A white-backed planthopper transcription factor SfTrps1 and its application

Abstract

The invention provides a white-backed planthopper transcription factor SfTrps1 and an application thereof, wherein the CDS sequence of the white-backed planthopper transcription factor SfTrps1 is shown in SEQ ID NO: 1, the cDNA of the transcription factor can be targeted by designing the transcription factor, and competent cells are transformed after recombination with L4440, and total RNA is extracted from the obtained engineered bacteria and combined with DMSNs to form a nano preparation, and the nano preparation can be used for controlling the resistance of the white-backed planthopper to pymetrozine and clothianidin, so as to ensure the green and safe production of rice.

Description

Technical Field

[0001] The invention relates to the technical field of biological gene engineering, and in particular to a white-backed planthopper transcription factor SfTrps1 and an application thereof. Background Art

[0002] Rice is one of the three major food crops in the world and plays a pivotal role in my country's food production. Whether rice can produce stable and high yields is related to my country's food security. White-backed planthopper [Sogatella furcifera (Horváth)] belongs to the Delphacidae family of the order Hemiptera. It is a typical rice pest with piercing-sucking mouthparts and is distributed in various rice-growing areas in my country, including Northeast China, North China, Central China, and South China. Both adults and nymphs of white-backed planthoppers pierce and suck the phloem sap of rice, causing mechanical damage and nutrient plunder; during the piercing and sucking process, they can also spread various rice viruses such as southern rice black-streaked dwarf virus, which has a great impact on rice planting and yield. At present, chemical control is still the main means of controlling white-backed planthoppers, but problems such as affecting the rice field ecosystem, increasing pesticide resistance, and the resurgence of white-backed planthoppers have emerged; therefore, it is particularly necessary to study green control methods. After entering the 21st century, due to continuous selection pressure, rice planthoppers have reached a high level of resistance to imidacloprid, which is hundreds of times higher. Therefore, my country has suspended the use of imidacloprid. Since the growth cycles of white-backed planthoppers and brown planthoppers overlap, the exposure of white-backed planthoppers to it has generally increased, resulting in increased resistance. We monitored the resistance of 16 populations of white-backed planthoppers in the wild in Sichuan, and found that one-third of the populations had a medium level of resistance; while the other monitored populations had a high level of resistance. Imidacloprid gradually withdrew from the stage of history and was suspended from use. Subsequently, the second-generation nano-preparation thiamethoxam filled the gap. As nano-preparations of the same type, indoor measurements show that there is indeed cross-resistance between imidacloprid and thiamethoxam.

[0003] Insect resistance is one of the manifestations of insects' own adaptation to external stress and adversity. The degree of resistance varies according to the insects' own survival adaptability and living environment conditions. At present, the repellent behavior of herbivorous insects is being studied in depth. Based on the existing results, it is concluded that the tolerance of herbivorous insects to nano-preparations mainly includes: 1) Weakened insect cuticle permeability: factors such as increased insect cuticle thickness and changes in the interstitial structure of epithelial cells can affect the penetration effect of nano-preparations on the intestinal epidermis or the outer epidermis of the body wall, prolong the penetration time, and delay the effect of toxic effects. 2) Improved metabolism of nano-preparations by insects themselves: increased enzyme activity of metabolic detoxification enzymes such as P450 enzymes, UGTs, GST, CarE and ABC, or diversification of enzyme functions, can improve the detoxification metabolism or presentation of nano-preparations. 3) Reduced sensitivity of target sites: reduced sensitivity of acetylcholinesterase and changes in sodium ion channel permeability. At present, research on the insecticide resistance mechanism of white-backed planthopper mainly focuses on the enhancement of metabolic enzyme activities, such as carboxylesterase CarE and cytochrome P450 enzyme activity.

