Specifically, the primers or detection kits are used to detect the genotype of SNP1 and / or SNP3 sites on chromosome 15 of Tan sheep.

[0029] In a preferred embodiment, individuals with heterozygous TC type at SNP1 site on chromosome 15 of Tan sheep are eliminated from the core group Tan sheep resource population to increase the CC and TT genotype frequencies of the site generation by generation, thereby increasing the birth weight and side curvature of wool of the offspring Tan sheep;

[0030] In another preferred embodiment, individuals with heterozygous TC type at SNP3 site on chromosome 15 of Tan sheep are eliminated from the core group Tan sheep resource population to increase the TT genotype frequency of the site generation by generation, thereby increasing the side hair length of the wool of the offspring Tan sheep;

[0031] In another preferred embodiment, individuals with heterozygous TT type at SNP3 site on chromosome 15 of Tan sheep are eliminated from the core group of Tan sheep resource population to increase the TC genotype frequency of the site generation by generation, thereby improving the lateral curvature of the wool of the offspring Tan sheep.

[0032] Another object of the present invention is to provide a method for genetic improvement of Tan sheep, the method comprising the following steps:

[0033] 1) Determine the genotype of the molecular marker site related to the weight or wool traits of Tan sheep in the core group Tan sheep resource population, wherein the molecular marker site is the site in the aforementioned embodiment.

[0034] 2) Make corresponding selections based on the genotype of the molecular marker and the breeding goal:

[0035] Wherein step 1 comprises the following steps:

[0036] 1.1) Extracting genomic DNA of the Tan sheep to be tested;

[0037] 1.2) Detecting the genotype of the Tan sheep to be tested using the aforementioned primer and probe set or detection kit;

[0038] 1.3) Based on the test results, the genotypes of the tested Tan sheep at the SNP1 and SNP3 sites on chromosome 15 of the reference genome are determined;

[0039] Wherein step 2 comprises the following steps:

[0040] 2.1) Eliminate individuals with heterozygous TC type at SNP1 site on chromosome 15 of Tan sheep from a core group of Tan sheep resource populations to increase the CC and TT genotype frequencies of the site generation by generation, thereby increasing the birth weight and side curvature of wool of offspring Tan sheep

[0041] 2.2) Eliminate the individuals with heterozygous TC type at SNP3 site on chromosome 15 of Tan sheep from another core group of Tan sheep resource population, so as to increase the TT genotype frequency of the site generation by generation, thereby increasing the side hair length of the wool of the offspring Tan sheep;

[0042] 2.3) Eliminate individuals with heterozygous TT type at SNP3 site on chromosome 15 of Tan sheep from another core group of Tan sheep resource groups to increase the TC genotype frequency of this site generation by generation, thereby increasing the lateral curvature of the wool of offspring Tan sheep. In a preferred embodiment, the above-mentioned Tan sheep weight or wool traits are milk fat rate, milk protein rate and / or 305-day milk protein amount.

[0043] In a preferred embodiment, the synthetic strain of Holstein Tan sheep is a Tan sheep strain having the bloodline or genetic background of Holstein Tan sheep.

[0044] Compared with the prior art, the present invention has the following advantages and effects:

[0045] First, new molecular markers related to Tan sheep body weight or wool weight traits and wool traits were identified, and detection primers were developed.

[0046] Second, the molecular markers identified in the present invention are applied to the genetic improvement of the weight or wool traits of Tan sheep, which can improve the weight or wool quality of the offspring Tan sheep, thereby increasing the market competitiveness of breeding enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] The method of the present invention and its beneficial effects are described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0048] Figure 1 These are the mixed pool PCR sequencing results of Holstein sheep SNP sites; A is the sequencing result of SNP1 site, B is the sequencing result of SNP2 site, and C is the sequencing result of SNP3 site. DETAILED DESCRIPTION

[0049] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0050] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by ordinary technicians in the technical field to which this application belongs.

[0051] Example 1 Detection of variant sites

[0052] 1. Experimental Animals

[0053] The experimental group consisted of 107 Tan sheep from the Ningxia Tan sheep breeding farm Sujing Station. The experimental sheep were healthy, born on similar dates, and in similar physical condition. The feeding conditions and environment of all samples remained basically unchanged. The breeding site was above 1,000 meters above sea level, with characteristics such as more wind and sand in spring, less hot summer, earlier cool autumn, longer cold winter, less snow and rain, sufficient sunshine, and strong evaporation. The average annual precipitation was about 300 mm.

