Primers and probes for droplet digital PCR of burkholderia glumae p. cocovenenans and application thereof

Abstract

The present application relates to the field of biological detection, and more particularly to a primer set, a probe and application thereof for microdrop digital PCR of Pseudomonas cocovenenans subspecies farinofermis, and the present application provides the primer set and the probe, which have nucleotide sequences as shown in SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:3, and the present application provides a method for quantitatively detecting Pseudomonas cocovenenans (Pseudomonas cocovenenans subspecies farinofermis) by microdrop digital PCR, which has the characteristics of strong detection specificity and high sensitivity, and is applied to the fields of food safety supervision and inspection, guarantee inspection and emergency inspection of sudden food safety incidents.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological detection, in particular to a microdrop digital PCR primer set for Burkholderia cenocepacia, Pseudomonas cocovenenans, Sphingobium multivorum, and an application thereof. BACKGROUND

[0002] Burkholderia cenocepacia (Pseudomonas cocovenenans Sphingobium multivorum) is a food poisoning bacterium found in fermented corn poisoning events. The bacterium mainly exists in fermented grain products (fermented corn flour, glutinous corn dumpling flour, corn starch, fermented glutinous millet, vinegar bean curd, etc.), deteriorated tremella, potato products (potato noodles, sweet potato starch, yam starch, etc.) and the surrounding environment. Burkholderia cenocepacia (Pseudomonas cocovenenans Sphingobium multivorum) can produce mycotoxins and toxic yellow substances, and can cause highly pathogenic food poisoning.

[0003] At present, the national food safety standard for detecting Burkholderia cenocepacia (Pseudomonas cocovenenans Sphingobium multivorum) in food is GB 4789.29-2020, which uses traditional microbial culture method. The detection process includes enrichment, separation and purification, biochemical identification, serum identification, and toxicological test. The detection operation steps are complicated, long cycle, and low efficiency. Conventional PCR, real-time fluorescent PCR and loop-mediated isothermal amplification (LAMP) cannot realize the absolute quantification of bacteria. The existing method cannot meet the requirements of rapid and accurate quantification of Pseudomonas cocovenenans Sphingobium multivorum microorganisms in food. Digital PCR detection technology (Digital PCR, dPCR) is a nucleic acid molecule absolute quantification technology. By dividing a sample nucleic acid into tens to tens of thousands of parts, the target molecule is amplified and detected in tens of thousands of different reaction units, reducing the interference of background interference and inhibitors on PCR reaction. Compared with traditional PCR technology, this technology has the advantages of high sensitivity, high precision and absolute quantification, and is more suitable for rapid quantitative detection of trace DNA in food and food poisoning samples.

[0004] In summary, for the quantitative analysis of Pseudomonas cocovenenans Sphingobium multivorum microorganisms, it is necessary to establish a new technology with strong specificity, high sensitivity and good accuracy, which can be applied to the fields of food safety supervision and inspection, security inspection and emergency inspection of sudden food safety incidents. SUMMARY

[0005] Therefore, the present application provides a microdrop digital PCR primer set for Burkholderia cenocepacia (Pseudomonas cocovenenans Sphingobium multivorum) and an application thereof. The present application provides a microdrop digital PCR quantitative detection method for Burkholderia cenocepacia (Pseudomonas cocovenenans Sphingobium multivorum), which has the characteristics of strong detection specificity and high sensitivity, and can be applied to the fields of food safety supervision and inspection, security inspection and emergency inspection of sudden food safety incidents.

[0006] To achieve the above-mentioned object, the present application provides the following technical solutions.

[0007] The present application provides a primer set, which has:

[0008] (1) the nucleotide sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0009] (2) the nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases of the nucleotide sequence as shown in (1);

[0010] (3) the sequence having at least 80% homology with the nucleotide sequence as shown in (1);

[0011] (4) the complementary sequence of the sequence as shown in (1), (2) or (3).