[0004] At present, the transcriptional regulation mechanism of insect detoxification metabolic genes has become one of the research hotspots in insect toxicology, and transcription factors play a very important role in gene transcriptional regulation. Metabolic resistance genes are usually regulated by heterologous substance stress transcription factors. The transcription factors involved in the overexpression regulation of detoxification metabolic genes mainly include the basic helix-loop-helix (bHLH-PAS), nuclear receptor (NR) and basic leucine zipper (b-ZIP) families. In insects, 7 transcription factors have been found to belong to these transcription factor superfamilies, among which Spineless-aristapedia (Ss) and Methoprene tolerant (Met) belong to the basic helix-loop-helix transcription factor superfamily, and Hepatocyte Nuclear Factor 4 (HNF4), Hormone Receptor 96 (DHR96) and μltraspiracle (USP) belong to the nuclear receptor transcription factor superfamily. Drugs such as megestrol acetate and phenobarbital can induce target gene expression through the nuclear receptor-mediated metabolic gene regulation pathway. This is because the proximal promoters of metabolic resistance genes such as CYP2B and CYP3A contain nuclear receptor binding elements, which recruit nuclear receptors in response to xenobiotic stimulation and activate metabolic resistance genes. In Drosophila melanogaster, the nuclear receptor DHR96 has been shown to regulate P450 gene expression and participate in the metabolism of xenobiotics; Tribolium castaneum can also participate in resistance to imidacloprid by regulating resistance metabolic genes such as CYP345A1 through DHR96; Brown planthopper can participate in resistance to imidacloprid by regulating UGT-1-7, UGT-2B10 and CYP6ER1 genes through HNF4, and the nuclear receptor HR83 can participate in resistance to chlorpyrifos by regulating UGT-1-3, UGT-2B10, CYP6CW1, CYP4CE1 and CarE. However, in white-backed planthoppers, the research on the mechanism of insecticide resistance mediated by detoxification metabolic genes is not in-depth enough, and the transcription factors that regulate detoxification metabolic genes are not comprehensive enough. Therefore, it is necessary to explore the transcription factors that regulate detoxification metabolic genes and participate in the formation of resistance in white-backed planthoppers, laying the foundation for the management and integrated prevention and control of agricultural pest resistance. Summary of the invention

[0005] In view of this, the present invention aims at the severe situation of pesticide resistance of white-backed planthopper, a rice pest in my country, which is difficult to adapt to the current situation of green and safe rice production, and explores transcription factors that can regulate detoxification and metabolic genes, and provides white-backed planthopper transcription factor SfTrps1 and its application for resistance management of agricultural pests.

[0006] In order to achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0007] In a first aspect, the present invention provides a white-backed plant hopper transcription factor SfTrps1, wherein the CDS sequence of the white-backed plant hopper transcription factor SfTrps1 is shown as SEQ ID NO:1, and the amino acid sequence encoded by the CDS sequence is shown as SEQ ID NO:2.

[0008] Preferably, the white-backed planthopper transcription factor SfTrps1 is obtained by gene cloning with the white-backed planthopper Tri gene as the target gene; further preferably, the primer pair sequence used for the gene cloning is shown in SEQ ID NO:3 and SEQ ID NO:4.

[0009] In a second aspect, the present invention provides a cDNA that targets the white-backed planthopper transcription factor SfTrps1 and can express dsRNA of the SfTrps1, wherein the cDNA has a nucleotide sequence shown in SEQ ID NO:5.

[0010] In a third aspect, the present invention provides a recombinant vector having the cDNA, wherein the recombinant vector is obtained by connecting the cDNA with an L4440 vector.

[0011] In a fourth aspect, the present invention provides a cell containing the dsRNA and / or the recombinant vector.

[0012] In a fifth aspect, the present invention provides the use of the white-backed planthopper transcription factor SfTrps1 and / or the cDNA and / or the recombinant vector in the preparation of nanoformulations.

[0013] In a sixth aspect, the present invention provides a nano preparation, which is obtained by culturing cells containing the recombinant vector, extracting total RNA, and then compounding the total RNA with DMSNs.

[0014] Preferably, the compounding method comprises:

[0015] Step 1, dispersing DMSNs in a polyethyleneimine solution, stirring at 200-300 rpm for 3-4 hours at room temperature, performing solid-liquid separation, and obtaining DMSNs-PEI; preferably, the polyethyleneimine solution is prepared with ultrapure water, and more preferably, the concentration of the polyethyleneimine solution is 1-2 mg / mL;

[0016] Step 2, mixing the RNA and DMSNs-PEI in ethanol at a mass ratio of 1:1 to 4, preferably 1:2, for 20 to 30 hours, and performing solid-liquid separation to obtain the nanoformulation;

[0017] Further preferably, the preparation method of the DMSNs comprises:

[0018] The method is obtained by reacting triethanolamine, hexadecyltrimethylammonium bromide, sodium salicylate, bis-[γ-(triethoxysilyl)propyl]-tetrasulfide and tetraethyl silicate; preferably, the reaction temperature is 70-90°C, more preferably 80±2°C.

[0019] Preferably, the method for obtaining the cell containing the recombinant vector comprises:

[0020] After the cDNA is amplified by PCT, the cDNA is constructed into the L4440 vector using restriction endonucleases SacI / KpnI to obtain a recombinant plasmid, and the recombinant plasmid is then transformed into HT115DE3 to obtain;

[0021] More preferably, the cells are cultured at 37° C. and 180 r / min for 2 to 4 h, and when the OD value is 0.6 to 0.8, IPTG is added at a final concentration of 0.2 mM, and the cells are cultured at 16° C. for 15 to 30 h.

[0022] In a seventh aspect, the present invention provides the use of the nanoformulation in the preparation of pesticides.