[0054] 2. Extraction and detection of blood DNA

[0055] 5 mL of blood was collected from the jugular vein of the sheep, anticoagulated with ACD, and stored at -20°C. DNA was extracted using a blood extraction kit, and the length, number of bends, and bend ratio of the lateral hair of the Tan sheep during the first and second hair period were measured regularly. 15 lambs were selected to collect skin tissue from the posterior edge of the left scapula at birth and in the second hair period, and the sample size was about 1 cm 2 , stored in liquid nitrogen. The genomic DNA of Tan sheep blood was extracted using the Ezup column blood genomic DNA extraction kit (B518253, Bio-Technology). The concentration of DNA samples was detected by UV spectrophotometer and 1.5% agarose gel electrophoresis.

[0056] 3. Primer design and PCR amplification

[0057] According to the genome sequence assembled in this experiment and the site information obtained by resequencing, appropriate primers were designed using Primer Premier 5 software. Primer information is shown in Table 1 (synthesized by Shanghai Sangon Biotechnology Co., Ltd.).

[0058] Table 1 Amplification primer sequence information

[0059]

[0060]

[0061] PCR reaction system 25.0μL: 1.0μL each of upstream and downstream primers (10μM), 3.7μL PCR Mix, 1.0μL DNA (50ng / μL), 17.3μL ddH2O. PCR reaction parameters: 95℃ pre-denaturation for 5min, 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 30s, 35 cycles, 72℃ extension for 10min, 4℃ storage.

[0062] The target PCR band was excised and recovered using the SanPrep column DNA gel recovery kit (Shenggong B518131), and the amplified PCR products were detected and purified. The PCR product sequencing was completed by Shanghai Shenggong Biotechnology Co., Ltd.

[0063] 4. Sequencing results and screening of polymorphic sites

[0064] By typing the three SNPs sites of the Tan sheep population, a T / C mutation occurred at the SNP1 site, with two alleles, T and C, and three genotypes, TT, TC, and CC. A T / C mutation occurred at the SNP2 site, with two alleles, T and C, and two genotypes, TT and TC, detected at this site; a T / C mutation occurred at the SNP3 site, with two alleles, T and C, and two genotypes, TT and TC (see Figure 1 ).

[0065] Example 2 Association analysis between genotype and body weight or wool traits

[0066] The primers in Example 1 were used to perform PCR amplification and first-generation sequencing on the genomes of 107 Tan sheep, and the genotypes of the SNP sites were obtained according to the sequencing results. The genotypes of the SNPs sites were analyzed for association with body weight or wool traits, and the general linear model in the GEMMA software was used to perform least squares analysis on the correlation between different genotypes and wool traits at different growth stages. The analysis model used was: y = Z k γ k +e, where y is the phenotype vector, Z k γ kis the marker effect to be tested, and e is the residual effect. Wald test was used to test whether the marker genotype was significantly associated with the phenotype, with P < 0.05 as the criterion for significant difference. The results are as follows:

[0067] Table 2 Association analysis between mutation sites and body weight or wool traits

[0068]

[0069] Note: P value indicates the association between each SNP and body weight or wool traits; different letters indicate the differences between genotypes after multiple comparisons (different lowercase letters indicate significant differences P<0.05, different uppercase letters indicate extremely significant differences p<0.01, regardless of uppercase or lowercase letters, the same letters indicate insignificant differences).

[0070] As shown in Table 2, the number of lateral curvatures at birth of CC genotype at SNP1 was significantly greater than that of other genotypes (P<0.05), and the birth weight of CC genotype was significantly greater than that of other genotypes (P<0.05). The length of the lateral hair of TT genotype at SNP3 was significantly greater than that of other genotypes (P<0.05), and the degree of lateral curvature was significantly less than that of TC genotype.

[0071] Example 3 Method for genetic improvement of milk fat rate trait of Tan sheep

[0072] A method for genetically improving the weight or wool traits of Tan sheep, wherein the Tan sheep population includes Holstein Tan sheep and synthetic lines thereof, and the method comprises the following steps:

[0073] 3) Determine the genotype of the molecular marker site related to the weight or wool traits of Tan sheep in the core group Tan sheep resource population, wherein the molecular marker site is the site in the aforementioned embodiment.

