Method for identifying brassica rapa and diplotaxis hybridization based on molecular markers and primer pair
By using specific primers to perform PCR amplification and gel electrophoresis on CCATATGGTGCGCCGTCTAT and ACTCGGACAAAGACACGGAC, the uncertainty and complexity of identifying distant hybrids of Chinese cabbage and arugula were resolved, and a simple and accurate allotetraploid identification was achieved.
Patent Information
- Application Number
- CN202410950106.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2025-11-11
- Estimated Expiration
- 2044-07-16
AI Technical Summary
In the identification of distant hybrids of Chinese cabbage and arugula, existing technologies rely on morphological identification, which is easily affected by environmental and human factors and is not reliable enough, and molecular marker identification is complex to operate and difficult to design, lacking a simple and accurate identification method.
PCR amplification was performed using specific primers for CCATATGGTGCGCCGTCTAT and ACTCGGACAAAGACACGGAC. The bands were observed by gel electrophoresis to determine the authenticity of the allotetraploid. The maternal and paternal parents were amplified using specific primers, and the authenticity of the hybrid was confirmed by observing the bands.
This method enables a simple and accurate identification of allotetraploid hybrids between Chinese cabbage and Arugula, overcoming the uncertainties of morphological identification and the complexity of molecular marker identification, and providing an efficient identification method.
Smart Images

Figure CN118668002B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the identification of distant new germplasm, specifically to the identification of allotetraploids from intergeneric hybridization of Chinese cabbage and Arugula based on molecular marker technology. Background Technology
[0002] With continuous population growth and rapid economic development, the demands of agricultural production are becoming increasingly diversified. These demands include, for example, better taste, higher yields, and superior resistance to diseases, pests, and stress. To meet these growing demands, the development of new hybrid germplasm has become a crucial technology in the agricultural field. How to accurately identify the authenticity of hybrid offspring is another important problem that has arisen since their creation.
[0003] Chinese cabbage and arugula are common crops with significant economic value. For the identification of distant hybrids of Chinese cabbage and arugula, morphological and cytological identification are commonly used. Morphological identification has advantages such as simplicity, but it is easily affected by environmental and human factors, making the results unreliable. Although molecular markers are also used for identification, their design is more difficult and sometimes requires two or more pairs of primers, making the process relatively complex.
[0004] Molecular markers have advantages such as co-dominance, marker stability, and wide availability. Currently, their application in the identification of distant hybrids between Chinese cabbage and arugula is limited.
[0005] Therefore, in the field of new germplasm from distant hybridization, there is a strong demand for providing methods that can conveniently and accurately identify new germplasm. Summary of the Invention
[0006] In view of this, in a first aspect, the present invention provides a method for identifying allotetraploid hybrids of Chinese cabbage and Arugula species based on molecular marker technology, comprising:
[0007] The sample to be identified was obtained by intergeneric hybridization of Chinese cabbage '72049' as the female parent and arugula 'ASTRO' as the male parent, and the material was obtained after embryo rescue and chromosome doubling.
[0008] Using the genomic DNA of the material as a template, amplification was performed using the following primer pairs:
[0009] Forward primers 5'-3': CCATATGGTGCGCCGTCTAT,
[0010] Reverse primer 5'-3': ACTCGGACAAAGACACGGAC;
[0011] The amplified products were subjected to gel electrophoresis; and
[0012] Observe the electrophoretic bands to determine the authenticity of the allotetraploid.
[0013] In some embodiments, the method of the present invention further includes amplifying the maternal and paternal parents using the specific primer pairs.
[0014] In some implementations, observing bands includes the presence of both maternal and paternal bands in the sample, confirming the acquisition of an allotetraploid.
[0015] In a preferred embodiment, the acquisition steps include: using Chinese cabbage '72049' as the female parent and arugula inbred line 'ASTRO' as the male parent, performing hybridization and pollination during the bud stage, harvesting the ovary 7 days after pollination, performing embryo rescue under aseptic conditions, and undergoing doubling treatment. For example, during the bud stage, the stigma is sprayed with a 62.3 mg / L MgCl2·6H2O solution, and after 15-20 minutes, hybridization and pollination are performed by smearing.