[0023] In an eighth aspect, the present invention provides an insecticide comprising the nanoformulation or a combination of the nanoformulation and at least one of pymetrozine, clothianidin and nitenpyram.

[0024] The beneficial effects of the present invention are:

[0025] The invention provides a white-backed planthopper transcription factor SfTrps1 capable of regulating detoxification metabolism genes, designs a cDNA that can target the transcription factor, transforms competent cells after recombination with L4440, extracts total RNA from the obtained engineered bacteria and combines it with DMSNs to form a nano preparation, and the nano preparation can be used to control the resistance of white-backed planthopper to pymetrozine, clothianidin and nitenpyram, so as to ensure the green and safe production of rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0027] Figure 1 is the vector map of pMD19-SfTrps1 of the present invention;

[0028] Figure 2 is the vector map of L4440-dsSfTrps1 of the present invention;

[0029] Figure 3The present invention is a schematic diagram of the transcription factors involved in the accumulation of pymetrozine resistance of white-backed planthoppers, wherein Sus: white-backed planthopper sensitive strain; Tri: white-backed planthopper pymetrozine-resistant strain; Tri-LC25: white-backed planthopper pymetrozine-resistant strain Tri was treated with pymetrozine LC25 for 48 hours; wherein A represents the comparison of the number of Reads in different treatments aligned to chromosome 3 and SfTrps1 locus interval of white-backed planthoppers; B represents the clustering heat map of differentially expressed genes in different treatments; C represents the heat map of intra-group and inter-group correlations of different treatments based on the expression of genes; and D represents the transcription factors up-regulated in the pymetrozine-resistant strain Tri of white-backed planthoppers.

[0030] Figure 4 The overexpression of the white-backed planthopper SfTrps1 of the present invention is involved in the accumulation process of the white-backed planthopper's resistance to pymetrozine, Sus: white-backed planthopper sensitive strain; Tri: white-backed planthopper pymetrozine-resistant strain; wherein, A represents qPCR verification of the relative expression of transcription factors in the pymetrozine-resistant strain Tri; B qPCR verification of the relative expression of transcription factor SfTrps1 in the pymetrozine-resistant strain Tri at different ages; C qPCR test of the relative expression of genes after dsSfTrps1 interferes with SfTrps1 of the pymetrozine-resistant strain Tri; D changes in sensitivity to pymetrozine after dsSfTrps1 interferes with SfTrps1 of the pymetrozine-resistant strain Tri.

[0031] Figure 5 The present invention is a schematic diagram of the preparation of SfTRPS1 / DMSNs nanoparticles that efficiently and stably target the transcription factor SfTRPS1, wherein A represents the loading conditions (1) and stability (2) after mixing dsTRPS1 and nanocarrier DMSNs in different proportions, and the conditions of re-dissolving the nanoparticles with 1M NaOH (3) and 4)); B represents the growth and development of the test insects after being treated with 500 mg / L SfTRPS1 / DMSNs; C represents the tissue section diagram of the test insects after being treated with 500 mg / L SfTRPS1 / DMSNs.

[0032] Figure 6The present invention is a schematic diagram of the sensitivity of the transcription factor SfTRPS1 of the white-backed planthopper to agents such as pymetrozine and clothianidin by regulating ABCs genes such as Sfur015042 and Sfur013508; wherein A represents the comparison of the mortality of the resistant strain Tri under different pymetrozine concentrations and whether it is treated with 500 mg / L SfTRPS1 / DMSNs; B represents the comparison of the mortality of the resistant strain Tri under different clothianidin concentrations and whether it is treated with 500 mg / L SfTRPS1 / DMSNs; C represents the comparison of the mortality of the resistant strain Tri under different nitenpyram concentrations and whether it is treated with 500 mg / L SfTRPS1 / DMSNs; D represents the detection of the interaction effect between SfTRPS1 / DMSNs treatment and different insecticides; E and F represent the changes in the relative expression levels of different ABC genes after the 3rd and 4th instar test insects of the resistant strain Tri were treated with 500 mg / L SfTRPS1 / DMSNs. DETAILED DESCRIPTION

[0033] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, which are intended to explain the present invention rather than to limit it.

[0034] Example 1 Transcriptome mining of transcription factors involved in the accumulation of pymetrozine resistance in white-backed planthopper

[0035] 1) Screening of the resistant strain Tri: According to the resistance monitoring data, 300 mg / L of pymetrozine was used to continuously screen the JL21 population of white-backed planthoppers for more than 6 generations (the local population collected from Yunlian in 2021 had a pymetrozine resistance multiple of 142.2 times) to obtain the pymetrozine-resistant strain Tri. The rice seedlings used in each repetition were changed to 30 plants, and about 1,000 third-instar nymphs were absorbed. After 7 days, the surviving nymphs were raised on fresh and healthy rice seedlings. After the nymphs emerged and paired, the G1 generation was bred, and the sublethal dose of the G1 generation was determined by toxicity. The sublethal dose of the G1 generation was used to screen the third-instar nymphs of the G1 generation, and the surviving nymphs were selected, emerged and paired, and the same method was used for generation screening for 6 generations, and finally a highly resistant strain Tri with significant differences from the sensitive strain was bred.

