A method, molecular marker, and application for identifying crude protein content in alfalfa

By locating the InDel molecular marker Ms_Chr8_32690092 on chromosome 8 of alfalfa, primer pairs were designed for PCR amplification and electrophoresis detection, solving the problem of long breeding cycles in alfalfa breeding and achieving rapid and accurate screening of high crude protein materials.

CN118653001BActive Publication Date: 2026-04-21LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU UNIV
Filing Date
2024-06-28
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

In existing technologies, the breeding cycle of alfalfa is long and labor-intensive, making it difficult to efficiently screen materials with high crude protein content, which affects the development of animal husbandry.

Method used

The InDel molecular marker Ms_Chr8_32690092 on chromosome 8 of alfalfa was located using genome-wide association analysis (GWAS). Specific primer pairs were designed for PCR amplification and electrophoresis detection to rapidly identify the crude protein content of alfalfa.

Benefits of technology

It enables rapid and accurate identification of crude protein content in alfalfa, simplifies the breeding process, improves screening efficiency, and saves costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118653001B_ABST
    Figure CN118653001B_ABST
Patent Text Reader

Abstract

This invention provides a method, molecular marker, and application for identifying the crude protein content of alfalfa, belonging to the field of biotechnology. The InDel molecular marker is located on chromosome 8 of alfalfa, and the nucleotide sequence of the inserted or deleted segment is shown in SEQ ID NO. 3. The primer pair used to amplify the molecular marker has nucleotide sequences shown in SEQ ID NO. 1-2. The molecular marker and primer pair of this invention can identify or assist in the identification of crude protein content in alfalfa. This invention also provides a method for rapidly identifying the crude protein content of alfalfa using the molecular marker; this method is simple, fast, and provides accurate results, with good prospects for widespread application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for identifying crude protein content in alfalfa, the InDel molecular marker Ms_Chr8_32690092 related to crude protein content in alfalfa, and its application. Technical Background

[0002] In recent years, the planting area of ​​alfalfa (Medicago sativa L.) in my country has continued to expand. With a crude protein content as high as 25%, it dominates the plant-based protein feed industry and is of great significance to livestock production. However, the production of high-crude-protein alfalfa hay is insufficient, and since 2010, my country has needed to import large quantities every year. Therefore, strengthening breeding research on high-quality alfalfa is urgently needed to ensure the sustainable development of my country's livestock industry.

[0003] While conventional breeding methods are widely used in breeding practice, they suffer from drawbacks such as long cycles and heavy workloads, severely hindering the progress of forage grass breeding. With the continuous development and optimization of modern breeding technologies, advanced breeding techniques such as molecular marker-assisted selection (MAS) can be used to accelerate the breeding process and shorten the breeding cycle.

[0004] InDel (Insertion / Deletion) molecular marker methods, also known as insertion / deletion polymorphism markers, are genetic markers based on insertions or deletions (i.e., additions or deletions) at known locations in a genome sequence. This type of molecular marker is widely present in the genome and can be used to study genetic diversity, genetic mapping, population genetics, association analysis, and molecular evolution.

[0005] Therefore, this study, by combining genome-wide association study (GWAS) to develop molecular markers related to crude protein content, is one of the effective means to accelerate the breeding process of new alfalfa materials and will help promote the breeding of new high-protein alfalfa varieties. Summary of the Invention

[0006] One of the objectives of this invention is to provide a method for identifying the crude protein content of alfalfa.

[0007] The second objective of this invention is to provide an InDel molecular marker related to the crude protein content of alfalfa.

[0008] The third objective of this invention is to provide the application of the InDel molecular markers related to the crude protein content of alfalfa.

[0009] To achieve the above objectives, the present invention adopts the following technical solution:

[0010] The molecular marker disclosed in this invention, which is related to the crude protein content of alfalfa, is located on chromosome 8 of alfalfa and is named Ms_Chr8_32690092.

[0011] Primer pairs were used to amplify molecular markers associated with crude protein content in alfalfa. The primer pair sequence corresponding to the molecular marker Ms_Chr8_32690092 is as follows:

[0012] Ms—Chr8_32690092-F: CTCATAATTACTAATTAACTCCCATTAACC (shown in SEQ ID NO.1);

[0013] Ms—Chr8_32690092-R: AATGAATATGGCTTTATTATTTGTGGAAAT (shown in SEQ ID NO. 2).

[0014] This invention also discloses the application of the aforementioned molecular marker primer pairs in marker-assisted breeding of alfalfa crude protein content. In other words, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage, the presence of the molecular markers of this invention can be detected, thereby identifying the crude protein content of alfalfa materials. The detection can be performed using PCR, specifically using the aforementioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0015] This invention also discloses the application of the above-mentioned molecular markers in identifying the crude protein content of alfalfa, especially in screening and identifying the level of crude protein content in alfalfa. Specifically, the specific steps for identifying whether alfalfa has a high crude protein content are as follows:

[0016] (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Ms_Chr8_32690092. The PCR amplification reaction system is shown in Table 1:

[0017] Table 1. Reaction system for PCR amplification

[0018]

[0019] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 50℃ for 30 s, extension at 72℃ for 6 s, 40 cycles; extension at 72℃ for 10 min; store at 4℃.

