Application and method of SPILR protein in improving plant resistance to Pseudomonas syringae

Abstract

The present invention discloses an application and method of a SPILR protein for improving plant resistance to Pseudomonas syringae, belonging to the field of agricultural science and technology. Specifically, the method comprises using Pseudomonas syringae to induce expression of the SPILR protein in Arabidopsis leaves, constructing an expression vector pCambia1300-SPILR containing the nucleotide sequence of the SPILR protein, transforming the expression vector into Agrobacterium tumefaciens GV3101 competent cells, culturing the cells, and infecting plant leaves to obtain Pseudomonas syringae-resistant plants. Therefore, genetic engineering techniques can be used to cultivate resistant varieties.

Description

Technical Field

[0001] The present invention relates to an application and method of SPILR protein in improving the resistance of plants to Pseudomonas syringae, and belongs to the field of agricultural science and technology. Background Art

[0002] Organisms need to make physiological adjustments and adapt to changes in their environment. This is particularly important for plants, which grow in fixed locations and lack adaptive immune mechanisms. Bacteria are common invasive plant diseases. The plant defense response to pathogens is a complex biological process involving changes at the biochemical, molecular (i.e., transcriptional) and physiological levels. The known plant immune system is divided into two levels: ① pattern-triggered immunity (PTI) and ② effector-triggered immunity (ETI), which is generally specific to pathogens or disease-causing factors.

[0003] The apoplast, an extracellular space composed of the cell wall matrix (containing nanofibrils), the apoplastic fluid, and extracellular vesicles, is a dynamic ecological niche established in the interplay between host and pathogen. Some responsive proteins, secondary metabolites, and noncoding RNAs require transport to the extracellular space via specific carriers for communication, leading to changes in gene expression and physiological levels of the invader. In recent years, extracellular vesicles (EVs) have been recognized as important mediators of intercellular and cross-kingdom communication. Proteomic analysis of EVs has revealed that they are rich in proteins involved in responses to biotic and abiotic stresses. These proteins account for 26% of the EV proteome, compared to 11% of total plant proteins, indicating that the secretion of defense molecules is an essential and crucial mechanism for the host immune response. Nanofibrils in the apoplast are difficult to distinguish from extracellular vesicles during ultracentrifugation sedimentation, and both are important components of the plant immune response. However, how the proteins in the apoplast nanofibrils exert their antimicrobial functions remains understudied. Pseudomonas syringae infects almost all economically important crop species, making it one of the most common plant pathogens and ranking first among plant bacterial diseases. Summary of the Invention

[0004] In order to address the above-mentioned defects and deficiencies in the prior art, the present invention provides an application and method of SPILR protein in improving plant resistance to Pseudomonas syringae. Pseudomonas syringae is used to induce Arabidopsis leaves to express SPILR protein, which can effectively improve the plant resistance to Pseudomonas syringae.

[0005] To solve the above technical problems:

[0006] The first object of the present invention is to provide a use of a SPILR protein for improving plant resistance to Pseudomonas syringae. Pseudomonas syringae is used to infect Arabidopsis leaves, and a series of proteins are screened from the apoplast extracted from the leaves. Among them, the SPILR protein has resistance to Pseudomonas syringae. The name of the SPILR protein is based on the LRR protein that inhibits the P. syringae FlgI protein (taking the initials Suppressing the P. syringae FlgI protein as a leucine-rich repeat (LRR) protein). The amino acid sequence of the SPILR protein is shown in SEQ ID NO. 1.

[0007] Furthermore, the editing nucleotide sequence of the SPILR protein is shown in SEQ ID NO.2.

[0008] The second object of the present invention is to provide an expression vector containing the above-mentioned SPILR protein.

[0009] The third object of the present invention is to provide a cell expressing the above expression vector.

[0010] At the same time, the present application also provides a use of the above-mentioned expression vector or the above-mentioned cell in improving the plant's antibody to Pseudomonas syringae.