[0036] Construction of sensitive strains: The pymetrozine-resistant strain Tri was used as the recurrent parent and hybridized with the laboratory sensitive strain HN-Lab (donor parent, introduced from Li Youzhi's research group at Hunan Agricultural University in 2015, and had not been exposed to any pesticides for 15 consecutive years) as the G0 generation. 16 female insects were randomly selected from the G0 generation and paired one-to-one with the male insects in the recurrent parent; the offspring G1 were selected with 10 μg / ml pymetrozine, and the most sensitive combination was selected for hybridization and expansion with the recurrent parent, and the virulence data of its offspring G2 was measured; and so on, backcrossing was carried out 6 times to obtain the near-isogenic line G6 with a genetic background basically consistent with that of the Yunlian population.

[0037] 2) Sus treatment was for the 3rd instar nymphs of the sensitive strain, Tri treatment was for the 3rd instar nymphs of the pymetrozine-resistant strain, and Tri-LC25 was for the pymetrozine-resistant strain Tri of the white-backed planthopper treated with pymetrozine LC25 for 48 hours. Two biological replicates were set for each treatment, with 0.2 g of test insects for each replicate. Total RNA was extracted using the TRIzol Reagent kit, and the integrity of RNA was detected using a nucleic acid concentration detector (1.9 < 260 / 280 < 2.0), and the nucleic acid purity of the RNA sample was detected). Eukaryotic mRNA with a polyA tail was enriched with Oligo (dT) magnetic beads and ultrasonically interrupted. Using small fragments of mRNA as templates and random oligonucleotides as specific primers, the first chain of cDNA was synthesized, and the nucleic acid chain was treated with RNaseH, and then the second chain of cDNA was synthesized. Finally, the purified double-stranded cDNA was repaired at the end, A-tailed, and connected to the sequencing adapter to obtain a library. The library was then sequenced using Illumina HiSeqTM 4000.

[0038] 3) After sequencing, remove reads containing adapters in the original file, reads containing N greater than 10%, reads containing all A bases, and low-quality reads (the number of bases with a quality value of Q≤20 accounts for more than 50% of the entire read). Use HISAT2 to align the sample's valid data to the reference genome and count the Mapping information. Use RSeQC to perform redundant sequence analysis, insert fragment distribution, and other analyses based on the alignment results. Use Qualimap to perform uniformity distribution checks, genome structure distribution, and other analyses based on the alignment results. Use BEDTools to perform statistical analysis of gene coverage and analysis of sequencing sequence distribution on chromosomes. After reconstructing transcripts using Stringtie, find the genes that were discovered in this sequencing result but were not included in the reference genome (or reference gene set) and define them as novel genes.

[0039] 4) The expression level of each gene in the entire gene set in any two samples is used to calculate the Pierce correlation coefficient between each two samples, and then these correlation coefficients are intuitively displayed in the form of a heat map ( Figure 3 According to the gene expression level RPKM of each sample, edgeR was used to obtain genes with significant differences between samples or groups ( Figure 3 Figure C). The screening conditions were FDR<0.05 (P-value after FDR correction) and |log2FC|>1. After obtaining the differentially expressed genes, we performed GO functional analysis and KEGG Pathway analysis on the differentially expressed genes ( Figure 3 (D in the middle).

[0040] The results are as follows Figure 3 As shown, conclusion: Transcriptome sequencing was used to screen 13 transcription factors that were highly expressed in pymetrozine-resistant lines (as shown in Table 1).

[0041] Example 2 qPCR verification of 13 transcription factors involved in the accumulation of pymetrozine resistance in white-backed planthopper

[0042] 1) Extract total RNA from white-backed planthoppers according to the instructions of TRIeasyTM Total RNA Extraction Reagent (Yisheng Biotechnology (Shanghai) Co., Ltd.). Take about 50 mg of 4th instar nymphs of white-backed planthoppers at -70℃ and put them into a homogenizer, add 1 mL of Total RNA Extraction Reagent, and homogenize. After vigorous shaking, place the homogenized sample at room temperature for 5 minutes to completely dissociate the ribosomes. Centrifuge at 4°C, 12000×g for 10 min, take the supernatant; add 0.2mL chloroform to the supernatant, cover the centrifuge tube tightly, vortex vigorously for 15sec, let stand at room temperature for 3min, then centrifuge at 4°C, 12000×g for 15min; carefully pipette 500μL of the upper aqueous phase into a new enzyme-free centrifuge tube, add 0.5mL of cold isopropanol, mix by inversion, and place at -20°C for 30min; then centrifuge at 4°C, 12000×g for 15min; discard the supernatant, add 0.5mL of 75% ethanol (prepared with DEPC water) to the precipitate, mix, and centrifuge at 7500r / min at 4°C for 5min; discard the supernatant, dry the precipitate for 5-10min; dissolve in 50μL and reconstitute in sterile enzyme-free water for 10min; determine the sample concentration and quality by ultramicro spectrophotometry.