[0012] The present application also provides a probe, which has:

[0013] (5) the nucleotide sequence as shown in SEQ ID NO: 3;

[0014] (6) the nucleotide sequence obtained by modifying, substituting, deleting and / or adding one or more bases of the nucleotide sequence as shown in (5);

[0015] (7) the sequence having at least 80% homology with the nucleotide sequence as shown in (5);

[0016] (8) the complementary sequence of the sequence as shown in (5), (6) or (7).

[0017] The present application also provides a primer-probe set, which comprises the primer set and the probe.

[0018] The present application also provides the application of the primer set, the probe and / or the primer-probe set in any of the following aspects:

[0019] (I) detecting B. glumae; and / or

[0020] (II) preparing a product for detecting B. glumae; and / or

[0021] (III) detecting the content of B. glumae; and / or

[0022] (IV) preparing a product for detecting the content of B. glumae; and / or

[0023] (V) detecting the content of B. glumae in food; and / or

[0024] (VI), detecting whether there is a B. gladioli in food.

[0025] The application also provides a detection reagent, comprising: the primer set, the probe, and / or the primer-probe set, and acceptable adjuvants and / or excipients.

[0026] The application also provides a detection kit, comprising: the primer set, the probe, the primer-probe set, and / or the detection reagent, and acceptable adjuvants, excipients, and / or devices.

[0027] In some embodiments of the application, the concentration of the primer set and the probe in the detection kit is 10 μmol / L, respectively.

[0028] The application also provides a device, comprising acceptable components, and coated with:

[0029] (1), the primer set; or

[0030] (2), the probe; or

[0031] (3), the primer-probe set; or

[0032] (4), the detection reagent.

[0033] The application also provides a detection method of B. gladioli, which amplifies and detects a sample to be tested by using the primer-probe set to obtain a detection result.

[0034] The detection uses microdroplet digital PCR.

[0035] In some embodiments of the application, the concentration of DNA in the sample to be tested in the detection method is 1.6-1000 pg / μL.

[0036] The application provides a primer set, which has:

[0037] (1), the nucleotide sequence shown in SEQ ID NO:1 and SEQ ID NO:2;

[0038] (2), a nucleotide sequence obtained by modifying, substituting, deleting, and / or adding one or more bases to the nucleotide sequence shown in (1);

[0039] (3), a sequence having at least 80% homology with the nucleotide sequence shown in (1);

[0040] (4), a complementary sequence of the sequence shown in (1), (2), or (3).

[0041] The beneficial effects of the application include:

[0042] (1), the application provides a microdroplet digital PCR specific primer capable of specifically identifying Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens), which has good specificity, cannot specifically amplify other non-target bacteria, can realize high-throughput quantitative detection of Pseudomonas cocovenenans subspecies zeaxanthinifaciens, and has commercial development value. In addition, the microdroplet digital PCR reaction system for Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) in the application can realize rapid detection of Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) within 2 hours after the completion of the enrichment.

[0043] (2), the microdroplet digital PCR specific primer can be used for rapidly detecting whether Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) exists in food, has high detection efficiency, high sensitivity and low quantitative limit, can quantitatively detect a sample with a DNA concentration of 1.6 pg / μL, and is suitable for rapid quantitative detection of Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens).

[0044] (3), the microdroplet digital PCR rapid detection method and kit for Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) provided by the application are suitable for the detection of Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) in various foods, and the technology can play an important role in the fields of rapid diagnosis of food poisoning, rapid early warning of risk monitoring and food safety guarantee. BRIEF DESCRIPTION OF DRAWINGS

[0045] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description.

[0046] Figure 1 A real-time fluorescent PCR amplification map for screening of Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) specific primer is shown;

[0047] Figure 2 A real-time fluorescent amplification efficiency curve graph of the Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) primer of the application is shown;

[0048] Figure 3 A microdroplet digital PCR amplification map of Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) with a DNA concentration of 1000 pg / μL is shown;

[0049] Figure 4 A microdroplet digital PCR amplification map of Burkholderia gladioli (Pseudomonas cocovenenans subspecies zeaxanthinifaciens) with a DNA concentration of 40 pg / μL is shown;

