A molecular marker for rapidly and efficiently identifying tea plants with purple leaf color variation and its application

Abstract

The present invention discloses a molecular marker for rapidly and efficiently identifying tea plants with purple leaf color variation and its application, belonging to the technical field of tea germplasm identification. The sequence of the molecular marker is as shown in SEQ ID No.1, and 2 pairs of primers are designed for this DNA molecular marker, and their sequences are as shown in SEQ ID No.2-5. Beneficial effects: The present invention proposes a method for identifying the leaf color of tea plants, which is a method for identifying whether the purple trait of tea plants is a stable inheritance by using trace DNA extracted from tea plant tissues as a template, molecular marker primer amplification and agarose electrophoresis technology. According to 2 pairs of molecular marker primers, the PCR amplification technology is used to amplify the target band, and whether the tea plant is a heritable purple variety is distinguished according to the position of the target band. The present invention has high reference value for the identification of purple leaf color variation tea plants in natural populations and hybrid populations, and is suitable for popularization and application.

Description

Technical Field

[0001] The present invention relates to the technical field of tea germplasm identification, and particularly relates to a molecular marker method for rapidly and efficiently identifying tea trees with purple leaf color variation. Background Art

[0002] The tea tree (Camellia sinensis) is an important economic crop, rich in a large number of secondary metabolites with economic and health care values, such as catechins, caffeine, and theanine, etc., and is widely planted in China. Purple bud and leaf tea trees are a special type of tea germplasm resource. Compared with green bud and leaf tea trees, purple bud and leaves are rich in a large amount of anthocyanins. Previous research results have shown that anthocyanins have strong antioxidant properties, and at the same time have various physiological functions such as anti-aging, anti-inflammatory, antibacterial, and protecting eyesight. They can reduce the oxidative stress and inflammation levels in the body, and can also improve the resistance of plants to ultraviolet rays and drought stress, and resist pathogens and herbivores, etc. The dry tea made from purple bud and leaf tea has a purple color, a relatively bitter taste, but is mellow and refreshing, with a high and long-lasting tea aroma, a special aroma, and high contents of anthocyanins and polyphenolic substances. Purple tea products can not only be used to develop tea products with special flavors, but also can be used as ornamental horticultural plants, and have high commercial value. Therefore, purple bud and leaf tea trees are an important germplasm resource. Currently, there are already many purple-varied tea tree varieties such as 'Zijuan', 'Ziyan', 'Zikui', etc. However, in terms of both quantity and cultivation area, these varieties far cannot meet the existing demands. Therefore, it is very necessary to continue breeding purple tea tree varieties.

[0003] For the breeding of purple bud and leaf variant tea trees, the traditional systematic selection method is still mainly used in China at present, mainly by directly visually observing to judge the degree of purple leaf coloration of tea leaves. This method not only has a long breeding cycle, but also tea trees are easily affected by the external environment, that is, strong light, high temperature or low temperature, drought, lack of nitrogen nutrition, etc., resulting in a temporary purple phenomenon in their apical buds and young leaves. However, this phenomenon will quickly disappear due to environmental changes. This phenomenon of new shoots turning purple due to environmental changes cannot be stably inherited. As Figure 1 shown, the inventor observed in the tea germplasm resource nursery (Guohe Town, Lujiang) of the Central Anhui Comprehensive Experiment Station of Anhui Agricultural University from the end of May to the beginning of June 2024: After consecutive days of high-temperature weather during the day, some normal green tea tree new shoots showed purple coloration. After fertilization and irrigation, the purple color disappeared and the bud and leaves returned to normal. And this phenomenon often causes misjudgment and interference to the field collection and selection of purple-varied cultivar resources by breeders. Therefore, there is an urgent need to establish a method for rapidly and efficiently identifying purple variant tea tree resources that can be stably inherited, so as to provide technical support for the breeding and identification of purple-varied cultivars.

[0004] As a new generation of breeding technology, molecular marker technology has the advantages of being fast, simple, accurate in operation, easy to popularize, safe and reliable. It can significantly improve the accuracy of breeding goals and the frequency of gene mutations, and greatly shorten the breeding period. Screening out molecular markers that can quickly identify purple-varied tea trees is of great significance for accelerating the breeding of tea trees with purple-leaf mutations and paternity testing of offspring. The inventor has publicly disclosed a Chinese patent application for an InDel marker and its combination and application for identifying different purple tea tree varieties (publication number: CN110669866A). This patent uses InDel fingerprint maps to identify four purple tea tree varieties: Ziyun, Zixian, Zihong, and Zijuan. However, the method invented in this patent cannot identify tea trees with purple and green (normal leaf color) leaves. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to provide a method for quickly and efficiently identifying tea trees with purple-leaf mutations.