[0011] The fourth object of the present invention is to provide a method for improving plant resistance to Pseudomonas syringae, the specific process of which is as follows:

[0012] Step 1: Inducing SPILR protein expression in Arabidopsis leaves: Injecting Pseudomonas syringae into Arabidopsis leaves, extracting the solid portion of the Arabidopsis leaf apoplast (including extracellular vesicles and nanofibrils), and isolating and extracting the SPILR protein. The amino acid sequence of the SPILR protein is shown in SEQ ID NO. 1. Based on the SPILR protein spectrum detection results, the nucleotide sequence of the edited SPILR protein is analyzed and shown in SEQ ID NO. 2.

[0013] Step 2: construct the expression vector pCambia1300-SPIL containing the SPILR protein nucleotide sequence;

[0014] Step 3: Transform the expression vector obtained in step 2 into Agrobacterium tumefaciens GV3101 competent cells and culture them;

[0015] Step 4: Infect plant leaves with the Agrobacterium tumefaciens GV3101 competent cells transformed in step 3 to obtain plants resistant to Pseudomonas syringae.

[0016] The beneficial technical effects achieved by the present invention include the use and method of a SPILR protein for improving plant resistance to Pseudomonas syringae. Specifically, the method comprises using Pseudomonas syringae to induce expression of the SPILR protein in Arabidopsis leaves, constructing an expression vector (pCambia1300-SPILR) containing the nucleotide sequence of the SPILR protein, transforming the expression vector into competent Agrobacterium tumefaciens GV3101 cells, culturing the cells, and infecting plant flower buds. Plants resistant to Pseudomonas syringae are screened and obtained. Therefore, genetic engineering techniques can be used to cultivate resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 A map of the expression vector pCambia1300-SPILR-GFP of the present invention;

[0018] Figure 2 Electron micrograph of the SPILR-expressing Arabidopsis plant of the present invention;

[0019] Figure 3 Band diagrams of Arabidopsis protein extract analysis of the present invention, wherein 3A is a band diagram of total protein lysate analysis by immunoblotting, and 3B and 3C are bands detected by Western blot in the apoplast;

[0020] Figure 4 Phenotypic analysis of Arabidopsis leaves infected by Pseudomonas syringae of the present invention;

[0021] Figure 5 Statistical analysis of the damage area of ​​Arabidopsis leaves infected by Pseudomonas syringae of the present invention;

[0022] Figure 6 Electron microscopic image of Arabidopsis thaliana infected by Pseudomonas syringae of the present invention;

[0023] Figure 7 Images of the SPILR protein gene of the present invention expressed in tobacco leaves, where TET8-mCherry is a fluorescence image of the localization marker protein in EVs, GFP is a fluorescence image, and Merge is a photo of the combined fluorescence of the marker protein and the target protein;

[0024] Figure 8 A picture showing the tolerance of tobacco plants transiently expressing the SPILR protein of the present invention to Pseudomonas syringae. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific examples. The following examples are only used to more clearly illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention.

[0026] The present invention is further described below with reference to the accompanying drawings and embodiments.

[0027] Example 1 Expression of SPILR protein in Arabidopsis

[0028] 1. Treatment of Arabidopsis leaves with Pseudomonas syringae: Pseudomonas syringae was cultured overnight in LB medium containing rifampicin (25 μg / ml) until the optical density OD600 = 0.004 (5 × 10 5 CFU / ml). P. syringae was then resuspended in injection buffer containing 10 mM MgCl2 and 0.01% Silwet-77. The suspension was injected into the base of Arabidopsis leaves using a 1 mL syringe. Leaf phenotypes were observed 48 hours later.