[0050] Figure 5A microdroplet digital PCR amplification map of the DNA concentration of 1.6 pg / μL of B. gladioli (P. cocovenenans var. keratinilyticum) of the present application is shown in the figure;

[0051] Figure 6 A specificity verification map of the microdroplet digital PCR rapid detection method of B. gladioli (P. cocovenenans var. keratinilyticum) of the present application is shown in the figure;

[0052] Figure 7 A linear method fitting curve map of the microdroplet digital PCR rapid detection method of B. gladioli (P. cocovenenans var. keratinilyticum) of the present application is shown in the figure;

[0053] Figure 8 A limit of quantification verification map of the microdroplet digital PCR rapid detection method of B. gladioli (P. cocovenenans var. keratinilyticum) of the present application is shown in the figure. DETAILED DESCRIPTION

[0054] The present application discloses a microdroplet digital PCR primer set, probe and application of B. gladioli (P. cocovenenans var. keratinilyticum).

[0055] It should be understood that the expression "one or more of the" includes each object recited after the expression and various different combinations of two or more of the recited objects, individually, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.

[0056] The terms "comprising", "having", or "including", including their grammatical variations, should generally be understood to be open-ended and non-limiting, for example, not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0057] It should be understood that the order of steps or order of performing certain actions is immaterial so long as the application remains operable. Moreover, two or more steps or actions can be conducted simultaneously.

[0058] The use of any and all examples, or exemplary language herein, for example, only the better illustrate the application, and unless otherwise claimed, does not pose a limitation on the scope of the application. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the application.

[0059] Also, the numerical ranges recited herein are approximate, meaning that the ends of the ranges are inherently approximate, i.e., they are preceded by the word "about". Unless otherwise indicated, all ranges, numbers, values and percentages recited in this disclosure are modified in all instances by the term "about." Herein, "about" generally means within 10%, 5%, 1%, or 0.5% of a given value or range.

[0060] The application provides a rapid detection method for Pseudomonas cocophila (Pseudomonas cocophila fermentum subspecies) microdroplet digital PCR, comprising the following steps:

[0061] Step 1, preparing sample bacterial DNA and microdroplet digital PCR specific primers;

[0062] Step 2, using a microdroplet digital PCR reaction system to amplify the sample bacterial DNA, and detecting the amplification product;

[0063] In step 1, the microdroplet digital PCR specific primers are:

[0064] The upstream primer is ATCTTCCACATGGGCCACG; (SEQ ID NO: 1)

[0065] The downstream primer is CATGTAGCGGAACAGGTGCA; (SEQ ID NO: 2)

[0066] The probe is FAM-CAGTGCCACTACGTGCCGCA-BHQ1; (SEQ ID NO: 3)

[0067] Preferably, the A260 / A280 of the sample bacterial DNA is between 1.7 and 2.0, and the concentration is ≥1.6 pg / μL.

[0068] Preferably, the microdroplet digital PCR specific primers are designed according to the methyltransferase bonM gene sequence of Pseudomonas cocophila (Pseudomonas cocophila fermentum subspecies).

[0069] Preferably, the microdroplet digital PCR reaction system is 20 μL, including 1.8 μL of the upstream primer 10 μmol / L and the downstream primer 10 μmol / L, 0.7 μL of the probe 10 μmol / L; the remaining reagent components are respectively: 2×ddPCRTM premix 10 μL, ddH2O 3.7 μL, DNA template 2 μL.

[0070] Preferably, the microdroplet digital PCR reaction system adopts the following microdroplet PCR amplification conditions: 10 min at 95 DEG C in the first step, 1 cycle; 40 cycles of 30 s at 94 DEG C and 1 min at 56 DEG C in the second step; and 10 min at 98 DEG C in the third step, 1 cycle.

[0071] The application further provides a Pseudomonas cocovenenans (Pseudomonas cocovenenans kojiensis) microdroplet digital PCR rapid detection kit, which is detected by using any one of the detection methods.

[0072] In addition, the application further provides application of the Pseudomonas cocovenenans (Pseudomonas cocovenenans kojiensis) microdroplet digital PCR rapid detection method and kit in the field of rapid diagnosis of food poisoning, rapid early warning of risk monitoring and food safety guarantee.