[0020] (2) Detection of PCR product by agarose gel electrophoresis: Take 3.5 μL and judge the crude protein content of alfalfa based on the band results.

[0021] PCR amplification was performed using primers Ms_Chr8_32690092-F and Ms_Chr8_32690092-R. If the PCR amplification product contained only one characteristic band of 100 bp as shown in SEQ ID NO.4, then alfalfa was of high crude protein content. If the PCR amplification product contained both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then alfalfa was of low crude protein content.

[0022] In addition, this invention also protects a kit for identifying the crude protein content of alfalfa, the kit containing primer pairs Ms_Chr8_32690092-F and Ms_Chr8_32690092-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0023] The kit of this invention can rapidly identify the crude protein content of alfalfa materials, and can also rapidly identify the genotypes related to crude protein content in alfalfa materials. The specific method follows the steps for identifying whether alfalfa has a high crude protein content. By performing electrophoresis and / or sequencing on the PCR amplification products, if the PCR amplification product has only one characteristic band of 100 bp as shown in SEQ ID NO.4, then the alfalfa is a homozygous high crude protein content genotype; if the PCR amplification product has both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then the alfalfa is a heterozygous low crude protein content genotype.

[0024] The present invention has the following advantages:

[0025] (1) The inventors of this invention screened out a molecular marker Ms_Chr8_32690092 that is related to the crude protein content of alfalfa. This molecular marker is located on chromosome 8. Using the molecular marker Ms_Chr8_32690092 of this invention, the crude protein content of alfalfa can be quickly and accurately identified.

[0026] (2) Using markers related to crude protein content for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0027] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied in a simple, rapid and high-throughput way to alfalfa breeding practice and material identification. Attached Figure Description

[0028] Figure 1 The results of the genome-wide association analysis related to crude protein content in alfalfa are based on the Manhattan plot obtained by EMMAX software. The red dots indicate the InDel positions associated in this invention.

[0029] Figure 2 This is a box plot showing the crude protein content distribution corresponding to the genotype at the Ms_Chr8_32690092 locus in the alfalfa population of Example 1 of this invention. 0 / 0 indicates that the genotype at the Ms_Chr8_32690092 locus is homozygous with high crude protein content, while 0 / 1 indicates that the genotype at the Ms_Chr8_32690092 locus is heterozygous with low crude protein content. Dots represent extreme values, and ** indicates P < 0.01.

[0030] Figure 3 This is a partial sequence alignment result between high-crude-protein and low-crude-protein materials in the region associated with crude protein content.

[0031] Figure 4 Electrophoresis images of molecular markers amplified from 10 alfalfa germplasm resources, using agarose gels with a concentration of 3.5%. M in the image represents a DNA marker. Detailed Implementation

[0032] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0033] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0035] Example 1: Development of molecular markers related to crude protein content in alfalfa

[0036] This invention determined the crude protein content of alfalfa at the initial flowering stage. After measuring the crude protein content of the alfalfa population, a genome-wide association study (GWAS) was performed to locate an InDel locus in alfalfa. Figure 1 The red locus, named Ms_Chr8_32690092, is located at locus 32690092 on chromosome 8 of the alfalfa reference genome. The first allele is genotype 0 / 0, and the second allele is genotype 0 / 1. A box plot showing the distribution of crude protein content corresponding to the genotypes at the Ms_Chr8_32690092 locus in the population is shown. Figure 2 This indicates that the crude protein content of alfalfa material with genotype 0 / 0 is significantly higher than that of alfalfa with genotype 0 / 1. An insertion / deletion fragment CTCCTATTTTTATTT (shown in SEQ ID NO. 3) is present at locus 32690092 on chromosome 8 of alfalfa. Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the crude protein content of alfalfa. Alfalfa with the fragment shown in SEQ ID NO.3 has a high crude protein content, while alfalfa without the fragment shown in SEQ ID NO.3 has a low crude protein content.

[0037] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0038] Ms_Chr8_32690092-F: CTCATAATTACTAATTAACTCCCATTAACC (shown in SEQ ID NO.1);

[0039] Ms_Chr8_32690092-R: AATGAATATGGCTTTTATTTGTGGAAAT (shown in SEQ ID NO. 2).

[0040] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous alfalfa sample with high crude protein content had only a 100bp characteristic band, while the PCR product of the heterozygous alfalfa sample with low crude protein content had both a 100bp characteristic band and an 85bp characteristic band.

[0041] Example 2: Accuracy verification of the molecular markers described in this invention

[0042] 188 germplasm accessions were identified, and the specific germplasm materials used are shown in Table 2:

[0043] Table 2. Crude protein content of 188 germplasm materials and their corresponding genotypes at the Chr8_32690092 locus.