[0043] 2) According to According to the instructions of the Ⅱ1st Strand cDNA Synthesis SuperMix for qPCR (gDNAdigester plus) reverse transcription kit (Yisheng Biotechnology (Shanghai) Co., Ltd.), total RNA was reverse transcribed into cDNA. In an RNase free centrifuge tube, 10 μL of system mixture was prepared, including 2 μL 5×gDNAdigester Buffer, 1 μL gDNA digester, 500 ng total RNA and an appropriate amount of RNase free ddH2O. Mix by gently pipetting with a pipette and incubate at 42°C for 2 min to remove residual genomic DNA. Add 10 μL 2×HifairTMⅡSuperMix plus directly to the reaction tube in the previous step, mix by gently pipetting with a pipette, and perform cDNA synthesis according to the reverse transcription program (25°C 5min, 42°C 30min, 85°C 5min).

[0044] 3) According to Yisheng Biotechnology (Shanghai) Co., Ltd. qPCR SYBR Green Master Mix (High Rox Plus) kit instructions. Forward Primer and Reverse Primer (10 μM) 0.4 μL each, cDNA 0.5 μL, qPCR SYBR Green Master Mix 10μL and an appropriate amount of sterile ultrapure water were prepared into a 20μL reaction system; qPCR was performed using a two-step amplification program (95℃ 5min, 95℃ 10s, then 60℃ 30s (read silver light), a total of 40 cycles; finally 60℃ 15s, gradually heated to 95℃ 15s at 0.2℃ / s, used to record the melting curve). The RPL9 gene was used as an internal reference gene, and 3 biological replicates were set for each sample; 3 experimental replicates. The primer sequences of the 13 transcription factors are shown in Table 1.

[0045] Table 1 Primer sequences of Example 2

[0046]

[0047] Conclusion: If Figure 4 As shown in Figures A and B, the relative expression of Sfur009128 (SfTrps1) in the pymetrozine-resistant strain was significantly higher than that of other transcription factors, and the relative expression of the resistant strain in the 1st to 5th instar nymphs, female adults and male adults was significantly higher than that of the sensitive strain. The transcription factor SfTrps1 that may be involved in the formation of pymetrozine resistance was mined from 13 candidate transcription factors by qPCR technology. Its CDS nucleotide sequence is shown in SEQ ID NO:1, and the amino acid sequence encoded by the CDS sequence is shown in SEQ ID NO:2.

[0048] Example 3 SfTrps1 gene cloning and function verification

[0049] 1) Based on the transcriptome data of white-backed planthopper, the complete CDS sequence of the transcription factor SfTrps1 was retrieved, and specific primers were designed for cloning (F: 5'-ATGGTGCTAATATGCGGCGT-3', SEQ ID NO: 3; R: 5'-TCGTGTTGTCCGACATGTTCA-3', SEQ ID NO: 4).

[0050] 2) Gene cloning The highly pymetrozine-resistant strain Tri of white-backed planthopper was used and cultured to the third instar under the feeding conditions of 26±1°C, relative humidity of 85%±5%, and photoperiod of 14L:10D. The test insect samples were collected and quick-frozen in liquid nitrogen. Total RNA was extracted after homogenization using the TRIeasyTM Total RNA Extraction Reagent kit (Yishen Biotechnology (Shanghai) Co., Ltd.) and reverse transcribed into cDNA. Using this as a template, specific primers (F: 5'-ATGGTGCTAATATGCGGCGT-3', SEQ ID NO:3; R: 5'-TCGTGTTGTCCGACATGTTCA-3', SEQ ID NO:4) were used for cloning to obtain a SfTrps1 gene fragment with a size of 1536 bp. Its CDS sequence is shown in SEQ ID NO.1, i.e., SfTrps1 transcription factor. This transcription factor is derived from white-backed planthopper Tri. Its encoding amino acid sequence is shown in SEQ ID As shown in NO.2, it consists of 511 amino acid residues (* represents the stop codon) and is a transcription factor of the zf-H2C2 subfamily of zinc finger family transcription factors. Its DNA binding domain (zf-H2C2) is located in the region between 100 and 175 amino acids at the N-terminus.