[0073] In the examples 1 to 3 and the verification examples 1 to 4, the raw materials and reagents used can be purchased from the market.

[0074] The application is further described below in combination with examples:

[0075] Example 1

[0076] A Pseudomonas cocovenenans (Pseudomonas cocovenenans kojiensis) microdroplet digital PCR rapid quantitative detection method, which comprises the following steps:

[0077] Step 1: preparing sample bacterial DNA and specific primers for PCR amplification of the sample bacterial DNA;

[0078] In this step, the sample bacterial DNA is extracted from the sample according to the requirements of the bacterial genomic DNA extraction kit (the kit is produced by Tian Gen Biochemical Technology (Beijing) Co., Ltd., product number DP302), and after determination by an ultramicro spectrophotometer, the A260 / 280 of the sample bacterial DNA is 1.82, and the DNA concentration is 1000 pg / μL, which meets the requirements of the DNA solution, and the DNA solution is stored at -20 DEG C for standby.

[0079] The microdroplet digital PCR specific primer is designed and synthesized by selecting the Burkholderia gladioli (Pseudomonas cocovenenans koji-mai subspecies) specific gene sequence. Specifically, the specific gene sequence at positions 66740-67546 bp of Burkholderia gladioli strain DMSZ11318 (accession number JX173632.1) is obtained by downloading the CDS region from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). The specific primer is designed by using the software Primer3 web (https: / / bioinfo.ut.ee / primer3 / ).

[0080] Upstream primer: ATCTTCCACATGGGCCACG; (SEQ ID NO: 1)

[0081] Downstream primer: CATGTAGCGGAACAGGTGCA; (SEQ ID NO: 2)

[0082] Probe: FAM-CAGTGCCACTACGTGCCGCA-BHQ1; (SEQ ID NO: 3)

[0083] In addition, in the test process, the present application also designs a plurality of different primer pairs according to other primer design principles, detects the specificity and amplification efficiency after reaction, and screens the optimal primer for actual detection. For example:

[0084] First group:

[0085] Upstream primer: GGCATCACCATCAGCAAGGT; (SEQ ID NO: 4)

[0086] Downstream primer: GATGTAGCCCAGGTTCTCGG; (SEQ ID NO: 5)

[0087] Probe: FAM-CAGTGCCACTACGTGCCGCA-BHQ1; (SEQ ID NO: 3)

[0088] Second group:

[0089] Upstream primer: ACGGCATCACCATCAGCAA; (SEQ ID NO: 6)

[0090] Downstream primer: CACCACGATGATGTAGCCCA; (SEQ ID NO: 7)

[0091] Probe: FAM-CAGTGCCACTACGTGCCGCA-BHQ1; (SEQ ID NO: 3)

[0092] Third group:

[0093] Upstream primer: AGCATCTTCCACATGGGCC; (SEQ ID NO: 8)

[0094] Downstream primer: CACGATGATGTAGCCCAGGT; (SEQ ID NO: 9)

[0095] Probe: FAM-CAGTGCCACTACGTGCCGCA-BHQ1; (SEQ ID NO: 3)

[0096] Fourth group:

[0097] Upstream primer: CACCGAGCAGTTCATGGAGT; (SEQ ID NO: 10)

[0098] Downstream primer: CACCGAGCAGTTCATGGAGT; (SEQ ID NO: 11)

[0099] Probe: FAM-CAGTGCCACTACGTGCCGCA-BHQ1; (SEQ ID NO: 3)

[0100] Step 2: The screening test of the above several groups of primers and the primer amplification efficiency test of the application are carried out by using a real-time fluorescent PCR amplification reaction system. The real-time fluorescent PCR reaction system is 25 μL, including 1 μL of 10 μmol / L of upstream primer and 1 μL of 10 μmol / L of downstream primer, 1 μL of 10 μmol / L of probe, and the rest of the components are respectively: real-time fluorescent PCR premix (THUNDERBIRD™ Probe qPCR Mix) 12.5 μL, DNA template 2 μL and ddH2O 7.5 μL; the reaction condition of step 2 is: 95℃ for 3 min; 95℃ for 10 s, 55℃ for 40 s, 45 cycles, and the fluorescence signal is collected at 55℃.

