An InDel molecular marker tightly linked to the major QTL of fiber length in upland cotton and its application

Abstract

The present invention discloses an InDel molecular marker tightly linked to a major effect QTL of upland cotton fiber length and its application, and relates to the technical field of cotton molecular breeding. The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.4, and can be amplified and identified by a forward primer having a nucleotide sequence such as SEQ ID NO.1 and a reverse primer having a nucleotide sequence such as SEQ ID NO.2. The InDel molecular marker A9-35 provided by the present invention can be tightly linked to the major effect QTL of fiber length of upland cotton A9 chromosome, lays the foundation for the positional cloning of cotton fiber length genes, and can be applied to molecular marker-assisted selection breeding and molecular polymerization breeding of cotton fiber quality to improve selection and polymerization efficiency.

Description

Technical Field

[0001] The present invention relates to the technical field of cotton molecular breeding, and more particularly to an InDel molecular marker tightly linked to a major effect QTL of upland cotton fiber length and an application thereof. Background Art

[0002] Cotton is an important cash crop, accounting for about 35% of the world's annual fiber demand. It provides raw materials for more than 50 industries such as textiles, papermaking, and medicine, and has a high economic status in the global market. At present, the per-acre yield of cotton has increased significantly, but there is still a large gap in the output of high-quality cotton, which cannot meet the textile industry's demand for the "quality" of raw cotton. Therefore, improving the quality of cotton fiber remains an important goal of cotton breeding. Cotton fiber quality traits mainly include fiber length, fiber strength, micronaire value, uniformity index and elongation. There is a significant correlation between the main fiber quality traits. Therefore, the mining of molecular markers that are closely linked to the main effect QTL of cotton fiber length is a problem that technicians in this field urgently need to solve. It will provide a basis and basis for the molecular marker-assisted selection of high-quality cotton varieties and greatly accelerate the process of molecular breeding. Summary of the invention

[0003] In view of this, the present invention provides an InDel molecular marker tightly linked to a major QTL for fiber length in upland cotton and application thereof.

[0004] In order to achieve the above object, the present invention adopts the following technical solution:

[0005] An InDel molecular marker tightly linked to a major QTL for fiber length in upland cotton, the nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.3.

[0006] As a preferred solution, the InDel molecular marker is located on the cotton A9 chromosome, between A09:6297275-A09:6297276, and is an insertion / deletion of 40 bp.

[0007] Another object of the present invention is to provide a primer pair for detecting the above-mentioned InDel molecular marker, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.2.

[0008] Another object of the present invention is to provide a product for detecting the above-mentioned InDel molecular marker, wherein the product comprises the above-mentioned primer pair.

[0009] As a preferred solution, the product is a kit.

[0010] Another object of the present invention is to provide an application of the above-mentioned InDel molecular marker, or the above-mentioned primer pair, or the above-mentioned product in cotton breeding, wherein the application is any one of the following:

[0011] A: Increase cotton fiber length;

[0012] B: Identify high-quality cotton resources;

[0013] C: Improvement of cotton varieties.

[0014] Another object of the present invention is to provide a method for detecting the length of cotton fibers, using the above-mentioned primer pair or the above-mentioned product to detect cotton samples. When the amplified product has only a 277bp band, the cotton fiber length is shorter; when the amplified product has only a 237bp band, the cotton fiber length is longer; when the amplified product contains two bands of 277bp and 237bp, the cotton fiber length is medium.

[0015] Beneficial effects: The InDel molecular marker A9-35 provided by the present invention can be tightly linked to the major QTL of fiber length on chromosome A9 of upland cotton, laying the foundation for the map-based cloning of cotton fiber length genes, and can be applied to molecular marker-assisted selection breeding and molecular polymerization breeding of cotton fiber quality to improve selection and polymerization efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0017] Figure 1 This is the location of the introduced fragment on the chromosome of the introduced line C14, where the red fragment represents the introduced fragment of the Sea Island cotton chromosome.

[0018] Figure 2 Relative positions of QTLs (qFL-1 and qFL-2) on chromosome A9.

[0019] Figure 3 The marker types were detected by polyacrylamide gel electrophoresis, where P1 is the band type of the parent Jimian 262, P2 is the band type of the parent C14, and the gel wells from left to right are Marker, P2, P1, and group band types. DETAILED DESCRIPTION

[0020] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0021] Example 1

[0022] 1. Using upland cotton Jimian 262 as the female parent and sea island cotton Hai7124 as the male parent, the F1 was obtained by hybridization. Then, Jimian 262 was used as the recurrent parent for four consecutive backcrossing generations and then self-pollination for four generations to obtain a set of sea island cotton chromosome fragment introgression line BC4S4 population. Through fiber quality measurement, the introgression lines with significant differences in fiber length traits compared with the recurrent parent were screened.