[0051] 3) Recombining the SfTrps1 gene fragment into the vector pMD19-T. The vector map is as follows Figure 1 As shown in Figure 1, the recombinant plasmid pMD19-SfTrps1 was obtained through blue-white screening, positive clone restriction detection and gene sequencing. Figure 1 shown.

[0052] 4) Based on the full-length sequence of the cloned gene, primers with T7 promoter were designed (dsSfTRPS1F: TAATACGACTCACTATAAGCAAACACAAGAGATGACCGGA, SEQ ID NO: 32; dsSfTRPS1R: TAATACGACTCACTATAAGGAAAATGTGCTCGCATGGCA, SEQ ID NO: 33). After amplifying the target product, gel recovery and purification were performed; 20 μL in vitro transcription reaction system (NTP mix 8 μL, 10×Transcription Buffer 2 μL, T7 Enzyme mix 2 μL, template 500 ng and appropriate amount of RNase-free H2O) were prepared. After freezing and thawing the reagents on ice, gently beat to mix. Incubate at 37°C for 2 hours or overnight. Then incubate at 72°C for 10 minutes to allow it to anneal naturally at room temperature. Before preparation, 100U / μL RNase T1 was diluted to 10U / μL with RNase T1 Dilution Buffer, and the digestion system (dsRNA 20μL, RNase-free H2O 17μL, DNase I 1μL, RNase 2μL) was prepared. Digestion was performed at 37°C for 30min to remove DNA and ssRNA. After digestion, dsSfTRPS1 was purified by magnetic bead method recommended by the kit.

[0053] Prepare 1% agar gel and pour it into a neutral culture medium. Before the agarose solidifies, place the capillary tube to a certain depth so that it solidifies to form a straight groove for fixing the nymphs for injection. Pick the fourth-instar nymphs with uniform growth for microinjection. The treatment group is injected with 40nL dsSfTRPS1 at an injection concentration of 150ng / μL, and the control group is injected with dsGFP (KU306402, pJV53-GFP); after anesthesia with CO2, use a small brush to pick the nymphs and place them in the groove of the agar plate prepared in advance. After injection, put the nymphs into the prepared fresh rice seedlings. After 24h and 48h, take 6 surviving individuals to extract total RNA, measure the expression of the corresponding interference gene, and determine the interference time. 48 hours after microinjection, surviving healthy nymphs were picked for pymetrozine toxicity sensitivity test using the rice seedling immersion method. Fifteen nymphs were treated in each concentration, and three replicates were set for each treatment. After 96 hours, the mortality rate of each treatment concentration was observed to evaluate the interference efficiency.

[0054] Conclusion: After microinjection of dsSfTRPS1 into the pymetrozine-resistant strain Tri, the relative expression level of SfTRPS1 was significantly downregulated at 24h and 48h (reduced to 0.52-fold and 0.48-fold, respectively) ( Figure 4Figure C), the mortality rate increased from 31.1% and 51.1% to 53.3% and 73.3% after 7 days of treatment at 300μg / mL and 500μg / mL pymetrozine concentrations, respectively, and the differences were significant ( Figure 4 (D in the middle).

[0055] Example 4 Preparation of SfTRPS1 / DMSNs Nanomaterials

[0056] 1) Add 0.34 g of triethanolamine to 125 ml of water and stir at 80°C for 0.5 hour. Then, add 1.9 g of hexadecyltrimethylammonium bromide and 0.84 g of sodium salicylate and stir for 1 hour. Next, add 8 ml of bis-[γ-(triethoxysilyl)propyl]-tetrasulfide and 10 ml of tetraethyl silicate and stir for 12 hours. After that, centrifuge and wash the obtained particles with ethanol. To remove the surfactant, add 0.5 ml of HCl (38%) and 30 ml of ethanol (99.7%) solution, heat at 60°C for 6 hours, and repeat three times. Finally, the collected DMSNs were vacuum dried at room temperature. Dendritic mesoporous silica nanoparticles (DMSNs)

[0057] 2) Based on the gene sequence of the transcription factor SfTrps1 of white-backed planthopper, a cDNA sequence (SEQ ID NO: 5) that can target SfTrps1 and express dsRNA of SfTrps1 was designed using siDirect (http: / / sidirect2.rnai.jp / ); after designing primers to amplify the product, the cDNA sequence was constructed into the L4440 vector (such as Figure 2 ). L4440-gene was transformed into HT115 (DE3), and the engineered bacteria were cultured at 37°C in a shaker (180r / min) for about 3h. When the OD value was 0.6-0.8, IPTG was added at a final concentration of 0.2mM and cultured at 16°C overnight. Total RNA of white-backed planthopper was extracted according to the instructions of TRIeasyTMTotal RNA Extraction Reagent (Yisheng Biotechnology (Shanghai) Co., Ltd.).