[0101] At the same time, positive control, negative control and blank control tests are carried out. The positive control is Burkholderia glumae (Pseudomonas cocovenenans Ferriacei subspecies) (CICC 25132), the negative control is Burkholderia glumae (pathogenic variety of onion) (ATCC 19302), and the blank control is ddH2O, and 3 repeats are carried out.

[0102] The results are as follows Figure 1As shown, the primer pair of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 has the highest sensitivity, the best specificity and the optimal detection efficiency (E = 96.2%, R 2 = 0.996) for Burkholderia glumae (Pseudomonas cocovenenana) (see Figure 2 ), and therefore the present application determines the primer as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3. The first group of primers, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 3, fails to obtain an amplification curve, and the rest of the second, third and fourth groups of primers have a later Ct value, lower sensitivity, and are prone to false negative results for low concentration samples compared with the primers of the present application, and cannot achieve accurate detection of Burkholderia glumae (Pseudomonas cocovenenana).

[0103] Step 3: The microdroplet digital PCR amplification reaction system is used to amplify the DNA sample (concentration of 1000 pg / μL) to be tested by using the primer (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3), and the signal of the amplification product is detected to obtain the detection result; wherein the microdroplet digital PCR reaction system comprises the microdroplet digital PCR specific primer.

[0104] The microdroplet digital PCR reaction system is 20 μL, comprising 1.8 μL of each of the upstream primer 10 μmol / L and the downstream primer 10 μmol / L, 0.7 μL of the probe 10 μmol / L; the rest of the reagent components are respectively: ddPCRTM premix (SuperMix for Probes, no dUTP) 10 μL, ddH2O 3.7 μL, DNA template 2 μL. The DNA template is the extracted DNA to be tested.

[0105] At the same time, positive control, negative control and blank control tests are carried out. The positive control is Burkholderia glumae (Pseudomonas cocovenenana) (CICC 25132), the negative control is Burkholderia glumae (Pseudomonas cocovenenana) (ATCC 19302), and the blank control is ddH2O. Microdroplet digital PCR amplification and fluorescence signal detection are carried out, and 3 repeated tests are carried out.

[0106] The specific detection process is as follows: the microdroplet digital PCR reaction system (20 μL) is transferred to the reaction sample hole of the microdroplet generation card slot by using a pipette, 70 μL of microdroplet generation oil is added to the oil hole of the microdroplet generation card slot, and then the microdroplet generation instrument is covered with a rubber pad and placed in the microdroplet generation instrument for reaction system microdroplet generation. After the microdroplet generation reaction is completed, the microdroplet generation card slot is taken out, and the generated microdroplets are transferred to the PCR plate, and the film is sealed by using a film sealing instrument.

[0107] The sealed PCR plate is transferred to the PCR instrument (T100TM Thermal Cycler) for microdroplet digital PCR amplification program, specifically: the first step is amplification at 95°C for 10 min, 1 cycle; the second step is amplification at 94°C for 30 s, and then amplification at 56°C for 1 min, 40 cycles; the third step is amplification at 98°C for 10 min, 1 cycle.

[0108] After the microdroplet digital PCR amplification program is completed, the PCR plate is taken out, and the result reading is performed by using a microdroplet detection instrument (QX200TM Droplet Reader), so as to obtain the DNA microdroplet digital PCR spectrum and gene copy number of the sample to be detected.

[0109] The results are shown in Table 1. Figure 3 As shown in Table 1, the average value of the gene copy number of the three repeated detection results is 1274.67 copies / μL, and the relative standard deviation is 1.13%, indicating that the DNA concentration of the present application is 1000 pg / μL, and the gene copy number can be accurately detected.

[0110] Example 2

[0111] Step 1: basically the same as step 1 of example 1, the difference is that the DNA concentration of the sample to be detected is 40 pg / μL, and the A260 / 280 is 1.80.