[0016] The specific primer pairs of this invention target the following gene sequences:
[0017] CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAAACTGTAACCAAAACAGAAGAAGCTTTAAGGA
[0018] GAAGAGAAGAGTCTGAGATCACAGCAATGGAGATTGATCTAAATGATTATACTGTTATTAAGGAAGG
[0019] AGAAGCTGAGATTCTCATGCACAAGAAGAACAAAGTCTTCTTCAATAAAGCTCAGGTCAACAATAG
[0020] GGACATGTCTATTGCTGTCTTAAGGGCGTATATATCAAAACGCAAGCAAGAGCATGAAGCCATGTTAT
[0021] CTAAAAGAGCTAGATCATCTGGTAAAATCCCTGAGAAGAATGTCTCTTCTGAAGTTTCCAGAGAAGA
[0022] GACTCCATTGAAAACGGTGAAACCAACGGAGAACATGAAGAAACATCTCAGGATGGACCAAATGA
[0023] AGCTGTGAAGACCACATATGAACCTGCACGAAGAGAACTCAAGCCACCAAGAGTGCTTGAGGCACT
[0024] GTCAGCTTCTGGATTAAGGGCTTTGAGATATGCTCGTGAAGTTGAAGGAATTGGTCAAGTTGTGGCT
[0025] TTAGATAATGATCCAGCATCGGTTGAAGCTTGCCAGAGAAACATAAAGTTCAACGGCTTGATGTCTAC
[0026] TTCAAAGGTGGAGTCACATCTTACTGATGCTCGTGTCCATATGCTCACCAACCCTAAAGAGTTTGATG
[0027] TGGTTGATCTTGAT CCATATGGTGCGCCGTCTAT CTTCCTTGATTCAGCTGTTCAATCAGTTGCAGATG
[0028] GTGGCTTGCTGATGTGTACAGCAACTGACATGGCAGTGTTATGTGGTGCTAATGGCGAGGTTTGCTAT
[0029] TCCAAATATGGTTCCTATCCACTTAAAGGGAAGTATTGTCATGAGATGGCTTTGCGTATCCTCCTCGCC
[0030] AGCATCGAGAGCCATGCAAACCGTTACAAGAGGTACATTGTACCTGTTCTGTCAGTCCAAATGGATT
[0031] TCTAC GTCCGTGTCTTTGTCCGAGT CTACACTTCGGCGAGTGCAATGAAGAACACACCACTAAAGCT
[0032] CTCATACGTCTATCAATGCATTGGTTGTGACTCTTTTCATCTTCAGTCCGTTGGAAGATCCCTCCCTAG
[0033] GAATAACAGTGTGAGGTATCAAGCAGGAGTTGGTCCTGTTGTTCCTCAAGACTGCACTCACTGTGGG
[0034] AAAAAATATAACATGGGTGGACCTATATGGTCAGCACCAATTCATGATCAAGAATGGGTGACTTCGGT
[0035] TCTAAATGGTGTTAAATCCATGAAAGATAGATATCCTGCTTATGACAAAATATGCTCTGTTCTTACAAC
[0036] AATCTCAGAGGAACTGCTAGATGTTCCACTATTTTTGAGCCTTCATAGTCTCTCTGGAACGTTGAAAT
[0037] GTACTTCACCATCAGCTGCTATGTTTAGATCAGCAGTGATGAATGCAAAGTACCGTGTCTCGGGGTCT
[0038] CATGTGAACCCTCTTGGGATTAAAACTGATGCTCCAATGGAGATTATTTGGGACATCATGCGTTGCTG
[0039] GGTGAAGAACCATCCTGTGAAAGCACAACCACCTGAACATCCAGGAAGTGTGATTCTATCTAAAGA
[0040] ACCATCTCTTCAGGCTGACTTCTCACGCCATGTTGGCTCATTAAGCAAAGCACAAGTGAAGAAAGTA
[0041] GCTCGGTTTCTACCTAATCCAGAGAAGCATTGGGGTCCAAAGATAAGAGCTGGTCGTCAGATCACAA
[0042] GCAAACACGTCTCTCTTATTGGTCATGAAGCTGTTAATGATCATCTCAATGGCCACAAGGAAGCAGC
[0043] AGGAGCAGAAGGAGGAGGAGGAGAAGAGAAGGAAGATGATATCACTGAGGGTGAGCCAGACCTG
[0044] AAACGCCAGAAGAAAACAGAGGATTTGCTTCAACATCATAAGAGGGCTAATTTGTTTACCCTAAAG
[0045] AATTTTAGATTTTTGTTTTGCAAAAGAATTTACCCTTTTTTATTATTATTTTCAAACATTTGTCATAGTAT
[0046] GTTCTACGTTTTTGATCCAAG
[0047] In a second aspect, the present invention provides a specific primer pair for identifying intergeneric hybridization between maternal Chinese cabbage '72049' and paternal arugula 'ASTRO', the primer pair consisting of forward primer 5'-3': CCATATGGTGCGCCGTCTAT and reverse primer 5'-3': ACTCGGACAAAGACACGGAC.