[0029] 2. Extraction of Arabidopsis apoplasts: Normal Arabidopsis leaves were infiltrated with VIB solution (20 mM MES, 2 mM CaCl2, 0.1 M NaCl, pH 6.0), then fixed to the outside of a syringe and centrifuged at 900g for 20 minutes at 4°C. The supernatant was centrifuged at 10,000g for 30 minutes, filtered through a 40 μm filter, and the filtrate was centrifuged at 100,000g for 60 minutes (Thermofisher Sorvall WX100+). The precipitate contained SPILR protein, which was subsequently confirmed by mass spectrometry. LC-MS / MS analysis was performed by Novogene using a TripleTOF® 5600 instrument.

[0030] The amino acid sequence of the SPILR protein is shown in SEQ ID NO. 1:

[0031] MQMDWSKTSTLTSQLSSNLFPTTNSSLLSINTTQFTTMNSSFTLFIFTFVIFLQCLNPTGAATCHPDDEAGLLAFKAGITRDPSGILSSWKKGTACCSWNGVTCLTTDRVSALSVAGQADVAGSFLSGTLSPSLAKLKHLDGIYFTDLKNITGSFPQFLFQLPNLKYVYIENNRLSGTLPANIGALSQLEAFSLEGNRFTGPIPSSISNLTLLTQLKLGNNLLTGTIPLGVANLKLMSYLNLGGNRLTGTIPDIFKSMPELRSLTLSRNGFSGNLPPSIASLAPILRFLELGHNKLSGTIPNFLSNFKALDTLDLSKNRFSGVIPKSFANLTKIFNLDLSHNLLTDPFPVLNVKGIESLDLSYNQFHLNTIPKWVTSSPIIFSLKLAKCGIKMSLDDWKPAQTFYYDFIDLSENEITGSPARFLNQTEYLVEFKAAGNKLRFDMGKLTFAKTLTTLDISRNLVFGKVPAMVAGLKTLNVSHNHLCGKLPVTKFPASAFVGNDCLCGSPLSPCKA。

[0032] The cDNA base sequence of the SPILR protein is shown in SEQ ID NO. 2:

[0033]

[0034] 3. Construction of expression vector: First, RNA from Arabidopsis leaves was extracted using the TRizol (Invitrogen: 15596026CN) method, and then reverse transcribed into cDNA using SMART MMLV Reverse Transcriptase (Clontech: 639522). The cDNA bases were PCR amplified to obtain the PCR amplification product of the SPILR protein. The amplification process was performed using the instructions of KOD One™ PCR Master Mix (TOYOBO: KMM-101NV). The base sequence of the upstream primer is shown in SEQ ID NO. 3, and the downstream primer is shown in SEQ ID NO. 4. The PCR amplification product was introduced into the plasmid pCambia1300 between the KpnI and SalI restriction sites using the ClonExpress Ultra One Stepcloning Kit V2 (Vazyme) according to the operating steps of the instructions to obtain the expression vector pCambia1300-SPILR-GFP for the SPILR protein. The map is shown in FIG. Figure 1 As shown. The plasmid pCambia1300 contains the green fluorescent protein (GFP) gene. The expression vector was then sequenced, and the correctly sequenced expression vector was selected and transformed into Agrobacterium tumefaciens GV3101 competent cells.

[0035] SEQ ID NO.3: ggagaggacagggtaccatgaactcttcctttactctctt;

[0036] SEQ ID NO.4: ccatggtactagtgtcgacagctttacaaggagaaagaggag.

[0037] 4. Screening for Positive Plants: Select Agrobacterium tumefaciens GV3101 strains expressing the above expression vector for expansion culture and transform into Arabidopsis plants using the floral dip method. Floral dip method: During the bud stage of Arabidopsis, remove excess siliques. Inoculate Agrobacterium in YEB medium (gentamicin 20 μg / mL, kanamycin 100 μg / mL) and grow to an OD600 of 1.6-2.0. Centrifuge at 6000 rpm for 10 minutes at room temperature to collect the Agrobacterium. Resuspend the Agrobacterium in transformation medium (5% sucrose, 0.05% Silwet L-77) to an OD600 of approximately 0.8-1.0. Immerse the Arabidopsis flower buds in 25 ml of transformation medium for 5 minutes, then remove and incubate in the dark overnight. After 24 hours, rinse with water and incubate under normal light until seed formation occurs.