[0112] Step 2: using a microdroplet digital PCR amplification reaction system, the DNA sample to be detected is subjected to microdroplet digital PCR amplification, the amplification product signal is detected, and the detection result is obtained; wherein the microdroplet digital PCR reaction system comprises the microdroplet digital PCR specific primer.

[0113] The microdroplet digital PCR reaction system is 20 μL, which comprises 1.8 μL of upstream primer 10 μmol / L and downstream primer 10 μmol / L, 0.7 μL of probe 10 μmol / L; the rest of the reagent components are respectively: ddPCRTM premix (SuperMix for Probes, no dUTP) 10 μL, ddH2O 3.7 μL, DNA template 2 μL. The DNA template is the extracted DNA to be detected.

[0114] Meanwhile, positive control, negative control and blank control tests are carried out. The positive control is Burkholderia glumae (Pseudomonas cocovenenans var. Fermentum) (CICC 25132), the negative control is Burkholderia glumae (Pseudomonas cepacia) (ATCC 19302), and the blank control is ddH2O. Microdroplet digital PCR amplification and fluorescence signal detection are carried out, and the test is repeated for three times.

[0115] The specific detection process is as follows: the microdroplet digital PCR reaction system (20 μL) is transferred to the reaction sample hole of the microdroplet generation card slot by using a pipette, 70 μL of microdroplet generation oil is added to the oil hole of the microdroplet generation card slot, a rubber pad is covered, and then the microdroplet generation instrument is put into the reaction system microdroplet generation instrument for reaction.

[0116] The sealed PCR plate is transferred to a PCR instrument (T100TM Thermal Cycler) for microdroplet digital PCR amplification program, specifically: the first step is amplification at 95℃ for 10 min, 1 cycle; the second step is amplification at 94℃ for 30 s, and then amplification at 56℃ for 1 min, 40 cycles; the third step is amplification at 98℃ for 10 min, 1 cycle.

[0117] After the microdroplet digital PCR amplification program is completed, the PCR plate is taken out, and the result reading is carried out by using a microdroplet detection instrument (QX200TM Droplet Reader), so as to obtain the DNA microdroplet digital PCR spectrum and gene copy number of the sample to be detected.

[0118] The results are shown in Table 1. Figure 4 The average value of the gene copy number of the three repeated detection results is 49.20 copies / μL, and the relative standard deviation is 3.07%, indicating that the DNA concentration of the present application is 40 pg / μL, and the gene copy number can be accurately detected.

[0119] Example 3

[0120] The difference between the present application and example 2 is that the DNA concentration of the sample to be detected is 1.6 pg / μL, and A260 / A280 is 1.88.

[0121] The detection results are shown in Table 2. Figure 5 The average value of the gene copy number of the three repeated detection results is 1.60 copies / μL, and the relative standard deviation is 16.25%, indicating that the DNA concentration of the present application is 1.6 pg / μL, and the gene copy number can be accurately detected.

[0122] Verification Example 1 Quantitative Detection Test of Artificially Contaminated Sample

[0123] The verification example prepares a rice flour sample with a target detection result of negative (high temperature and high pressure sterilization), takes 25g of the sample in a filter homogenization bag, adds about 10 7 CFU / mL B. pseudomallei (CICC25132) bacterial suspension 2.5mL, to prepare an artificially contaminated sample.

[0124] Add 222.5mL of sterile physiological saline to the artificially contaminated sample, and homogenize to prepare a 1:10 sample homogenate (at this time, the dilution multiple of the bacterial liquid is 1:100, and the concentration is about 10 5 CFU / mL), 1mL of the sample homogenate is taken for DNA extraction, and then microdroplet digital PCR detection is performed, and the same concentration is taken for plate colony counting, which needs to be diluted by 10 times in series, and after the template DNA extraction is completed, the same 10 times in series dilution is performed for microdroplet digital PCR detection.