[0048] In a third aspect, the present invention provides a kit for identifying allotetraploid hybrids of maternal Chinese cabbage '72049' and paternal arugula 'ASTRO', the kit comprising the molecular marker primer pairs defined in the second aspect.
[0049] In some embodiments, the kit of the present invention further comprises genomic DNA of Chinese cabbage '72049' and genomic DNA of arugula 'ASTRO'.
[0050] In a fourth aspect, the present invention provides the use of the specific primer pairs defined in the second aspect for identifying allotetraploids resulting from intergeneric hybridization between the maternal Chinese cabbage '72049' and the paternal arugula 'ASTRO'.
[0051] In a fifth aspect, the present invention provides the use of the kit defined in the third aspect for identifying allotetraploids resulting from intergeneric hybridization between maternal Chinese cabbage '72049' and paternal arugula 'ASTRO'.
[0052] After obtaining the intermediate material of 'Chinese cabbage 72049 × Arugula ASTRO', another challenge was how to accurately and conveniently identify the hybrid. The inventors overcame the shortcomings of traditional morphological identification, which is easily affected by environmental and human factors and whose identification results are not reliable enough. At the same time, they overcame the current situation that there are few studies on the identification of distant hybrids of Chinese cabbage and Arugula using molecular markers, which are difficult to design and complicated to operate. They successfully screened primer pairs for identification. When using primer pairs to identify the allotetraploid of Chinese cabbage 72049 × Arugula ASTRO, the operation is simple and the results are accurate. Attached Figure Description
[0053] Figure 1 The morphology of the parent and doubled material plants is shown in Figure a, which is Chinese cabbage; Figure b is arugula; and Figures c1-c7 are F1 to F7. The scale bar is 10 cm.
[0054] Figure 2 The number of chromosomes in the root tip of the doubled material; d1-d7 represent F1 to F7.
[0055] Figure 3 The results are obtained by gel electrophoresis of maternal, paternal, and allotetraploid amplification using 5 primer pairs.
[0056] Figure 4 The results are shown in the gel electrophoresis of seven progeny populations (maternal, paternal, and allotetraploid) amplified using the Cluster 4592.11 primers. Detailed Implementation
[0057] Material
[0058] Maternal parent: Chinese cabbage '72049' (Brassica rapa; 2n=20; AA), paternal parent: arugula (Eruca sativa, EE, 2n=22); '72049 × arugula' distant hybrid (AE) and allotetraploid (AAEE) after chromosome doubling.
[0059] These materials were provided by the Leafy Vegetable Research Group of the Vegetable Research Institute of the Henan Academy of Agricultural Sciences, and were planted and managed routinely at the Henan Modern Agricultural Research and Development Base.
[0060] Equipment and reagents
[0061] The main experimental instruments include: CyFlow Cube 8 flow cytometer, microscope, fluorescence microscope, centrifuge, autoclave, etc.
[0062] Main experimental tools: centrifuge tubes, tweezers, dissecting needles, coverslips, glass slides, pipettes, absorbent paper, scissors, blades, etc.
[0063] Main experimental reagents: Carnoy's fixative, distilled water, glacial acetic acid, anhydrous ethanol, 8-hydroxyquinoline, carbofuran staining solution, DAP I staining solution, 2% enzyme digestion solution, propidium iodide (PI), B5 medium, MS medium, etc.
