A fusion antigen of swine flu virus, a kit, and a preparation method and application thereof

Abstract

The present invention discloses a fusion antigen of a porcine Geta virus, a kit, a preparation method thereof and an application thereof. The fusion antigen of the Geta virus is mainly obtained by recombining a Gaussian luciferase gene with a codon-optimized GETV E2 antigen gene to obtain an expression vector, and then the expression vector containing GLuc-E2 is transfected into a mammalian cell line, and the GLuc-E2 protein is expressed in the cell supernatant in a secretory form. There is no need to perform a protein purification step, and the cell supernatant can be directly collected for disease detection. The present invention has strong specificity and does not cross-react with African swine fever virus, porcine reproductive and respiratory syndrome virus, porcine circovirus, pseudorabies virus, and porcine Japanese encephalitis virus.

Description

Technical Field

[0001] The invention belongs to the technical field of virus detection, and in particular relates to a fusion antigen of swine flu virus, a kit, a preparation method and application thereof. Background Art

[0002] Getah Virus (GETV) is a single-stranded positive-strand RNA virus belonging to the genus Alphavirus of the family Togaviridae. GETV is transmitted through mosquito bites and infects vertebrates, mainly pigs and horses, causing reproductive disorders in sows, miscarriage in pregnant sows, stillbirth or weak piglets, and fever, rash, edema of the hind legs, and swollen lymph nodes in horses. In addition, neutralizing antibodies against GETV have been detected in human serum, and the specific antibody titer of people with fever is significantly higher than that of those with subclinical symptoms, indicating that GETV is a potential zoonotic virus.

[0003] Swine GETV disease is common in the summer and autumn when mosquitoes are present. The clinical symptoms of pigs infected with GETV, such as reproductive disorders, piglet diarrhea and dyspnea, are similar to the clinical symptoms of diseases such as porcine epidemic diarrhea or porcine reproductive and respiratory syndrome, which leads to the disease being often mistaken for other porcine reproductive disorders or diarrheal diseases, and cannot be diagnosed and prevented in time. Therefore, the establishment of a rapid and accurate disease diagnosis and detection method is of great significance for the prevention and control of swine GETV disease. At present, the only commercial detection kit for GETV in pigs is the nucleic acid detection kit (fluorescent RT-PCR dye method), but the RT-PCR method has problems such as cumbersome operation steps, high requirements for experimental instruments, and easy cross-contamination. In addition, laboratories have also established serological detection methods for porcine GETV, such as indirect ELISA and double antibody sandwich ELISA, but the specificity and accuracy of the ELISA method mainly depend on the quality of the preparation of GETV antigens and antibodies; and the ELISA method has high requirements for enzyme activity and sensitivity. If the reaction concentration of the antigen or antibody and the enzyme-bound substrate is low, the final absorbance value will be too small, and false negatives are prone to occur. Therefore, there is currently a lack of a highly sensitive clinical detection method for GETV. Summary of the invention

[0004] The present invention aims to solve the technical problem and overcomes the shortcomings of the prior art to provide a fusion antigen of swine fever virus, a kit and a preparation method and application thereof. The luciferase immunoprecipitation method is adopted and can be used for swine fever virus infection detection according to the fluorescence intensity. The detection is fast and simple, with high sensitivity and high signal-to-noise ratio, and the measurement value is stable and reliable.

[0005] In order to achieve the purpose of the present invention, the present invention adopts the following technical solutions:

[0006] A technical solution of the present invention: a fusion antigen of swine flu virus, wherein the fusion antigen is a GLuc-E2 fusion protein, and the amino acid sequence of the GLuc-E2 fusion protein is shown in SEQ ID No.2.

[0007] The fusion antigen of the GETV virus is mainly obtained by recombining the Gaussia luciferase (GLuc) gene with the codon-optimized GETV E2 antigen gene to obtain an expression vector, and then the expression vector containing GLuc-E2 is transfected into a mammalian cell line, and the GLuc-E2 protein is expressed in the cell supernatant in a secretory form. No protein purification step is required, and the cell supernatant can be directly collected for disease detection.

[0008] Preferably, the mammalian cell line is HEK-293T cells.