[0125] The microdroplet digital PCR can directly obtain the copy number of the target gene in each reaction, and the conversion formula of the copy number and the corresponding bacterial liquid concentration is as follows: C=C0*V0 / (V1*V2), wherein C is the bacterial liquid concentration (CFU / mL) converted from the copy number of the microdroplet digital PCR, C0 is the copy number concentration (copies / μL) in the reaction system, V0 is the final constant volume of DNA extraction (μL), V1 is the amount of DNA template in the microdroplet digital PCR reaction system (μL), and V2 is the volume of the bacterial liquid used for DNA extraction (mL).

[0126] Table 1 detects B. pseudomallei (B. pseudomallei glutinosum subspecies) in artificially contaminated samples

[0127]

[0128] As can be seen from Table 1, in the quantitative detection test of the artificially contaminated sample, the number of colonies obtained by substituting the gene copy number detected by the microdroplet digital PCR into the formula is not much different from the theoretical added amount, the lowest detectable theoretical added value of 63 CFU / mL of B. pseudomallei (B. pseudomallei glutinosum subspecies) can be detected, the relative standard deviation (RSD) of the microdroplet digital PCR detection is in the range of 0.45% to 19.56%, and all are <25% in the acceptable range. The microdroplet digital PCR detection result has no signal amplification in the blank control test, and the result is negative.

[0129] Conclusion: The detection method of the application can be applied to rapid high-throughput quantitative detection of B. pseudomallei (B. pseudomallei glutinosum subspecies) in food and other categories.

[0130] Verification example 2 specificity test

[0131] This verification example tests the specificity of the droplet digital PCR reaction system and the droplet digital PCR amplification primers of the present invention. Specifically, the droplet digital PCR detection method described in Verification Example 1 is used to detect the DNA samples of 21 standard strains tested in this example, and the fluorescence signal of the amplification product is detected to verify the specificity of the droplet digital PCR primers and probes in the detection method.

[0132] Test results are shown Figure 6 As shown in Table 2, the present invention performed droplet digital PCR amplification on DNA samples of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*). Positive amplification signals were observed for *Burkholderia gladioli* (CICC 25132 and ATCC 33664), while no amplification signals were observed for *Burkholderia gladioli* of unknown pathogenicity (CICC 10574), *Burkholderia gladioli* of onion pathogenicity (ATCC 19302), *Burkholderia gladioli* of gladioli pathogenicity (ATCC 10248), and 16 other standard strains, resulting in negative results. Therefore, it can be concluded that the detection method of the present invention has good specificity for *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*).

[0133] Table 2. Specificity detection results of the microdroplet digital PCR amplification primers and probes of the present invention.

[0134]

[0135] Note: + indicates detected; - indicates not detected.

[0136] Validation Example 3: Limit of Quantitation Test of Detection Method

[0137] To determine the quantitation limit range of the droplet digital PCR reaction system, 5000 pg / μL of *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) sample DNA was diluted to 1000 pg / μL, 200 pg / μL, 40 pg / μL, 8 pg / μL, 1.6 pg / μL, and 0.32 pg / μL, for a total of seven concentration gradients. The droplet digital PCR detection method described in Example 1 was used to amplify the *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*) sample DNA at these seven concentration gradients. The amplification product signals were detected to determine the quantitation limit of the method of this invention. Each concentration gradient was tested in triplicate to verify the quantitation limit range of the method system. The detection results are shown in Table 3. The standard curve fitting data within the linear range is shown in Table 3. Figure 8 As shown.

[0138] Table 3. Limits of Quantitation (LOQ) of Droplet Digital PCR Method for *Burkholderia gladioli* (*Pseudomonas cocovenenans* subsp. *farinofermentans*).

[0139]

[0140] The linear graph of the target gene bonM was plotted with the template DNA concentration as the horizontal coordinate and the number of copies of the target sequence per microliter as the vertical coordinate according to the detection results of different DNA concentrations on the gene copy number in Table 3. Figure 7 It can be seen that, in the template DNA concentration of 1.6-5000 pg / μL, the copy number of the target gene bonM presents good linearity in the interval of 1.6-5483.33, the correlation coefficient R 2 is 1, and the RSD values of all concentrations are between 1.13% and 16.25%, which meets the requirement of less than 25%. It is shown that the method has good quantitative detection capability when the DNA concentration of P. cocovenenans (P. cocovenenans var. sphaeria) is 1.6-5000 pg / μL.