[0064] Preparation of enzymatic hydrolysate: Weigh 200-400 mg of cellulase and 100-200 mg of pectinase (cellulase:pectinase = 2:1), dissolve in 0.01 mol of citrate buffer, and store at -20°C. The 0.01 mol of citrate buffer is prepared by weighing 0.30 g of trisodium citrate and 0.21 g of citric acid, and adding sterile water (double-distilled H2O, ddH2O) to a final volume of 100 mL.
[0065] Example 1: Distant hybridization and embryo rescue
[0066] A hybrid cross was constructed using Chinese cabbage '72049' (provided by the Vegetable Research Institute of Henan Academy of Agricultural Sciences) as the female parent and arugula inbred line 'ASTRO' (collected and preserved by the Vegetable Research Institute of Henan Academy of Agricultural Sciences) as the male parent. The cross was constructed using bagging at the bud stage and artificial pollination. Two to three days before hybridization, the opened flowers on the male parent inflorescence were removed, and the plant was isolated by bagging. On the day the bagged male parent opened, the anthers were collected and used to pollinate the appropriately sized buds on the female parent plant. During the bud stage, the stigmas of the Chinese cabbage were sprayed with a 62.3 mg / L MgCl2·6H2O solution. After the solution dried (approximately 15 to 20 minutes), pollination and hybridization were performed by smearing the stigmas on the stigmas, as well as in the untreated group. After pollination, the plants were isolated by bagging to strictly control contamination by pollen from sources other than the male parent. Seven days after pollination, the ovaries were harvested, and embryo rescue was performed under aseptic conditions.
[0067] The collected test materials were kept fresh at 4℃ to reduce moisture evaporation; solid inoculation medium (MS + 6-BA 1.0mg / L + NAA 0.1mg / L + hydrolyzed casein 0.5% + activated carbon 0.5% + agar 7.2g / L + sucrose 20g / L + activated carbon 0.5%), distilled water, petri dishes with filter paper, and inoculation petri dishes were autoclaved at 121℃ for 25 minutes and then sterilized with ultraviolet light in a clean bench for 20 minutes. Gloves, masks, laboratory gowns, 75% alcohol, 0.1% mercuric chloride, waste liquid container, tweezers, scalpels and blades, alcohol lamp, marker pen, and sealing film were also prepared.
[0068] Using scissors, remove plump, healthy, and pest-free ovaries from the selected test material and place them in the corresponding beakers, clearly labeling them with the material name or corresponding code. Place the selected test material in a clean bench, first surface disinfecting with 75% alcohol for 30 seconds, then sterilizing with 0.1% mercuric chloride for 8 minutes. Afterward, rinse 3-5 times with sterile distilled water, pouring the waste liquid into a prepared waste liquid container. After rinsing clean, use tweezers to remove the ovaries and place them in sterile petri dishes with filter paper. Use a scalpel to slowly cut along the midline of the ovary with moderate force, removing the ovules from the ovary with a blade and placing them evenly on sterile solid inoculation medium, with 30-50 ovules per dish depending on their size. Finally, seal the petri dishes tightly with sealing film, label the petri dish lid with the material name and operation date, and then place them in an incubator for dark incubation at room temperature (25℃). After about a week of cultivation, check for any contaminated culture dishes. Remove any contaminated culture dishes promptly and check them every 5 days to prevent contamination of other normally growing culture dishes.
[0069] After about 20 days of cultivation, observe whether new embryos have grown. Place the culture dishes with grown embryos on a light-lit culture rack for further cultivation. Once the embryos have recovered and turned green, they can be transferred to a solid subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%) for subculture propagation.
[0070] The germination rate of ovules was statistically analyzed by observing whether new embryonic buds emerged. The results showed that the germination rates of ovules treated with 62.3 mg / L MgCl2·6H2O solution were 6.67%, 5.83%, and 9.17%, respectively, with an average germination rate of 7.22%, which was significantly higher than the 0.83% germination rate of the untreated control.