[0074] 4) Make corresponding selections based on the genotype of the molecular marker and the breeding goal:

[0075] Wherein step 1 comprises the following steps:

[0076] 1.1) Extracting genomic DNA of the Tan sheep to be tested;

[0077] 1.2) Detecting the genotype of the Tan sheep to be tested using the aforementioned primer and probe set or detection kit;

[0078] 1.3) Based on the test results, the genotypes of the tested Tan sheep at the SNP1 and SNP3 sites on chromosome 15 of the reference genome are determined;

[0079] Wherein step 2 comprises the following steps:

[0080] 2.1) Eliminate individuals with heterozygous TC type at SNP1 site on chromosome 15 of Tan sheep from a core group of Tan sheep resource populations to increase the CC and TT genotype frequencies of the site generation by generation, thereby increasing the birth weight and side curvature of wool of offspring Tan sheep

[0081] 2.2) Eliminate the individuals with heterozygous TC type at SNP3 site on chromosome 15 of Tan sheep from another core group of Tan sheep resource population, so as to increase the TT genotype frequency of the site generation by generation, thereby increasing the side hair length of the wool of the offspring Tan sheep;

[0082] 2.3) Eliminate individuals with heterozygous TT type at SNP3 site on chromosome 15 of Tan sheep from another core group of Tan sheep resource population, so as to increase the TC genotype frequency of this site generation by generation, thereby improving the lateral curvature of the wool of the offspring Tan sheep.

[0083] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for improving the weight or wool traits of Tan sheep, characterized in that: The method comprises the following steps: 1) Determine the genotype of the SNP1 site and / or the SNP3 site in the Tan sheep resource population, wherein the SNP1 site is located at the 67th position from the 5' end of SEQ ID NO.1, and the SNP3 site is located at the 87th position from the 5' end of SEQ ID NO.3, 2) Make corresponding selections according to the genotypes of SNP1 and / or SNP3 loci and the breeding goals, the selections being: eliminating individuals with heterozygous TC type at SNP1 loci of Tan sheep, so as to increase the CC and TT genotype frequencies of the loci generation by generation, thereby increasing the birth weight and the number of side bends of wool of the offspring Tan sheep; Eliminate the individuals with heterozygous TC type at SNP3 locus in Tan sheep to increase the frequency of TT genotype at this locus generation by generation, thereby increasing the length of the side hair of the wool of the offspring Tan sheep in the second wool period; or Eliminate individuals with homozygous TT type at SNP3 locus in Tan sheep to increase the TC genotype frequency of this locus generation by generation, thereby increasing the number of lateral bends in the wool of offspring Tan sheep in the second wool stage.

2. Application of primers for detecting SNP1 site in improving the birth weight or the number of lateral bends of wool of Tan sheep, wherein the SNP1 site is located at the 67th position from the 5' end of SEQ ID NO.1, and the application comprises the following method: 1) Determine the genotype of SNP1 in the Tan sheep resource population, 2) Make corresponding selections based on the genotype of the SNP1 locus and the breeding goal, the selections are: Individuals with heterozygous TC type at SNP1 locus of Tan sheep were eliminated to increase the frequency of CC and TT genotypes of this locus generation by generation, thereby increasing the weight and side bends of wool of offspring Tan sheep at birth.

3. Application of primers for detecting SNP3 site in improving the side hair length or side bend number of Tan sheep wool in the second wool stage, wherein the SNP3 site is located at the 87th position from the 5' end of SEQ ID NO.3, and the application comprises the following method: 1) Determine the genotype of SNP3 in the Tan sheep resource population, 2) Make corresponding selections based on the genotype of the SNP3 locus and the breeding goal, the selections are: Eliminate the individuals with heterozygous TC type at SNP3 locus in Tan sheep to increase the frequency of TT genotype at this locus generation by generation, thereby increasing the length of the side hair of the wool of the offspring Tan sheep in the second wool period; or Eliminate individuals with homozygous TT type at SNP3 locus in Tan sheep to increase the TC genotype frequency of this locus generation by generation, thereby increasing the number of lateral bends in the wool of offspring Tan sheep in the second wool stage.

Images