[0006] The present invention solves the above technical problems through the following technical means:

[0007] In a first aspect of the present invention, a specific DNA molecular marker for identifying purple tea tree varieties is proposed, and the sequence of the DNA molecular marker is as shown in SEQ ID No.1.

[0008] CAACAATGATTCATCCCACTAAAAATATCACCACTAATAGCACTAATGCATTAAAAAAGTAAAAAAAAAAAAAAAAAAATACAACTCCAAGACCAAAACATCACATCATTAACGGTGGGACCCACTGCCACCTAATTAGTGGGAGCACTAATTAGTGCTCCCAAGCATTTTTCTTTTTTTT(SEQ ID No.1)

[0009] Preferably, the purple tea tree variety is any one or more of Zijuan, Ziju, and Zimudan.

[0010] In a second aspect of the present invention, primers designed for the above DNA molecular marker are proposed, and the primers are at least one of a first molecular marker primer pair and a second molecular marker primer pair:

[0011] The sequence of the first molecular marker primer pair is:

[0012] Upstream primer 1: 5’-TAATCTTTCCATATAAGGGAGAG-3’(SEQ ID No.2);

[0013] Downstream primer 1: 5’-TCTCACTCCTAATGGAACACA-3’ (SEQ ID No.3);

[0014] The sequences of the second molecular marker primer pair are as follows:

[0015] Upstream primer 2: 5’-CAACAATGATTCATCCCACTAA-3’ (SEQ ID No.4);

[0016] Downstream primer 2: 5’-AGGGATATAGCCTTAATAACCTG-3’ (SEQ ID No.5).

[0017] In the third aspect of the present invention, a detection reagent or kit is proposed, which contains primers designed based on the above DNA molecular markers.

[0018] In the fourth aspect of the present invention, the application of the primers, detection reagents or kits designed based on the above DNA molecular markers in identifying purple tea tree varieties is proposed.

[0019] In the fifth aspect of the present invention, a method for identifying purple tea tree varieties using the primers designed based on the above DNA molecular markers is proposed, including the following steps:

[0020] (1) Extract the DNA of the tea tree sample to be tested;

[0021] (2) Use the primers designed based on the above DNA molecular markers to perform a PCR amplification reaction on the DNA of the tea tree sample to be tested;

[0022] (3) Electrophoresis detection: After adding a fluorescent dye to the reaction product in step (2), perform electrophoresis using agarose gel, and use a gel imager to detect the bands and analyze:

[0023] If there are bands at 500bp and / or 332bp, it is a heritable purple-variation tea tree; if there are no bands at 500bp and / or 332bp, it is a non-heritable purple-variation tea tree.

[0024] The present invention proposes a method for identifying the leaf color of tea trees, which is a method for identifying whether the purple trait of tea trees is stably inherited using trace DNA extracted from tea tree tissues as a template, molecular marker primer amplification, and agarose electrophoresis technology. According to 2 pairs of molecular marker primer pairs, using PCR amplification technology to amplify the target bands, and distinguishing whether the tea tree is a heritable purple-variation tea tree according to the position of the target bands.

[0025] Preferably, the PCR reaction conditions in step (2) are as follows (10μl system):

[0026] 5 μl of reaction solution, 0.5 μl of polymerase, 0.5 μl of 10 μmol / L upstream primer, 0.5 μl of 10 μmol / L downstream primer, 1 μl of DNA template, ddH 2 O is made up to 10 μl.

[0027] Preferably, the PCR reaction procedure in step (2) includes the following steps:

[0028] 1) Pre-denaturation at 94 °C for 3 min;

[0029] 2) Denaturation at 94 °C for 15 s;

[0030] 3) Annealing temperature: 57 °C, annealing time: 15 s;

[0031] 4) Extension at 72 °C for 25 s,

[0032] 5) Repeat steps 2), 3), and 4) for 30 cycles;

[0033] 6) Extension at 72 °C for 5 min;

[0034] 7) Store at 4 °C.

[0035] Preferably, the fluorescent dye is SYBR Green I.