[0009] The present invention also provides a method for preparing a fusion antigen of swine flu virus, comprising the following steps:

[0010] S1. With reference to the complete gene sequence of the E2 protein of the GETV strain, codon optimization was performed and the nucleotide sequence was synthesized. The E2 gene after sequence optimization was connected to the eukaryotic vector PCAGGS(+) plasmid to obtain the recombinant plasmid pCAGGS-E2;

[0011] S2, using plasmid pCAGGS-E2 as template, using primers

[0012] F: AAGGGGAGTGGCGATATCTCTGTGACAGAGCACTTTA and R: AAAAAGATCTGCTAGCTCGAGTCAAGGGTACAGGCCGTAGT were used to amplify the E2 fragment, and then the amplified E2 antigen gene fragment and the pCAGGS-GLuc vector plasmid carrying the GLuc gene were double-digested with EcoRV and XhoI, and the digested products were connected with T4 ligase to obtain the recombinant plasmid pCAGGS-Gluc-E2;

[0013] S3. Culture HEK-293T cells. When the cell density reaches 60-70%, transfect the recombinant plasmid pCAGGS-Gluc-E2 with lipofectamine2000 liposome nucleic acid transfection reagent. Then culture the transfected 293T cells. After culture, collect the cell supernatant and centrifuge. The collected supernatant is the fusion protein GLuc-E2.

[0014] Another technical solution of the present invention: a luciferase immunoprecipitation kit for detecting swine flu virus, comprising the following components: sample diluent, blocking solution, GLuc-E2 protein solution, protein A coated ELISA plate, washing solution, luciferase substrate, positive control, and negative control.

[0015] Preferably, the sample diluent is a phosphate buffer solution with a pH of 7.4; the washing solution is a PBS solution containing 0.05% Tween-20; and the luciferase substrate is 20 μM coelenterazine h.

[0016] Preferably, the blocking solution is at least one of 1% BSA, 5% skim milk or 10% skim milk; the positive control is a standard positive serum of swine fever virus, and the negative control is a standard negative serum of swine fever virus.

[0017] Preferably, the preparation and storage method of the protein A-coated ELISA plate is as follows: protein A protein is prepared into a protein A solution with a concentration of 20 μg / mL using PBS solution, the protein A solution is added to the ELISA plate at a rate of 100 μL / well, the ELISA plate is coated, incubated at 4°C for 16 hours, the protein A solution is discarded, the plate is washed 5 times with 300 μL / well of PBST solution, and the plate is dried and stored at 4°C.

[0018] Another technical solution of the present invention is a method for constructing a luciferase immunoprecipitation kit for swine flu virus disease, comprising the following steps:

[0019] S1. preparing the GLuc-E2 fusion protein solution of Gluc virus;

[0020] S2. Determine a blocking solution, wherein the blocking solution is at least one of 1% BSA, 5% skim milk or 10% skim milk;

[0021] S3, sealing, determine the sealing temperature is 37 ° C, the sealing time is 1 hour;

[0022] S4, incubate, determine the incubation temperature is 37 ° C, the incubation time is 1 h;

[0023] S5. Add fusion antigen and determine the amount of fusion antigen added to be 10 7 Fluorescence units;

[0024] S6. Dilute the serum samples to be tested and the Gehrig's disease-positive or -negative serum samples and determine that the serum dilution ratio is 1:100.

[0025] The detection method of the above kit comprises the following steps:

[0026] S1. Balance: Take the kit out of the refrigerated environment and equilibrate it at room temperature for 15 minutes before use;

[0027] S2, blocking, add 300 μL of blocking solution to each well of the protein A-coated ELISA plate after equilibration at room temperature, incubate at 37°C for 1 hour, then discard the solution, add 300 μL of washing solution to each reaction well, let it stand for 5 minutes, discard it, wash it 5 times, and dry the reaction plate for the last time;

[0028] S3, sample dilution, dilute the serum sample to be tested, positive control and negative control samples 100 times with sample diluent and set aside for use;

[0029] S4, dilution of fusion protein solution: dilute the GLuc-E2 fusion antigen to 107 fluorescence units with sample diluent;

[0030] S5. Add samples. Mix the diluted samples to be tested and the positive and negative control sera with 107 fluorescent units of GLuc-E2 fusion antigen, respectively, for a total of 100 μL, and add them to the blocked protein A-coated ELISA plate.

