A snp molecular marker related to chicken carcass weight traits and application thereof

Abstract

The application discloses a SNP molecular marker related to chicken carcass weight traits and application thereof, the molecular marker site is located in an intron region of RNASEH2B gene, GRCg6a version genome chr1:171223058, 1174 chicken crossbreeding population individuals are sequenced by using resequencing technology, and whole genome association analysis is carried out, a SNP site significantly related to a carcass phenotype is found, the SNP marker has three genotypes, AA, CC and AC, wherein CC corresponds to higher carcass weight, breast muscle weight and leg muscle weight, SNP frequency analysis of the SNP site in low-weight chicken breeds and high-weight chicken breeds is carried out, and it is found that the SNP frequency distribution has a significant difference in the low-weight chicken breeds and the high-weight chicken breeds, in the high-weight chicken, C is the dominant allele, and in the low-weight chicken, A is the dominant allele, and early selection of chicken carcass traits can accelerate chicken genetic breeding by selecting the C / C genotype of the SNP site.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and in particular to a SNP molecular marker related to chicken carcass weight traits and its application, specifically to SNP molecular markers related to chicken carcass weight, left breast muscle weight and left leg muscle weight and their application. Background Technology

[0002] In recent years, my country's chicken production has continued to grow, and improving muscle yield and chicken quality has been a long-term endeavor for breeding scientists. Classical breeding methods have made significant contributions to the improvement of agricultural animal production traits. With the continuous advancement of genomics work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding based on specific genetic markers, thereby gradually improving the overall yield and quality of the flock.

[0003] SNPs (Single Nucleotide Polymorphisms) are one of the most common forms of genetic variation in genetics. SNPs are characterized by their large quantity, high frequency, and low mutation rate, playing a crucial role in genetic research and molecular selection breeding. However, current molecular breeding practices for broilers still lack molecular markers with clearly defined functions and significant effects. Therefore, identifying high-efficiency, accurate molecular markers is a current research focus. If we can find SNP molecular markers associated with target traits in chickens and ultimately elucidate the molecular mechanisms underlying these sites, it will greatly promote genetic improvement in chickens and bring breakthrough progress to the field of poultry breeding. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a SNP molecular marker associated with chicken carcass weight and its application. Using resequencing technology, 1174 individuals from a hybrid chicken population were sequenced, and GWAS analysis was performed. This revealed an SNP locus significantly associated with chicken carcass weight, left breast muscle weight, and left leg muscle weight. This SNP is rs313374140 (chr1:171223058) located in genome version GRCg6a 104. The SNP molecular marker exhibits polymorphisms of A and C, including three genotypes: AA, CC, and AC. Statistical analysis of the SNP frequency in other low-weight and high-weight chicken breeds revealed significant differences between the two breeds. In high-weight chickens, C was the dominant allele, while in low-weight chickens, A was the dominant allele. In populations with low body weight gain, selecting individuals with allele C can improve body weight gain.

[0005] To solve the above-mentioned technical problems, the technical solution provided by the present invention is as follows:

[0006] A SNP molecular marker associated with chicken slaughter weight traits.

[0007] The SNP molecular marker is located at chr1:171223058 of GRCg6a 104 in the genome, and the alleles of the SNP locus are C and A; it includes three genotypes: AA, CC and AC.

[0008] The economic traits are slaughter weight, left breast muscle weight, and left leg muscle weight. C is the dominant allele in high-weight chickens, while A is the dominant allele in low-weight chickens.

[0009] Preferred,

[0010] The SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO.1.

[0011] SEQ ID NO.1(chr1:171222958-171223158)

[0012] gactgctgaaatgaaataaatgtaatggtttttgttgttgttttaacaattgacacttgtctatcactttttagagttacgtatttctgagctgtgaaaa aggtataagtggcaagtttaccttgcaggaagaagaaggacatgttctaatgctatgcaagaagctccaaaagttttctcacaataaagcctctttccaag

[0013] The above-mentioned SNP molecular markers were used in the detection of chicken carcass weight, left breast muscle weight, and left leg muscle weight traits.

[0014] The above application includes the following steps:

[0015] (1) Detect the genotype of the sample chickens at the SNP locus;

[0016] (2) Select C / C genotype sample chickens for breeding superior strains.

[0017] Preferred,

[0018] Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.

[0019] The specific amplification steps were as follows: Blood tissue samples from the hybrid population were collected, and DNA was extracted using the total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA was then analyzed using a NanoDrop 2000 spectrophotometer to determine its concentration and purity (OD260 / OD280 and OD260 / OD230 ratios). Agarose gel electrophoresis was used to check the DNA integrity. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2 × Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to detect the fragment size of the product.

[0020] Primer pairs containing the SNP site fragment of claim 1 are used to amplify the primer pairs, the sequences of which are shown in SEQ ID NO. 2 and SEQ ID NO. 3.

[0021] Primer pair sequence is

[0022] F: GACTGCTGAAATGAAAATAA (SEQ ID NO.2)

[0023] R: CTTGGAAAGAGGCTTTATT (SEQ ID NO.3) The above SNP molecular markers are used in marker-assisted selection breeding to select chicken breeds with genotype C / C for breeding.