[0058] 3) Disperse 60 mg of DMSNs in 15 ml of 1 mg / ml polyethyleneimine (PEI) solution (prepared with ultrapure water) and stir at 250 rpm for 4 hours at room temperature. Then, centrifuge the solution (12,000 rpm, 20 minutes) to remove excess PEI, and wash the precipitate with deionized water. Stir and mix RNA and DMSNs-PEI in a ratio of 1:10, 1:3, 1:2, 1:1, 4:3, 2:1, and 5:2 (mass ratio), and find that the brightness of the bound RNA in the 1:2 ratio spot well is the brightest ( Figure 5 1 in Figure A); Finally, 30 mg of RNA and 60 mg of DMSNs-PEI were added to 60 ml of ethanol and stirred at room temperature for 24 hours. Centrifugation was performed again to remove any free RNA to obtain the dsSfTRPS1 / DMSNs nanoformulation. When dsRNA is combined with DMSNs, the brightness of the bound RNA in the spotting well increases, while the free RNA that can migrate decreases. After the dsSfTRPS1 / DMSNs nanoformulation was placed for 5d, 10d, 15d, 20d, 25d and 30d, the brightness of the bound RNA in the spotting well remained basically unchanged ( Figure 5 2) in Figure A, where control is a sample placed for 0 days; after 1M NaOH and 1mg / mL dsSfTRPS1 / DMSNs nanoformulation were mixed at a ratio of 0.1:100, 0.2:100, 0.5:100, 1:100, 1:50, 1:10, 1:5, 3:10, and 2:5, the dsSfTRPS1 / DMSNs nanoprecipitate became a uniform suspension as the concentration of NaOH increased ( Figure 5 4) in Figure A), but the brightness of its binding RNA also gradually decreases ( Figure 5 Middle A Figure 3 ), where control is the sample without adding NaOH.

[0059] Example 5 Changes in the sensitivity of white-backed planthoppers to insecticides such as pymetrozine, clothianidin and nitenpyram in the treatment of SfTRPS1 / DMSNs

[0060] 1) SfTRPS1 / DMSNs was prepared into a 500 mg / L working solution, and the stems of the rice seedlings dried in advance were immersed in the working solution. After 30 seconds, they were taken out and continued to dry (be careful not to immerse the roots), and the roots were wrapped with cotton and placed in a plastic cup. After the test insects were starved for 3 hours, they were sucked into the cup to feed on the rice seedlings. After 24 hours, the test insects were bioassayed, and the control group was soaked in 500 mg / L DMSNs solution. The primers shown in Table 2 were used to perform qPCR tests on the relative expression of the target gene and the downstream ABC gene (Table 2).

[0061] 2) Indoor bioassay, the target pest was white-backed planthopper, and the rice seedling immersion method was used to determine the toxicity of the sensitivity of white-backed planthoppers treated with SfTRPS1 / DMSNs to insecticides such as pymetrozine, clothianidin and nitenpyram. After weighing appropriate amounts of pymetrozine, clothianidin and nitenpyram original drugs and dissolving them in dimethylformamide, 0.1% triaton solution was added to dilute them to different concentrations of the solution (wherein, pymetrozine concentration: 25 μg / mL, 50 μg / mL, 100 μg / mL and 300 μg / mL; clothianidin concentration: 0.25 μg / mL, 0.5 μg / mL, 1.0 μg / mL and 2 μg / mL; nitenpyram concentration: 0.25 μg / mL, 0.5 μg / mL, 1.0 μg / mL and 2 μg / mL); a solution containing 1 mg / mL SfTRPS1 / DMSNs (final concentration) and the corresponding concentrations of the above-mentioned pesticides was prepared, and experiments were carried out on treatment with 1 mg / mL SfTRPS1 / DMSNs alone, pesticides alone, and a mixed solution of pesticides and SfTRPS1 / DMSNs. The rice seedlings were treated by the rice seedling immersion method. Fifteen nymphs were inoculated for each treatment concentration and each treatment was repeated three times. The experimental results were observed 3 days after the drug was applied. The insects were considered dead if they could not coordinate their movements or died.

[0062] 3) Select test insects that died after feeding on the nanomaterials, fix them with 4% paraformaldehyde, and then use gradient ethanol aqueous solution to thoroughly dehydrate them. Then, HE staining of the tissues is performed according to the steps of wax dipping, embedding, slicing, dewaxing to water, hematoxylin staining, eosin staining, dehydration and sealing.