[0044]

[0045]

[0046]

[0047] 1) Using the genomic DNA of alfalfa to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0048] The PCR amplification reaction system is as follows: template DNA 10–100 ng, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2×Taq PCR Master Mix, and deionized water to a final volume of 20 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 6 s, 40 cycles; 72℃ extension for 10 min; and storage at 4℃. Separation is performed by electrophoresis on a 3.5% agarose gel. After loading, the samples are electrophoresed at 110V DC for 2 h, and the PCR banding patterns of each sample are then read.

[0049] 2) Determine the crude protein content of alfalfa based on the size of the PCR product: If the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, then the alfalfa to be identified is alfalfa with low crude protein content.

[0050] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with high crude protein content.

[0051] Specifically, when the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 100bp (SEQ ID NO.4), then the alfalfa to be identified is alfalfa with high crude protein content.

[0052] The sequence of SEQ ID NO.4 is as follows:

[0053]

[0054] When the PCR product of the alfalfa to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 85bp (SEQ ID NO.5), then the alfalfa to be identified is alfalfa with low crude protein content.

[0055] The sequence of SEQ ID NO.5 is as follows:

[0056]

[0057] If the PCR product of the alfalfa to be identified consists of two bands, namely a band with the inserted fragment shown in SEQ ID NO.3 and a band with the deleted fragment shown in SEQ ID NO.3, and one band is 100 bp in length and the other is 85 bp in length, then the alfalfa to be identified is a heterozygous alfalfa with low crude protein content.

[0058] Furthermore, Table 2 shows the crude protein content of 188 alfalfa accessions and their corresponding genotypes at the Chr8_32690092 locus. Of these, 175 accessions had a genotype of 0 / 0, and 13 had a genotype of 0 / 1. The average crude protein content of the 175 alfalfa accessions at the initial flowering stage was 22.57%, classifying them as high-crude-protein alfalfa. The 13 alfalfa accessions with genotype 0 / 1 had an average crude protein content of 22.00%, classifying them as low-crude-protein alfalfa, which was 0.57% lower than the average of the 175 high-crude-protein accessions. Analysis of variance showed a significant difference in crude protein content between the high-crude-protein and low-crude-protein types (P < 0.01). The PCR results of 10 randomly selected germplasm samples (CF040656, CF040145, CF020828, P610821619, Sutter, Tianshui, CF005594, CF049890, Saite, and Zhonglan 12) corresponded consistently with the genotypes and actual crude protein content measurements. Figure 4 Therefore, the InDe1 molecular marker of the present invention can effectively identify the crude protein content of alfalfa and can be used for the prediction and screening of alfalfa varieties with high crude protein content.

[0059] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The molecular marker Ms_Chr8_32690092 associated with crude protein content in alfalfa, characterized in that, The nucleotide sequence of the molecular marker Ms_Chr8_32690092 is shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 8 of the alfalfa reference genome. The primer pair sequence for amplifying the molecular marker Ms_Chr8_32690092 is as follows: Ms_Chr8_32690092-F:CTCATAATTACTAATTAACTCCCATTAACC; Ms_Chr8_32690092-R:AATGAATATGGCTTTTATTTGTGGAAAT.

2. The application of the primer pair for amplifying the molecular marker Ms_Chr8_32690092 described in claim 1 in identifying or assisting in the identification of the crude protein content of alfalfa.

3. A method for identifying the crude protein content of alfalfa, characterized in that, The method includes the following steps: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker Ms_Chr8_32690092 described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification products. (3) The determination is based on the electrophoresis bands and / or sequencing results from step (2), and the specific criteria are as follows: PCR amplification was performed using primers Ms_Chr8_32690092-F and Ms_Chr8_32690092-R. If the PCR amplification product showed only one characteristic band of 100 bp as shown in SEQ ID NO.4, then alfalfa was of high crude protein content. If the PCR amplification product showed both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then alfalfa was of low crude protein content.

4. The application of a reagent kit in identifying the genotype of crude protein content in alfalfa, characterized in that, The kit contains the primer pair of the molecular marker Ms_Chr8_32690092 as described in claim 1. The method for identifying the genotype of crude protein content in alfalfa using the kit is as follows: (1) Extract genomic DNA from alfalfa to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the kit, and perform electrophoresis detection and / or sequencing on the PCR amplification products. (3) Perform electrophoresis and / or sequencing on the PCR amplification products. If the PCR amplification product has only one characteristic band of 100 bp as shown in SEQ ID NO.4, then alfalfa is a homozygous high crude protein content genotype; if the PCR amplification product has both one characteristic band of 100 bp as shown in SEQ ID NO.4 and one characteristic band of 85 bp as shown in SEQ ID NO.5, then alfalfa is a heterozygous low crude protein content genotype.