[0036] The sixth aspect of the present invention provides the application of the primer, detection reagent or kit designed by the above DNA molecular marker in the molecular marker-assisted breeding of tea plants.

[0037] The advantages of the present invention are as follows:

[0038] 1. This method is fast and efficient, and can screen out leaf purple-variation plants in natural populations and hybrid populations at the seedling stage of tea plants, avoiding the influence caused by leaf purple-variation due to the environment;

[0039] 2. It does not require expensive instruments and complex procedures, and only common instruments such as a PCR instrument can be used to identify the results;

[0040] 3. It has high sensitivity and low sample requirement. DNA can be extracted from a single leaf for result detection;

[0041] 4. It has good specificity. Two pairs of primers are designed according to the specific fragments inserted in the leaf purple-variation tea plants to accurately verify whether the tea plants contain the specific fragments. The present invention has high reference value for the identification of leaf purple-variation tea plants and is suitable for popularization and application. Description of the Drawings

[0042] Figure 1 It is a comparison chart of the phenotypes of tea buds and leaves before and after fertilization;

[0043] Figure 2Molecular marker identification results of PurpleTE inserted in tea plants with purple - leaf - variegated mutants, normal - leaf - colored tea plants, and tea plants with adversity - induced purple - leaf coloration.

[0044] The samples include: ZJ: Zijuan, ZJu: Ziju, ZMD: Zimudan, YK10: Yunkang 10, SCZ: Shuchazao, LJ43: Longjing 43, as well as tea plants P1, P2, P3 with environment - induced purple - leaf coloration and samples G1, G2, G3 of normal - leaf - colored tea plants. Detailed implementation methods

[0045] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0046] The test materials and reagents used in the following embodiments, unless otherwise specified, can all be obtained from commercial channels.

[0047] For those not specifying specific techniques or conditions in the embodiments, they can all be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications.

[0048] Based on the high - quality genome sequencing of a purple - variegated tea plant, the present invention compared the whole - genome sequences of this purple tea plant with those of other normal - leaf - colored tea plants and found a 181 - bp specific insertion in the promoter region of CsMYB75 in this purple tea plant. This insertion was also found in other purple - leaf tea plant varieties such as 'Zijuan', 'Ziju', and 'Zimudan', but not in normal - leaf - colored tea plants such as 'Yunkang 10', 'Shuchazao', and 'Longjing 43'. Meanwhile, the expression level of CsMYB75 and the anthocyanin content in purple - leaf tea plant varieties were also significantly higher than those in normal - leaf - colored varieties. For this insertion fragment, two pairs of molecular markers were designed. The present invention can quickly and accurately identify whether the purple - variegated mutation of natural populations and hybrid progeny tea plant seedlings can be stably inherited through simple techniques such as extracting tea plant DNA and performing ordinary polymerase chain (PCR) amplification, agarose gel electrophoresis, and imaging analysis using these two pairs of molecular markers. This identification method is convenient, fast, highly efficient and accurate, inexpensive, and suitable for popularization and application.

[0049] Example 1:

[0050] 1. Preparation of the PCR amplification reaction system:

[0051] (1) Reaction solution: 10 mM dNTP, 10× ThermoPol reaction buffer, 150 mM MgSO4, 5 mM Betaine, and the volume ratio of the four is 8:5:3:10;

[0052] (2) Primer solution: including 4 pmol / μl upstream primer 1, 4 pmol / μl downstream primer 1 (or 4 pmol / μl upstream primer 2, 4 pmol / μl downstream primer 2). The four primers are respectively:

[0053] Upstream primer 1: 5’-TAATCTTTCCATATAAGGGAGAG-3’ (SEQ ID No.: 2);

[0054] Downstream primer 1: 5’-TCTCACTCCTAATGGAACACA-3’ (SEQ ID No. 3);

[0055] Upstream primer 2: 5’-CAACAATGATTCATCCCACTAA-3’ (SEQ ID No. 4);

[0056] Downstream primer 2: 5’-AGGGATATAGCCTTA ATAACCTG-3’ (SEQ ID No. 5);

[0057] (2) DNA polymerase: Taq DNA polymerase, with a concentration of 5 U / μl;

[0058] (3) Color reagent: Fluorescent dye 1× SYBR Green I.

[0059] Using purple-varied tea plants, tea plants with adversity-induced purple leaf color, and tea plants with normal leaf color as materials respectively, the above reaction system was used to identify them according to the following methods.