[0023] 2. With reference to the linkage map of sea and land (Zhao L, Lv Y, Cai C, et al. Toward allotetraploid cotton genome assembly: integration of a high-density molecular genetic linkage map with DNA sequence information [J]. BMC Genomics. 2012, 13 (1): 539.), 459 pairs of SSR molecular markers with significant polymorphism were uniformly selected for molecular identification of the introduced lines. Through molecular marker identification, the introduced line C14 contained two homozygous sea island cotton chromosome introduced fragments, which were distributed on A9 (JESPR274-TMF18) and D13 (BNL2652-NAU5387), respectively. The total length of the introduced fragments was 21.932 cM, the total length of the map was 3677.600 cM, and the background homozygosity reached 99.404% (see Appendix Figure 1 The comparison of the characteristics of C14, Hai 7124 and Ji Mian 262 is as follows (Table 1):

[0024] Table 1 Comparison of the average values ​​of the main traits of the parents in two years and three replicates

[0025]

[0026] SSR reaction system (10 μL): 0.5 μL of each of 5 μM / μL upstream and downstream primers, 1.0 μL of 20-100 ng / μL Template DNA, 4.7 μL of 2*M5 Taq PCRmix, and 3.3 μL of ddH2O.

[0027] Reaction program (PTC-100 (MJ research) thermal cycler): 95°C for 5 min; 94°C for 45 s, 57°C for 45 s, 72°C for 1 min (30 cycles); 72°C for 10 min; 10°C for 1 min.

[0028] Non-denaturing polyacrylamide gel electrophoresis: gel concentration 9%, electrophoresis buffer 1×TBE, 220V constant voltage electrophoresis for 1 hour and 45 minutes.

[0029] After electrophoresis, silver staining was performed according to the method of Zhang Jun et al. (Zhang Jun, Wu Yaoting, Guo Wangzhen, et al. PAGE / silver staining rapid detection of cotton microsatellite markers. Cotton Science, 2000, 12(5): 267-269.).

[0030] 3. A secondary segregation population was constructed with C14 as the male parent and the recurrent parent Jimian 262 as the female parent, including 2040 plants. Combining BSA pool construction and high-throughput sequencing technology, ED and ΔSNP-index algorithms were used to analyze the variation information, and 7 candidate regions related to fiber length traits were obtained (distributed on chromosomes A9 and D13, including 33 candidate genes). 47 pairs of high-density InDel markers were developed in the differential segments (see Table 2).

[0031] Table 247 InDel markers

[0032]

[0033]

[0034] Combining the SSR molecular markers used for molecular identification in the early stage and the phenotypic data of the secondary population, winQTLCart 2.5 software was used to locate the fiber length QTL. In this study, two QTLs were identified (see Table 3 and Appendix Figure 2 )

[0035] Table 3 QTL analysis of fiber length

[0036]

[0037] 200 plants were randomly selected from the secondary population, and their leaf DNA was extracted by CTAB method. Polypropylene gel electrophoresis was used to detect population banding using 47 pairs of Indel markers and 474 pairs of SSR markers, and a significance analysis was performed between fiber length traits and genotypes.

[0038] The analysis showed that there was a significant difference between the individual genotype and fiber length trait of the Indel marker A9-35 located on qFL-1. The rules for reading the gel after electrophoresis of A9-35 amplification are as follows: in the secondary population, the one with the same band type as the parent P1 is marked as "1", and the fiber length of this type of individual plants is generally shorter; the one with the same band type as the parent P2 is marked as "2", and the fiber length of this type of individual plants is generally longer; the one with both of the above band types is marked as "3", and the fiber length trait of this type is between "1" and "2". The one with no amplification results is marked as "-" (see Appendix Figure 3 ).

[0039] A9-35 Primer:

[0040] Upstream primer: AACTGCTCATCCAAACCCAC, SEQ ID NO.1;

[0041] Downstream primer: GGTGAGTAAAGCCCTGGTCA, SEQ ID NO. 2;

[0042] The InDel molecular marker is located between A09:6297275-A09:6297276, which is a 40 bp insertion / deletion. The nucleotide sequence is as follows:

[0043] AACATAAATATACTTCCAAACTCAAAGCCCAAATGTAGGA, SEQ ID NO. 3.