[0031] S6, reaction, cover the reaction plate with a sealing film, place in a 37°C incubator, and incubate for 1 hour;

[0032] S7, wash the plate, spin dry the reaction liquid in the wells, fill each reaction well with diluted washing solution, let stand for 5 minutes, and discard the washing solution; wash 5 times in this way, and dry the reaction plate for the last time;

[0033] S8, add substrate and detect, add 50 μL of luciferase substrate to each well, place in LumiStation-1800 luminescence detector to detect fluorescence value, and record;

[0034] S9. Result determination: when the test value of the serum sample to be tested / the average value of the negative test is ≥ 41.57, it is judged to be positive.

[0035] A further preferred technical solution of the present invention is the use of the above-mentioned fusion antigen of swine flu virus in the preparation of a product for detecting swine flu virus, wherein the product is a reagent or a kit.

[0036] The beneficial effects of the present invention are as follows:

[0037] (1) The GLuc-E2 fusion antigen selected in the present invention is expressed in the cell supernatant in a secretory form, which has high expression efficiency, simple preparation, low cost, and does not require tedious steps such as protein purification.

[0038] (2) The present invention has strong specificity and does not cross-react with African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus (PCV2), pseudorabies virus (PRV), and porcine Japanese encephalitis virus (JEV).

[0039] (3) The detected swine flu virus positive and negative serum samples have a 100% coincidence rate with the immunofluorescence test results, with a high accuracy rate.

[0040] (4) The present invention is quick and simple to operate, the results can be reported within 3 hours, and it is not subject to technical restrictions. The operator can operate it according to the instructions.

[0041] (5) The present invention has high stability, and the intra-batch and inter-batch coefficients of variation are both less than 10%. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] For ease of explanation, the present invention is described in detail with reference to the following specific embodiments and the accompanying drawings.

[0043] Figure 1 This is a diagram of the expression and verification analysis of the recombinant GLuc-E2 protein.

[0044] Figure 2 The following is an analysis chart for determining the optimal blocking solution, optimal blocking temperature and time, and optimal reaction temperature and time. In the figure: A is the P / N value under the conditions of blocking at 25°C for 30 minutes and incubating at 37°C for 1 hour; B is the P / N value under the conditions of blocking at 25°C for 1 hour and incubating at 37°C for 1 hour; C is the P / N value under the conditions of blocking at 37°C for 30 minutes and incubating at 37°C for 1 hour; D is the P / N value under the conditions of blocking at 37°C for 1 hour and incubating at 37°C for 1 hour; E is the P / N value under the conditions of blocking at 37°C for 1 hour and incubating at 25°C for 30 minutes; F is the P / N value under the conditions of blocking at 37°C for 1 hour and incubating at 25°C for 1 hour; G is the P / N value under the conditions of blocking at 37°C for 1 hour and incubating at 37°C for 30 minutes.

[0045] Figure 3 This is a determination analysis chart of the optimal antigen concentration and the optimal serum dilution multiple. In the figure: A is the amount of antigen added is 10 5 The P / N value of each serum dilution multiple under the condition of 10 fluorescence units; B is the P / N value of each serum dilution multiple under the condition of 10 fluorescence units; 6 The P / N value of each serum dilution multiple under the condition of 10 fluorescence units; C is the amount of antigen added when 10 7 The P / N value of each serum dilution multiple under the condition of 1 fluorescence unit.

[0046] Figure 4 This is an analytical diagram for determining the positive and negative critical values ​​of the luciferase immunoprecipitation detection method for swine virus.

[0047] Figure 5 This is a diagram showing the specificity of the luciferase immunoprecipitation detection method for swine flu virus. DETAILED DESCRIPTION

[0048] The technical solution of the present invention is further described in detail below in conjunction with the embodiments: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0049] Unless otherwise specified, the materials, practices and experimental equipment involved in the embodiments of the present invention are all in line with commercially available products in the relevant chemical and biotechnology fields.

[0050] Example 1 Preparation of GLuc-E2 fusion protein of swine flu virus

[0051] 1.1 Construction of recombinant plasmid pCAGGS-GLuc-E2 eukaryotic expression vector

[0052] With reference to the complete gene sequence of E2 protein of GETV strain (Gen Bank: MT086508.1, MT269657.1 and MK693225.1), codon optimization was performed and nucleotide sequence was synthesized, as shown in SEQ ID No. 1. The optimized E2 gene sequence was synthesized by GenScript Biotech and ligated into the eukaryotic vector pCAGGS(+) plasmid (purchased from GenScript Biotech) to obtain the recombinant plasmid pCAGGS-E2.