[0141] Verification Example 4 Detection Reproducibility Test

[0142] The lowest template DNA concentration that can be stably amplified in the linear range verification of Verification Example 3 was taken for the verification of the limit of quantitation (LOQ), and the template DNA concentration of 1.6 pg / μL was taken for the quantitative detection limit of the target gene bonM in the method. Therefore, the template DNA of this concentration was taken, and the microdroplet digital PCR detection method described in Example 1 was used for PCR amplification of the template DNA of this concentration, and 10 repeated tests were performed, and the obtained graph is shown in Figure 8 . The average value and RSD were calculated, and the test results are shown in Table 4.

[0143] Table 4 Reproducibility Test and Quantitative Limit of the Microdroplet Digital PCR Method of P. cocovenenans (P. cocovenenans var. sphaeria)

[0144]

[0145] It can be seen from Table 4 that the template DNA concentration of the target gene bonM at the level of 1.6 pg / μL was repeatedly amplified for 10 times, the average value of the target gene copy number was 1.78 / μL, and the RSD was 16.29% (<25%), which met the method requirement, and it was shown that the method could stably and quantitatively detect the bonM gene of the unit system.

[0146] In summary, the micro-droplet digital PCR amplification specific primer and detection system of the Birkholderia gladioli (Pseudomonas cocovenenans fermentum subspecies) of the application has high specificity, high sensitivity and good stability, can realize quantitative detection of the Birkholderia gladioli (Pseudomonas cocovenenans fermentum subspecies) quickly and in high throughput, especially can realize quantitative detection of trace sample DNA before the bacteria proliferate in large amount, plays an important role in the fields of food risk monitoring, rapid early warning, food safety guarantee and rapid detection of trace sample in food poisoning, and has good application prospect. In addition, the detection kit formed by the micro-droplet digital PCR amplification specific primer and related reagents of the Birkholderia gladioli (Pseudomonas cocovenenans fermentum subspecies) has wide application range and strong practicability, can be more directly and conveniently applied in the field of food safety, reduces the occurrence of food poisoning accidents, and guarantees the safety of people's lives.

[0147] The above only describes the preferred embodiments of the application, and it should be noted that, for those skilled in the art, some improvements and refinements can be made without departing from the principles of the application, and these improvements and refinements should also be considered as the protection scope of the application.

Claims

1. A primer-probe set, characterized in that, include: Primer set and probe; The sequences of the primer set are shown in SEQ ID NO:1 and SEQ ID NO:2; The sequence of the probe is shown in SEQ ID NO:

3.

2. The application of the primer-probe set as described in claim 1 in any of the following: (I) Detection of Burkholderia gladioli; and / or (II) Preparation of products for the detection of Burkholderia gladioli; and / or (III) Detection of Burkholderia gladioli content; and / or (IV) Preparation of products for detecting Burkholderia gladioli content; and / or (V) Detection of the content of Burkholderia gladioli in food; and / or (VI) Detect the presence of Burkholderia gladioli in food.

3. A detection reagent, characterized in that, include: The primer and probe set as described in claim 1, and acceptable auxiliaries and / or excipients.

4. A test kit, characterized in that, include: The primer-probe set as described in claim 1 and / or the detection reagent as described in claim 3, as well as acceptable adjuvants, excipients and / or devices.

5. The detection kit as described in claim 4, characterized in that, The concentrations of the primer set and the probe are each 10 μmol / L.

6. An apparatus, characterized in that, Including acceptable components, and the package includes: (1) The primer-probe set as described in claim 1; or (2) The detection reagent as described in claim 3.

7. A method for detecting Burkholderia gladioli, characterized in that, The primer and probe set as described in claim 1 is used to amplify and detect the sample to be tested, and the detection results are obtained. The detection method used was droplet digital PCR.

8. The detection method as described in claim 7, characterized in that, The concentration of DNA in the sample to be tested is 1.6~1000 pg / μL.

Images