[0071] Example 2: Colchicine Double Treatment
[0072] Weigh out the required amounts of agar, sucrose, and B5 medium to prepare the subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%). Weigh 0.21 g of colchicine (concentration 0.02%) per liter of the liquid subculture medium and add it to the medium. Stir until completely dissolved. Adjust the pH to 5.8-5.9 to obtain the colchicine-doubled medium, which is then dispensed into culture flasks. Autoclave at 121℃ for 25 min. After sterilization, allow it to solidify to obtain the doubled medium for later use.
[0073] Prepare all necessary experimental tools and doubled culture medium. Select healthy, vigorous plants with normal green leaves from the regenerated seedlings that need to be doubled and double-treat them for 7 days.
[0074] After the treatment period, the seedlings were transferred to normal subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%) to allow for acclimatization. The material name and the number of days of double treatment were clearly labeled on the outside of the culture bottles. If a culture bottle contained both strong and weak seedlings, the strong seedlings were transferred to double-treated medium, and the weak seedlings were transferred to subculture medium without colchicine to continue growth. During the double treatment and subsequent acclimatization stages, close observation of plant growth, plant shape, and leaf changes was necessary. Timely adjustments and records were made based on these observations.
[0075] After embryo rescue and colchicine treatment, seven ovules formed doubled tissue culture seedlings. Then, using in vitro propagation, seven progeny populations were obtained, designated F1, F2, ... F7. The plants were then transplanted into the field and managed using standard methods, such as... Figure 1 As shown.
[0076] Example 3: Confirmation of Distant Hybrids
[0077] Chromosome observation in root tips
[0078] Rinse the root tips of the parent plants and hybrid offspring multiple times with tap water until clean. Use scissors to cut fresh lateral roots with a diameter of 0.8-1.2 mm and a length of 10-15 mm, and rinse the collected lateral root samples with distilled water to further remove impurities. Place the clean lateral root samples into centrifuge tubes, fill them with 8-hydroxyquinoline, and incubate them in a 25°C incubator in the dark for 3.5 hours.
[0079] After incubation in the dark, remove the lateral roots from the centrifuge tubes, blot the residual liquid at the root tips with filter paper, fix them in centrifuge tubes containing Carnot fixative (alcohol: glacial acetic acid = 3:1), and store them in a -20°C freezer.
[0080] Remove the root tip, rinse it with distilled water, and then place it in 2 ml of 1 mol / L hydrochloric acid solution. Dissociate it in a water bath at 55-60°C for 15 minutes.
[0081] After dissociation, the stem tip was removed, rinsed, placed on a glass slide, crushed, and then stained with Carbofuran stain for 5 minutes.
[0082] Cover with a coverslip, press the slide, and observe and photograph it under a microscope.
[0083] Chromosome number determination using root tip chromosome counting in seven groups of doubled chromosome materials can accurately determine whether a hybrid is a true hybrid. The expected true hybrid (AAEE) should have 42 chromosomes (AA+EE=42). Figure 2As shown, the number of chromosomes in the root tips of all 7 groups of doubled materials was 42.
[0084] Therefore, through observation of root tip chromosomes, the doubled material can be basically identified as a distant hybrid, and the allodiploid was successfully doubled into an allotetraploid.
[0085] Example 4 Morphological Analysis
[0086] After several subcultures, the embryos obtained through experiments gradually grow from new embryos into regenerated seedlings, eventually forming robust regenerated plants. At this point, robust seedlings can be selected for rooting culture. After about 10-15 days, robust seedlings with strong root systems are selected for transplanting.
[0087] Prepare appropriately sized seedling trays, trays, protective covers, sterile substrate, a fungicide solution to prevent pests and diseases, a rooting agent of a certain concentration, and tweezers. Fill the seedling trays with the prepared moist sterile substrate. Carefully remove strong seedlings and their well-developed roots using tweezers. Dip the roots in the fungicide solution and rooting agent before planting them into the corresponding holes on the label. Transplant each subsequent tissue culture seedling into the seedling trays using this method. After each tray is full, water it, cover it with a protective cover, and place it in a pre-set light incubator to allow the seedlings to recover and grow. Once the seedlings have recovered and reached a certain size, they can be transplanted to the experimental field for normal growth in a natural environment.