[0044] Parent P1 amplification product: (the underlined part is the inserted fragment)

[0045] AACTGCTCATCCAAACCCACCCTAAACCAAAAAAACTTTTCAATGTTGAATTAAGCATATTAGCCATCCTTCAAAAAAATATTTATCAAATCCTTACCT AACATAAATATACTTCCAAACTCAAAGCCCAAATGTAGGA AACATTTTATCATTATATTACATTTAAAAAATTTAAAAATACGGTTAATTAACTTAATAATTATCTTGAAACATTAAATTCGTTATTGTATTAGAACTCTTATAGTTATAGCCATGGTTGACCAGGGCTTTACTCACC, SEQ ID NO.4;

[0046] Parental P2 amplification product:

[0047] AACTGCTCATCCAAACCCACCCTAAACCAAAAAAACTTTTCAATGTTGAATTAAGCATATTAGCCATCCTTCAAAAAAATATTTATCAAATCCTTACCTAACATTTTATCATTATATTACATTTAAAAAAATTTAAAAATACGGTTAATTAACTTAATAATTATCTTGAAACATTAAATTCGTTATTGTATTAGAACTCTTATAGTTATAGCCATGGTTGACCAGGGCTTTACTCACC, SEQ ID NO.5;

[0048] The significance analysis of fiber length difference between the individual plants with band type marked as "1" and the individual plants marked as "2" and "3" in the population is shown in Table 4. The P value is 0.000216, indicating that there is an extremely significant difference in the fiber length traits of the two types, indicating that the marker can efficiently detect the fiber length trait in this population.

[0049] Table 4 Significance analysis of fiber length of two types of plants

[0050]

[0051]

[0052] In this population, fiber length is extremely significantly positively correlated with fiber strength, and extremely significantly negatively correlated with micronaire value (Li Xinghe, Liu Cunjing, Tang Liyuan, et al. Quantitative genetic analysis of fiber quality traits in the F2 population of the land-sea introgression line [J]. Shandong Agricultural Science, 2023, 55(03): 15-21. DOI: 10.14083 / j.issn.1001-4942.2023.03.003.). Therefore, the InDel marker A9-35 will play a greater role in the future breeding of high-quality cotton.

[0053] The present invention provides an InDel molecular marker A9-35 that is tightly linked to the major QTL for fiber length on the chromosome of upland cotton A9. The InDel molecular marker A9-35 provided by the present invention can be tightly linked to the major QTL for fiber length on the chromosome of upland cotton A9, laying a foundation for the positional cloning of cotton fiber length genes, and can be applied to molecular marker-assisted selection breeding and molecular polymerized breeding for cotton fiber quality to improve selection and polymerized efficiency.

[0054] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0055] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A primer pair for detecting InDel molecular markers, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.2; Moreover, the InDel molecular marker is located on chromosome A9 of cotton genome TM-1_v2.1, between A09:6297275-A09:6297276, is an insertion / deletion of 40 bp, and the nucleotide sequence is shown in SEQ ID NO.

3.

2. A product for detecting InDel molecular markers, characterized in that: The product comprises the primer pair of claim 1; Moreover, the InDel molecular marker is located on chromosome A9 of cotton genome TM-1_v2.1, between A09:6297275-A09:6297276, is an insertion / deletion of 40 bp, and the nucleotide sequence is shown in SEQ ID NO.

3.

3. The product for detecting InDel molecular markers according to claim 2, characterized in that: The product is a test kit.

4. Use of the primer pair according to claim 1 or the product according to claim 2 or 3 in cotton breeding, characterized in that: The application is any of the following: A: Increase the fiber length of upland cotton; B: Identify high-quality long-fiber resources of upland cotton; C: Improvement of long-fiber varieties of upland cotton; When the primer pair described in claim 1 or the product described in claim 2 or 3 is used to detect upland cotton samples, when the amplified product has only a 277bp band, the cotton fiber length is shorter; when the amplified product has only a 237bp band, the cotton fiber length is longer; when the amplified product contains two bands of 277bp and 237bp, the cotton fiber length is medium.

5. A method for detecting the length of cotton fibers, characterized in that: The cotton is upland cotton; When cotton samples are detected using the primer pair described in claim 1 or the product described in claim 2 or 3, when the amplified product has only a 277bp band, the cotton fiber length is shorter; when the amplified product has only a 237bp band, the cotton fiber length is longer; when the amplified product contains two bands of 277bp and 237bp, the cotton fiber length is medium.

Images