[0038] Hygromycin was used to screen positive plants. The specific process was as follows: the collected Arabidopsis T0 seeds were spread on the screening medium (1 / 2MS, 1% sucrose, 0.8% Agar, 25mg / L hygromycin). After 10-14 days, the plants that could root were considered positive plants. The positive plants were transferred to culture soil for cultivation. The leaves were picked and the GFP fluorescence was observed under a laser confocal microscope. The scale was 50μm. The results are shown in Figure 2. Figure 2 As shown: SPILR is also localized in the apoplast (between cells) in leaves of Arabidopsis positive plants. Total protein and apoplast protein were extracted from leaves of Arabidopsis positive plants. Total protein from leaves was treated in the presence (+) and absence (-) of the glycosidase PNGaseF. Coomassie staining of the large subunit of Rubisco was used as an internal protein control. Total protein lysates were then analyzed by immunoblotting. The results are shown in Figure 2. Figure 3 As shown in Figure 3A. The figure shows two bands near 100 kDa and 70 kDa, confirming that they are SPILR proteins. Western blot analysis was then used to determine whether the extracted protein was present on the EV surface: vesicles were treated with sodium dodecyl sulfate (with (+SDS) or without (-SDS)) to assess membrane integrity, and then treated with PNGase F to remove N-glycans. The results are shown in Figure 3A. Figure 3 To distinguish whether the protein exists in vesicles or nanofibrils, trypsin was used in the presence of non-ionic detergent (with (+Triton) or without (-Triton)) and cellulase (with (+CM) or without (-CM)). The results are shown in Figure 3B. Figure 3 As shown in Figure 3C, SPILR is present in the apoplast and is an N-glycosylated protein. Sugar chains are present inside vesicles in the apoplast, and the protein is partially encapsulated in vesicles and partially present in nanofibrils.

[0039] Example 2 Detection of resistance to Pseudomonas syringae after expression of SPILR protein in Arabidopsis

[0040] Leaf injury phenotype and statistics: Pseudomonas syringae DC3000 was cultured in LB medium containing rifampicin (25 μg / ml) overnight until the optical density OD600 = 0.004 (5 × 10 5 CFU / ml). Pseudomonas syringae was then resuspended in injection buffer containing 10 mM MgCl2 and 0.01% Silwet-77 by volume. The Pseudomonas syringae suspension was injected into the dorsal surface of 5-week-old Arabidopsis leaves using a 1 mL syringe. Leaf phenotypes were observed 48 hours later. The relative ratio of lesion area to leaf area was statistically compared. Plant tissue reactive oxygen species were detected using a DAB assay kit (Solarbio: G4815). The results are shown in the figure below. Figure 4 and Figure 5 As shown: The yellowing and wound area of ​​leaves expressing SPILR were reduced, and the ROS response was weakened, indicating that the expression of the SPILR gene enhanced the resistance to Pseudomonas syringae.

[0041] Transmission electron microscopy examination of P. syringae morphology: Leaves were harvested 36 hours after inoculation with P. syringae DC3000. The leaves were then minced with sterile scissors in a 10 mM MgCl₂ solution. The homogenate was filtered through a 40 µm pore-size membrane filter to remove plant debris. The filtrate was centrifuged at 2500 g for 5 minutes at 4°C to obtain the bacteria. The bacterial pellet was then resuspended in phosphate-buffered saline (PBS) to a final concentration suitable for further processing. The resuspended bacterial cells were fixed with an equal volume of 2.5% glutaraldehyde in 0.1 M sodium bicarbonate buffer (pH 7.2). The mixture was incubated at 4°C for 2 hours. Following fixation, the samples were fixed in 1% osmium tetroxide at 4°C for 1 hour, dehydrated through a graded ethanol series, and embedded in epoxy resin. Ultrathin sections were cut using an ultramicrotome, mounted on copper grids, and stained with uranyl acetate and lead citrate. The sections were then examined by transmission electron microscopy. Electron microscopy was performed by Servicebio. The results are as follows Figure 6 As shown: Pseudomonas syringae was obtained from Arabidopsis WT and SPILR-expressing leaves treated with bacteria for 36 hours. Transmission electron microscopy analysis showed that SPILR caused bacterial morphology to break and flagella to fall off, so the expression of SPILR can effectively inhibit bacteria.