[0063] Conclusion: When treated with 1 mg / mL SfTRPS1 / DMSNs alone, the growth and development of white-backed planthoppers slowed down significantly, and the individual length became shorter ( Figure 5 and abnormalities in multiple internal organs, such as ovaries, testes, and compound eyes, which led to the death of some individuals, with a mortality rate between 40% and 53.3% ( Figure 5 Figure C and Figure 6 Figures A to C in the middle), where Figure 5 Figure C in the middle is HE images of longitudinal sections of different test insects (a total of 4 test insects) that died after being treated with 1 mg / mL SfTRPS1 / DMSNs. Each row represents a dead test insect, the first column is a low-power microscope field of view, and the last three columns are HE images of different tissues under high power microscopes. The mortality rate after SfTRPS1 / DMSNs treatment at 25μg / mL, 50μg / mL and 100μg / mL pymetrozine increased from 15.5%, 40.0% and 53.3% to 82.2%, 100.0% and 100%, respectively, and the differences were all significant. At 300μg / mL, the difference between the treatments was not significant ( Figure 6Figure A); The mortality rates of SfTRPS1 / DMSNs after treatment at 0.25μg / mL, 0.5μg / mL and 1.0μg / mL clothianidin increased from 22.2%, 48.8% and 71.1% to 64.4%, 77.8% and 93.3%, respectively, and the differences were all significant. At 2μg / mL, the differences between the treatments were not significant ( Figure 6 Figure B); The mortality rates of SfTRPS1 / DMSNs after treatment at 0.25μg / mL, 0.5μg / mL and 1.0μg / mL nitenpyram increased from 15.6%, 15.6% and 44.4% to 53.3%, 66.7% and 86.8%, respectively, and the differences were all significant. At 2μg / mL, the differences between the treatments were not significant ( Figure 6 (C) Figure 6 Figure D in the middle is a variance analysis by SPSS multi-factors, in which the interaction effect between SfTRPS1 / DMSNs treatment and pymetrozine and clothianidin reached a significant level, indicating that SfTRPS1 / DMSNs can increase the sensitivity of the test insects to pymetrozine and clothianidin. Using the method in Example 2, qPCR found that after SfTRPS1 / DMSNs, multiple ABC genes such as Sfur015042 were significantly downregulated ( Figure 6 (E and F), where control is not treated with SfTRPS1 / DMSNs, and 3rd and 4th represent the 3rd and 4th instar nymphs of white-backed planthoppers, respectively, indicating that SfTRPS1 transcription factor can participate in the regulation of sensitivity to pesticides such as pymetrozine and nitenpyram by regulating the expression of multiple ABC genes such as Sfur015042.

[0064] Table 2 Primers used in Example 5

[0065]

[0066] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A white-backed planthopper transcription factor SfTrps1, characterized in that The CDS sequence of the white-backed planthopper transcription factor SfTrps1 is shown in SEQ ID NO:1, and the encoded amino acid sequence of the CDS sequence is shown in SEQ ID NO:

2.

2. The white-backed planthopper transcription factor SfTrps1 according to claim 1, characterized in that The white-backed planthopper transcription factor SfTrps1 is obtained by gene cloning with the white-backed planthopper Tri gene as the target gene.

3. A cDNA targeting the white-backed planthopper transcription factor SfTrps1 according to claim 1 or 2 and capable of expressing dsRNA of the SfTrps1, characterized in that: The cDNA has a nucleotide sequence as shown in SEQ ID NO:

5.

4. A recombinant vector having the dsRNA according to claim 3, characterized in that: The recombinant vector is obtained by connecting the cDNA described in claim 3 with the L4440 vector.

5. A cell containing the cDNA according to claim 3 and / or the recombinant vector according to claim 4.

6. Use of the white-backed planthopper transcription factor SfTrps1 according to claim 1 or 2 and / or the cDNA according to claim 3 and / or the recombinant vector according to claim 4 in the preparation of nanoformulations.

7. A nano preparation, characterized in that: The method comprises culturing cells containing the recombinant vector according to claim 4, extracting total RNA, and compounding the total RNA with DMSNs to obtain the DMSNs; the preparation method of the DMSNs comprises: reacting triethanolamine, hexadecyltrimethylammonium bromide, sodium salicylate, bis-[γ-(triethoxysilyl)propyl]-tetrasulfide, and tetraethyl silicate to obtain the DMSNs; and the reaction temperature is 70-90°C.

8. The nanoformulation according to claim 7, characterized in that The composite method comprises: Step 1, dispersing DMSNs in a polyethyleneimine solution, stirring at 200-300 rpm for 3-4 hours at room temperature, performing solid-liquid separation, and obtaining DMSNs-PEI; the polyethyleneimine solution is prepared with ultrapure water with a concentration of 1-2 mg / mL; Step 2, mixing the RNA and DMSNs-PEI in ethanol at a mass ratio of 1:1-4 for 20-30 hours, performing solid-liquid separation, and obtaining the nanoformulation.

9. Use of the nanoformulation according to claim 7 or 8 in the preparation of insecticides.

10. An insecticide, characterized in that: The nanoformulation according to claim 7 or 8 is contained or the nanoformulation according to claim 7 or 8 is used in combination with at least one of pymetrozine and clothianidin.

Images