[0060] 2. Template DNA extraction:

[0061] 1) Grind 100 mg of tea leaf specimens with liquid nitrogen;

[0062] 2) Add 700 μl of DNA lysis solution to the ground powder;

[0063] 3) Incubate in a water bath at 65 °C for 15 min, and invert and shake well every 5 min;

[0064] 4) Add 600 μl of chloroform / isoamyl alcohol and mix well, and centrifuge at 12,000 rpm for 10 min;

[0065] 5) Pipette 500 μl of the supernatant, add 500 μl of isopropanol to it, centrifuge at 12,000 rpm for 5 min, and discard the supernatant;

[0066] 6) Add 500 μl of 70% ethanol, pipette the precipitate, centrifuge at 12,000 rpm for 5 min, discard the supernatant, and repeat once;

[0067] 7) Air-dry the residual ethanol in the preparation tube;

[0068] 8) Add 100 μl of deionized water to dissolve the precipitate.

[0069] 2. PCR amplification reaction: Prepare the reaction system in a 200 μl PCR tube: 5 μl of reaction solution, 1 μl of primer mixture, 0.5 μl of DNA polymerase, 1 μl of template DNA, and make up to 10 μl with sterilized deionized water. Place the above reaction tube in a PCR instrument for reaction. The reaction program is as follows:

[0070] 1) Pre-denature at 94 °C for 3 min;

[0071] 2) Denature at 94 °C for 15 s;

[0072] 3) Annealing temperature: 57 °C, annealing time: 15 s;

[0073] 4) Extend at 72 °C for 25 s;

[0074] 5) The cycling steps are ②, ③, and ④, cycling 30 times;

[0075] 6) Extend at 72 °C for 5 min;

[0076] 7) Store at 4 °C.

[0077] 3. Agarose gel electrophoresis: Add 2 μl of 1×SYBR Green I to the above reaction tube, mix well, and perform electrophoresis on a 1.5% agarose gel, and use a 2,000 bp DNA marker to indicate the band position, and image on a gel imager.

[0078] 4. Result determination: Observe the amplified bands. For the results of the first molecular marker primer pair, if there is a band at 500 bp, it represents that there is a purpleTE insertion in the promoter region of the CsMYB75 gene of this variety, and this variety is a heritable purple mutant tea variety or germplasm; if there is no band at this position, it is a normal leaf color tea tree or a normal leaf color tea tree with leaf color turning purple induced by adversity. Similarly, for the results of the second molecular marker primer pair, if there is a band at 332 bp, it is a heritable purple tea variety; if there is no band at this position, it is a normal leaf color tea tree or a tea tree with leaf color turning purple induced by adversity.

[0079] In this embodiment, when using the first molecular marker primer pair, bands were observed at 500 bp for the samples of 'Zijuan', 'Ziju' and 'Zimudan', indicating that there was a purpleTE insertion in the promoter region of the CsMYB75 gene in these three varieties, which were genetically purple-varied tea plants; for the tea plants with normal leaf color, bands were only observed at 319 bp, indicating that there was no purpleTE insertion in the promoter region of the CsMYB75 gene in this variety. When using the second molecular marker primer pair, bands were observed at 332 bp for the samples of 'Zijuan', 'Ziju' and 'Zimudan', while no bands were observed at this position for the tea plants with normal leaf color. For the tea plants with leaf color turning purple induced by adversity, like all tea plants with normal leaf color, no bands were observed at 500 bp and 332 bp, indicating that their purple traits could not be stably inherited.

[0080] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of primers for amplifying InDel molecular markers in identifying purple tea varieties, characterized in that: The following steps are involved: (1) Extracting DNA from tea tree samples to be tested; (2) Using primers for amplifying InDel molecular markers, a PCR amplification reaction is performed on the DNA of the tea tree sample to be tested; the primers for amplifying InDel molecular markers are a first molecular marker primer pair and a second molecular marker primer pair; the sequence of the first molecular marker primer pair is: Upstream primer 1: 5′-TAATCTTCCATATAAGGGAGAG-3′; Downstream primer 1: 5′- TCTCACTCCTAATGGAACACA -3′; The sequence of the second molecular marker primer pair is: Upstream primer 2: 5′- CAACAATGATTCATCCCACTAA -3′; Downstream primer 2: 5′-AGGGATATAGCCTTA ATAACCTG-3′; (3) Electrophoresis detection: After adding fluorescent dye to the reaction product of step (2), electrophoresis is performed using agarose gel, and the bands are detected using a gel imager for analysis: Observe the amplified bands. For the result of the first molecular marker primer pair, if there is a band at 500 bp, the variety is a heritable purple variant tea tree variety; if there is no band at this position, it is a normal leaf color tea tree or a normal leaf color tea tree induced to turn purple by adversity. Similarly, for the result of the second molecular marker primer pair, if there is a band at 332 bp, it is a heritable purple tea tree variety; if there is no band at this position, it is a normal leaf color tea tree or a tea tree induced to turn purple by adversity. The purple tea tree variety is any one or more of the purple varieties of Zijuan, Ziju, Zimudan and their hybrid offspring.