[0042] Example 3 Detection of resistance to Pseudomonas syringae by transient expression of protein SPILR in tobacco

[0043] Transient expression inhibition experiment in tobacco leaves: 5-6-week-old young, pre-flowering tobacco plants were used. Agrobacterium (GV3101) carrying the pCambia1300-GFP-SPILR plasmid was cultured overnight in YEB medium to an OD600 of 1.5, then centrifuged and suspended in injection solution (50 ml: 250 mg D-glucose, 5 ml 500 mM MES, 5 ml 20 mM Na3PO4 12H2O, 5 μl 1M acetosyringone) to an OD600 of 0.2. The solution was injected into the underside of tobacco leaves using a 1 ml syringe with the needle removed. GFP fluorescence was observed under a laser confocal microscope 48 hours later. The scale bar represents 50 μm. The results are shown in Figure 2. Figure 7As shown in the figure: Fluorescence intensity and expression location indicate that the SPILR protein gene is expressed in the apoplast of tobacco leaves, colocalizing with the EV marker protein TET8-mCherry. Pseudomonas syringae was resuspended in injection buffer containing 10 mM MgCl2 and 0.01% Silwet-77 to an OD600 of 0.004 (5 × 105 CFU / ml) and then applied to the upper surface of the leaves. The non-bacterial treatment group used a suspension instead of an application. Photos were taken 48 hours after treatment. The results are shown in the figure. Figure 8 As shown in the figure, Con represents no treatment, Ps represents treatment with Pseudomonas syringae DC3000, and SPILR represents transient expression of SPILR. As can be seen from the figure, tobacco leaves transiently expressing the SPILR gene and treated with Pseudomonas syringae exhibit a "water-soaked" phenotype, while SPILR expression significantly reduces pathogen-induced damage, eliminating the "soaked" phenotype and resulting in only slight yellowing.

[0044] The present invention has been disclosed above with preferred embodiments, which are not intended to limit the present invention. Any technical solutions obtained by adopting equivalent replacement or equivalent transformation solutions fall within the protection scope of the present invention.

Claims

1. Application of the SPILR protein having an amino acid sequence as shown in SEQ ID NO. 1 in improving the resistance of Arabidopsis thaliana and tobacco to Pseudomonas syringae.

2. The use according to claim 1, characterized in that: The edited nucleotide sequence of the SPILR protein is shown in SEQ ID NO.

2.

3. A method for improving plant resistance to Pseudomonas syringae, characterized in that: The SPILR protein was overexpressed in Arabidopsis leaves, and the amino acid sequence of the SPILR protein was shown in SEQ ID NO.

1.

4. The method for improving plant resistance to Pseudomonas syringae according to claim 3, wherein: The specific process is as follows: Step 1: Inducing the expression of SPILR protein in Arabidopsis leaves: Injecting Pseudomonas syringae into Arabidopsis leaves, extracting the Arabidopsis leaf apoplast, isolating and extracting the SPILR protein, and analyzing the SPILR protein expression results to determine the nucleotide sequence of the edited SPILR protein as shown in SEQ ID NO. 2; Step 2: constructing the expression vector pCambia1300-SPILR containing the SPILR protein nucleotide sequence; Step 3: Transform the expression vector obtained in step 2 into Agrobacterium tumefaciens GV3101 competent cells and culture them; Step 4: Infect the plant buds with the Agrobacterium tumefaciens GV3101 competent cells transformed in step 3 to obtain plants resistant to Pseudomonas syringae.

Images