[0053] Using plasmid pCAGGS-E2 as a template, the E2 fragment was amplified using primers F: AAGGGGAGTGGCGATATCTCTGTGACAGAGCACTTTA as shown in SEQ ID No. 3 and R: AAAAAGATCTGCTAGCTCGAGTCAAGGGTACAGGCCGTAGT as shown in SEQ ID No. 4. The obtained E2 antigen gene fragment and the pCAGGS-GLuc vector plasmid carrying the GLuc gene (constructed and preserved by the laboratory of the College of Veterinary Medicine of Yangzhou University) were double-digested with EcoRV and XhoI, and the digested products were ligated using T4 ligase to obtain the recombinant plasmid pCAGGS-GLuc-E2.

[0054] 1.2 Expression and verification of recombinant GLuc-E2 protein

[0055] HEK-293T cells (HEK-293T cells were stored in the laboratory of the School of Veterinary Medicine of Yangzhou University) were cultured in a 10 cm2 cell culture dish. When the cell density reached 60-70%, 8 μg of recombinant plasmid was transfected into 293T cells at a ratio of 1.5 μL:1 μg using lipofectamine 2000 liposome nucleic acid transfection reagent (purchased from Invitrogen), and the cells were then cultured in an incubator at 37°C and 5% CO2. After 60 hours of culture, the cell supernatant was collected and centrifuged at 4°C, 12000 rpm for 15 minutes to remove cell debris. The collected supernatant was the fusion protein GLuc-E2.

[0056] The collected cell supernatant was used to verify the expression of GLuc-E2 by Western-Blot and Luciferase experiments:

[0057] First, the collected cell supernatant was subjected to SDS-PAGE electrophoresis and protein electrotransfer (membrane transfer). The protein membrane was blocked in PBS buffer containing 5% w / v skim milk powder at 37°C for 2 hours, and then incubated with porcine GETV-positive serum at a serum dilution of 1:1000 at 4°C overnight; after incubation, the protein membrane was washed 3 times with PBST buffer and incubated with HRP-labeled goat anti-swine IgG antibody at a dilution of 1:2000 at room temperature for 1 hour, washed 3 times with PBST, and detected with a chemiluminescence detection kit. The results showed that the supernatant of cells transfected with pCAGGS-GLuc-E2 contained secreted GLuc-E2 and could be specifically recognized by porcine GETV-positive serum (see Figure 1 A).

[0058] Secondly, the collected cell supernatant was subjected to GLuc enzyme activity analysis. 20 μL of cell supernatant was reacted with 50 μL of GLuc fluorescent substrate-coelenterazine h (20 μM, coelenterazine h purchased from Shanghai Maokang Biotechnology Co., Ltd.), and the GLuc luciferase activity was detected using the LumiStation-1800 luminescence detector. The results showed that GLuc luciferase activity could be clearly detected in the cell supernatant, and the fluorescence unit reached 10 7.94 units / 100μL (see Figure 1 B).

[0059] Example 2 Parameter Optimization Experiment of Luciferase Immunoprecipitation Detection Method of Swine Virus Based on Recombinant Protein GLuc-E2 Protein

[0060] 2.1 Determination of the optimal blocking solution, temperature and time

[0061] Protein A (purchased from Tiandi Renhe Biotechnology Co., Ltd.) was diluted to a concentration of 20 μg / mL with a PBS solution of pH 7.4, and the above protein A solution was added to the ELISA plate at a rate of 100 μL / well. The ELISA plate was covered with a film and incubated at 4°C for 16 hours. The next day, the solution was discarded and the plate was washed five times with PBST for 5 minutes each time. The blocking solution was 5% skim milk, 10% skim milk, and 1% BSA prepared in PBS, respectively. The blocking temperature was 25°C and 37°C, respectively, and the blocking time was 30 minutes and 60 minutes, respectively. After completing the above conditions, the blocking solution was discarded, the plate was washed five times with PBST for 5 minutes each time, and a standard GETV-positive or -negative pig serum sample and 10 7 The total volume was 100 μL, and then incubated at 37°C for 1 h. Finally, the reaction liquid in the wells was dried and each reaction well was filled with diluted washing solution PBST (PBST containing 0.05%

[0062] Tween-20), let stand for 5 min, discard the washing solution; wash 5 times, and dry the reaction plate for the last time. Add 50 μL of luciferase substrate to each well, place in LumiStation-1800 luminescence detector to detect the fluorescence value, and record it.