2. The use according to claim 1, characterized in that: The sequence of the InDel molecular marker is shown as SEQ ID No.

1.

3. A method for identifying purple tea varieties, characterized in that: The following steps are involved: (1) Extracting DNA from tea tree samples to be tested; (2) using primers for amplifying InDel molecular markers to perform PCR amplification reaction on the DNA of the tea tree sample to be tested; the primers for amplifying InDel molecular markers are the first molecular marker primer pair and the second molecular marker primer pair described in claim 1; (3) Electrophoresis detection: After adding fluorescent dye to the reaction product of step (2), electrophoresis is performed using agarose gel, and the bands are detected using a gel imager for analysis: Observe the amplified bands. For the result of the first molecular marker primer pair, if there is a band at 500 bp, the variety is a heritable purple variant tea tree variety; if there is no band at this position, it is a normal leaf color tea tree or a normal leaf color tea tree induced to turn purple by adversity. Similarly, for the result of the second molecular marker primer pair, if there is a band at 332 bp, it is a heritable purple tea tree variety; if there is no band at this position, it is a normal leaf color tea tree or a tea tree induced to turn purple by adversity. The purple tea tree variety is any one or more of the purple varieties of Zijuan, Ziju, Zimudan and their hybrid offspring.

4. The identification method according to claim 3, characterized in that: The PCR reaction conditions in step (2) are as follows: 5 μl of PCR reaction solution, 0.5 μl of polymerase, 0.5 μl of 10 μ mol / L upstream primer, 0.5 μl of 10 μ mol / L downstream primer, 1 μl of DNA template, and ddH2O added to 10 μl.

5. The identification method according to claim 3, characterized in that: The PCR reaction procedure in step (2) comprises the following steps: 1) Pre-denaturation at 94°C for 3 min; 2) Denaturation at 94°C for 15 s; 3) Annealing temperature: 57 °C, annealing time: 15 s; 4) 72℃ extension for 25 s, 5) Repeat steps 2), 3), and 4) 30 times; 6) Extension at 72°C for 5 min; 7) Store at 4℃.

6. The identification method according to claim 3, characterized in that: The fluorescent dye is SYBR Green I.

7. Application of primers for amplifying InDel molecular markers in molecular marker-assisted breeding of purple tea varieties, characterized in that: The following steps are involved: (1) Extracting DNA from tea tree samples to be tested; (2) using primers for amplifying InDel molecular markers to perform PCR amplification reaction on the DNA of the tea tree sample to be tested; the primers for amplifying InDel molecular markers are the first molecular marker primer pair and the second molecular marker primer pair described in claim 1; (3) Electrophoresis detection: After adding fluorescent dye to the reaction product of step (2), electrophoresis is performed using agarose gel, and the bands are detected using a gel imager for analysis: Observe the amplified bands. For the result of the first molecular marker primer pair, if there is a band at 500 bp, the variety is a heritable purple variant tea tree variety; if there is no band at this position, it is a normal leaf color tea tree or a normal leaf color tea tree induced to turn purple by adversity. Similarly, for the result of the second molecular marker primer pair, if there is a band at 332 bp, it is a heritable purple tea tree variety; if there is no band at this position, it is a normal leaf color tea tree or a tea tree induced to turn purple by adversity. The purple tea tree variety is any one or more of the purple varieties of Zijuan, Ziju, Zimudan and their hybrid offspring.

8. The use according to claim 7, characterized in that: The purple tea tree variety is Zijuan.

9. The use according to claim 7, characterized in that: The purple tea tree variety is Ziju.

10. The use according to claim 7, characterized in that: The purple tea tree variety is purple peony.

Images