[0024] The beneficial effects of this invention are:

[0025] This invention provides a SNP molecular marker related to chicken slaughter weight traits and its application. Genotyping of the SNP locus chr1: 170522957 in 1174 chickens was performed. SNP frequency analysis of this locus was conducted in low-weight and high-weight chicken breeds, revealing that C is the dominant allele in high-weight chickens and A is the dominant allele in low-weight chickens. In the low-weight population, selecting individuals with allele C can increase the overall weight of the population. This locus, as an SNP molecular marker, can be applied to the breeding of superior chicken breeds, enabling early, rapid, low-cost, and effective prediction of weight, showing broad application prospects in chicken breed improvement and achieving excellent economic value. Attached Figure Description

[0026] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are used in conjunction with embodiments of the invention to explain the invention and do not constitute a limitation thereof. In the drawings:

[0027] Figure 1A Figure 1A shows the Manhattan plot of the GWAS results for carcass weight, and Figure 1B shows the Manhattan plot of the results for the left pectoral muscle weight. Figure 1C Manhattan plot of GWAS results for left leg muscle weight Detailed Implementation

[0028] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.

[0029] This invention provides a SNP molecular marker associated with chicken slaughter weight traits and its application, wherein the SNP molecular marker is located at... RNASEH2B The intron region of the gene, chr1:171223058 of the genome GRCg6a 104, has an SNP molecular marker located at base 101 of the nucleotide sequence shown in SEQ ID NO.1; the alleles of the SNP site are C and A; the economic traits are slaughter weight, left breast muscle weight, and left leg muscle weight. C is the dominant allele in high-weight chickens, while A is the dominant allele in low-weight chickens. In the low-weight population, the weight of chickens can be increased by selecting individuals with allele C.

[0030] Example 1: Genome-wide association analysis of chicken carcass traits

[0031] 1. Test materials

[0032] 1174 hybrid chickens were slaughtered at thirteen weeks of age, and their carcass weight, left breast muscle weight, and left leg muscle weight were measured. The measurements were strictly conducted in accordance with the chicken farm's internal regulations.

[0033] 2. Test Methods

[0034] 2.1 Phenotypic determination

[0035] For chickens aged thirteen weeks in the flock, slaughter them, remove the feathers and internal organs of each chicken, place them on a weighing device, and measure the carcass weight; in addition, remove the left breast muscle and left leg muscle of each chicken and weigh them separately.

[0036] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0037] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. The genotype probability of all individuals was estimated using STITCH. For SNP loci obtained through genotyping, they were filtered based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0038] 2.3 Genome-wide association analysis

[0039] Genome-wide association analysis was performed on the slaughter weight, left breast muscle weight, and left leg muscle weight of 1174 chickens using fastGWA.

[0040] 2.4 SNP sites significantly associated with carcass traits

[0041] Detection of significant loci at the genomic level: significant loci are identified based on FDR < 0.05.

[0042] 3. Results and Analysis

[0043] This invention uses 1174 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained and GWAS analysis was performed on the body weight of chickens at different ages. A SNP (Chr1:171223058) that was significantly associated with the slaughter weight of chickens was identified, as shown in Figure 1.

[0044] Example 2: Frequency distribution of SNP (chr1: 171223058) in different chicken breeds

[0045] 1. Experimental Materials

[0046] Low-weight chicken breeds: Bearded chicken (n=15), Camellia chicken (n=30), Daweishan miniature chicken (n=33), Silkie chicken (n=57) and Tibetan chicken (n=154).

[0047] High-weight chicken breeds: Lingnan yellow-feathered broiler (n=16), white-feathered broiler (n=20) and Kebao chicken (n=33).

[0048] 2. Test Methods

[0049] 2.1 Data Collection

[0050] The whole-genome resequencing data from the above 5 low-weight chicken breeds and 3 high-weight chicken breeds were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0051] 2.2 SNP typing using GATK

[0052] The gVCF was constructed based on the GRCg6a 104 reference genome using the gtx wgs command on the GTX server. Then, the gtx gi and gtx joint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0053] 2.3 SNP Filtration and Quality Control

[0054] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0055] 2.4 Calculation of allele frequencies of chr1:171223058 in different chicken breeds

[0056] The allele frequencies of chr1:171223058 in different chicken breeds were calculated using vcftools --freq2.

[0057] 3. Results and Analysis

[0058] The SNP frequency distribution of SNP (chr1: 171223058) in different low-weight and high-weight chicken breeds is shown in Table 1. Significant differences exist between the two breeds. C is the dominant allele in high-weight chickens, while A is the dominant allele in low-weight chickens.

[0059] Table 1. SNP (chr1: 171223058) frequencies in different low-weight and high-weight chicken breeds.

[0060] ;

[0061] Thus, a SNP molecular marker associated with chicken slaughter weight trait was obtained. In a population with low slaughter weight, the weight of the breeding population can be increased by breeding individuals with the C / C allele at this locus.

[0062] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

[0063] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. The application of an SNP molecular marker in the detection of carcass weight, left breast muscle weight, and left leg muscle weight in chickens at thirteen weeks of age, characterized in that... The SNP molecular marker is located at chr1:171223058 of the GRCg6a genome, and the alleles of the SNP locus are C and A; it includes three genotypes: AA, CC and AC.

2. The application according to claim 1, characterized in that, Includes the following steps: (1) Detect the genotype of the sample chickens at the SNP locus; (2) Select C / C genotype sample chickens for breeding superior strains.

3. The application according to claim 2, characterized in that, Step (1) can be performed by direct sequencing or by first amplifying the gene fragment containing the SNP molecular marker and then detecting it.

Images