[0063] The results show that the P / N value under each condition is calculated, such as Figure 2 As shown in the figure, 10% skim milk has the best blocking effect among the three blocking solutions. Figure 2 As shown, after blocking with 10% skim milk at 37°C for 1 hour, P1 / N was 290.75, P2 / N was 405.48, and P3 / N was 328.99, which were better than other conditions.

[0064] 2.2 Determination of optimal reaction temperature and time

[0065] According to the steps in 2.1, the protein A ELISA plate was coated and blocked with 10% skim milk at 37°C for 1h. According to step 2.1, 107 fluorescent units of GLuc-E2 fusion protein and GETV positive and negative sera were added, and then incubated at 25°C and 37°C for 30min and 1h respectively. Subsequently, the reaction liquid in the well was dried, and each reaction well was filled with diluted washing solution PBST (0.05% Tween-20), let it stand for 5min, and the washing solution was discarded; this was washed 5 times, and the reaction plate was dried for the last time. 50μL of luciferase substrate was added to each well, and the fluorescence value was detected and recorded in the LumiStation-1800 luminescence detector.

[0066] The results show that the P / N value under each condition is calculated, such as Figure 2As shown, the best reaction condition was 37°C for 1h, with P1 / N of 290.75, P2 / N of 405.48, and P3 / N of 328.99, which were better than other conditions.

[0067] 2.3 Determination of the optimal antigen concentration and the best serum dilution multiple

[0068] According to the steps in 2.1, protein A ELISA plate was coated and blocked with 10% skim milk at 37°C for 1h. The optimal antigen concentration and the best serum dilution multiple were determined by the limiting serum dilution method. First, the GETV positive serum was diluted twofold serially (the initial dilution multiple was 1:50) to 102400 times; then, the GETV pig positive serum of each dilution multiple was mixed with 105, 106, and 107 fluorescent units of GLuc-E2 fusion protein and added to the ELISA plate, and incubated at 37°C for 1h. Then, the reaction liquid in the well was dried, and the diluted washing solution PBST (0.05% Tween-20) was filled in each reaction well, and the washing solution was discarded; this was washed 5 times, and the reaction plate was dried for the last time. 50μL of luciferase substrate was added to each well, and the fluorescence value was detected and recorded in the LumiStation-1800 luminescence detector.

[0069] The results show that the P / N value under each condition is calculated, such as Figure 3 As shown, under various reaction conditions: the amount of antigen added was 10 7 The best results were obtained when the serum was diluted 1:100. The mean values ​​of P1 / N, P2 / N and P3 / N were 329.22, 459.03 and 257.82, which were better than the other conditions.

[0070] Example 3 Determination of positive and negative critical values ​​of luciferase immunoprecipitation detection method for swine flu virus

[0071] According to the optimal reaction conditions determined in Example 2, under the optimal conditions, 325 serum samples negative for Gehrig's disease and 106 serum samples positive for Gehrig's disease were tested, and the critical value was 41.57 through ROC curve analysis of the test results, and the specificity and sensitivity were 100%. Figure 4 shown.

[0072] Example 4 Repeatability Experiment of Luciferase Immunoprecipitation Detection Method for Swine Virus

[0073] According to the optimal working conditions of the luciferase immunoprecipitation detection method determined above, the intra-batch and inter-batch repeatability were determined. The results are shown in Tables 1 and 2. The inter-batch and intra-batch coefficients of variation of the luciferase immunoprecipitation detection method for detecting GETV established in this example are less than 10%, indicating that this method has good repeatability during detection.

[0074] Table 1. Results of inter-batch repeatability test

[0075]

[0076] Table 2. Results of inter-batch repeatability test

[0077]

[0078] Example 5: Luciferase immunoprecipitation detection method for swine flu virus

[0079] First, the indirect immunofluorescence experiment, the "gold standard" experiment for antibody detection, was used to identify 36 GETV-positive serum samples and 10 GETV-negative serum samples stored in our laboratory. The luciferase immunoprecipitation detection method for swine genomic virus was used to detect these samples, and the coincidence rate between negative and positive samples reached 100%, indicating that the established luciferase immunoprecipitation detection method for swine genomic virus can be used for clinical GETV antibody detection and has certain practical value.

[0080] Example 6 Specificity experiment of luciferase immunoprecipitation detection method for swine flu virus

[0081] The luciferase immunoprecipitation detection method for swine fever virus established by the present invention was used to detect positive serum samples of African swine fever virus (ASFV), porcine reproductive and respiratory syndrome virus (PRRSV), pseudorabies virus (PRV), porcine circovirus (PCV2), and porcine Japanese encephalitis virus (JEV). The results are as follows Figure 5 This shows that the test kit of the embodiment of the present invention has no false positive test results and has good specificity.

[0082] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A fusion antigen of swine flu virus, characterized in that: The fusion antigen is a GLuc-E2 fusion protein, and the amino acid sequence of the GLuc-E2 fusion protein is shown in SEQ ID No.

2.

2. A method for preparing a fusion antigen of swine flu virus according to claim 1, characterized in that: The steps include: S1. With reference to the complete gene sequence of the E2 protein of the GETV strain, codon optimization was performed and a nucleotide sequence was synthesized. The E2 gene after sequence optimization was connected to the eukaryotic vector pCAGGS(+) plasmid to obtain the recombinant plasmid pCAGGS-E2; S2, using plasmid pCAGGS-E2 as a template, using primers F: AAGGGGAGTGGCGATATCTCTGTGACAGAGCACTTTA and R: AAAAAGATCTGCTAGCTCGAGTCAAGGGTACAGGCCGTAGT to amplify the E2 fragment, then double-digest the amplified E2 antigen gene fragment and the pCAGGS-GLuc vector plasmid carrying the GLuc gene with EcoRV and XhoI, and connect the digestion products with T4 ligase to obtain the recombinant plasmid pCAGGS-Gluc-E2; S3. HEK-293T cells were cultured. When the cell density reached 60-70%, the recombinant plasmid pCAGGS-Gluc-E2 was transfected with lipofectamine 2000 liposome nucleic acid transfection reagent. The transfected 293T cells were then cultured. After the culture, the cell supernatant was collected and centrifuged. The collected supernatant was the GLuc-E2 fusion protein.

3. A luciferase immunoprecipitation kit for detecting swine flu virus, characterized in that: The method comprises the following components: a sample diluent, a blocking solution, the GLuc-E2 fusion protein according to claim 1, an ELISA plate coated with protein A, a washing solution, a luciferase substrate, a positive control, and a negative control.

4. A luciferase immunoprecipitation kit for detecting swine flu virus according to claim 3, characterized in that: The sample diluent is a phosphate buffer solution with a pH of 7.4; the washing solution is a PBS solution (PBST) containing 0.05% Tween-20; and the luciferase substrate is 20 µM coelenterazine h.

5. A luciferase immunoprecipitation kit for detecting swine flu virus according to claim 3, characterized in that: The blocking solution is at least one of 1% BSA, 5% skim milk or 10% skim milk; the positive control is a standard positive serum for swine flu virus, and the negative control is a standard negative serum for swine flu virus.

6. A luciferase immunoprecipitation kit for detecting swine flu virus according to claim 3, characterized in that: The preparation and storage method of the protein A-coated ELISA plate is as follows: protein A protein is prepared into a protein A solution with a concentration of 20 μg / mL using a PBS solution, the protein A solution is added to the ELISA plate at a rate of 100 μL / well, the ELISA plate is coated, incubated at 4°C for 16 hours, the protein A solution is discarded, 300 μL / well is washed 5 times with a PBST solution, and the plate is dried and stored at 4°C.

7. A method for constructing a luciferase immunoprecipitation kit for swine flu virus disease, characterized in that: The following steps are involved: S1. Prepare the GLuc-E2 fusion protein solution of the Gluc virus using the method described in claim 2; S2. Determine a blocking solution, wherein the blocking solution is at least one of 1% BSA, 5% skim milk or 10% skim milk; S3, sealing, determine the sealing temperature is 37 ° C, the sealing time is 1 hour; S4, incubate, determine the incubation temperature is 37 ° C, the incubation time is 1 h; S5. Add fusion antigen and determine the amount of fusion antigen added to be 10 7 Fluorescence units; S6. Dilute the serum samples to be tested and the Gehrig's disease-positive or -negative serum samples and determine that the serum dilution ratio is 1:

100.

8. Use of a fusion antigen of swine flu virus according to claim 1 in the preparation of a product for detecting swine flu virus, wherein the product is a reagent or a kit.

Images