[0088] In addition, whether transplanting tissue culture seedlings into plug trays or from light-incubated incubators to experimental fields, they should be transplanted and planted in a reasonable manner according to the type, quantity, and size of the materials, so as to facilitate the investigation and recording of plant characteristics in later experiments.
[0089] Observe and record the morphological characteristics of Chinese cabbage (mother parent), arugula (father parent), and F1 generation plants at different growth and development stages, such as plant trunk, lateral branches, flower shape, number of petals, flower bud morphology, inflorescence, stamens, and flower color.
[0090] The morphological data of the allotetraploid and the parent are shown in Table 1.
[0091] Table 1. Statistical data on allotetraploid and parental phenotypes
[0092]
[0093] Example 5: Development and Identification of Specific Molecular Markers
[0094] Leaves were taken from the parents and F1 generation plants, RNA was extracted using the Trizol method, libraries were constructed, and high-throughput sequencing of the parents and their hybrid offspring was performed using the Illumina platform.
[0095] After obtaining clean reads through high-throughput sequencing, reference-free assembly analysis was performed. Trinity (Grabherr MG, Haas BJ, Yassour M, et al., Full-length transcriptome assembly from RNA-Seq data without a reference genome, Nature biotechnology, 2011, 29(7):644-652) was used to perform de novo assembly of the reference transcriptome. Common software was employed for assembly, alignment, and differential analysis. The assembly results were used to compare the parental and doubled-genome materials, and codominant markers were developed at sequence difference positions. Through comparative screening, these markers were made specific to the parental material. Meanwhile, Primer3 was used to design corresponding primers for these specific sites. The differential candidate regions were first primed using TBtools (Chengjie Chen, Hao Chen, Yi Zhang, et al. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data, Molecular Plant, 2020, 13(8): 1194-1202). Next, from the many primer pairs obtained from the primer-check, five specific primer pairs initially screened by the leafy vegetable research group were used for molecular marker identification of Chinese cabbage '72049', arugula, and allotetraploids, as shown in Table 2.
[0096] Table 2
[0097]
[0098]
[0099] PCR amplification was performed using genomic DNA from the parental line and the allotetraploid. The PCR program was set according to the primer melting temperature, base number, base composition, and base sequence: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles, and the PCR product was stored at 4℃ for later use. The 20 μL reaction mixture included: 2 μL DNA template, 1 μL each of pre- and post-primer, 10 μL PCR Mix, and 6 μL dd H2O. Using a DNA marker as a control, agarose gel electrophoresis was performed at 120V, 346mA for 20 min, and the bands were observed. Figure 3 It can be seen that only the allotetraploids under the Cluster 4592.11 primer have the parental electrophoretic bands.
[0100] PCR amplification was performed using genomic DNA from the parent and allotetraploid sources targeting the Cluster 4592.11 sequence. The PCR program was set according to the primer melting temperature, base number, base composition, and base sequence: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, and 35 cycles. The PCR products were stored at 4℃ for later use. A 20 μL reaction mixture included: 2 μL DNA template, 1 μL each of pre- and post-primer, 10 μL PCR Mix, and 6 μL dd H2O.
[0101] Using a DNA marker as a control, agarose gel electrophoresis was performed at 120V and 346mA for 20 min, and the bands were observed. PCR and agarose gel electrophoresis were performed on the DNA of the seven distantly hybridized progeny. All seven allotetraploid populations were found to possess the electrophoretic bands of the parents, confirming the authenticity of the hybrids. Figure 4 As shown.
[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention.
Claims
1. A method for identifying allotetraploid hybrids between Chinese cabbage and Arugula species based on molecular marker technology, comprising: The sample to be identified was obtained by intergeneric hybridization of Chinese cabbage '72049' as the female parent and arugula 'ASTRO' as the male parent, and the material was obtained after embryo rescue and chromosome doubling. Using the genomic DNA of the material as a template, amplification was performed using the following specific primer pairs: Forward primers 5'-3': CCATATGGTGCGCCGTCTAT, Reverse primer 5'-3': ACTCGGACAAAGACACGGAC; The amplified products were subjected to gel electrophoresis; and Observe the electrophoretic bands to determine the authenticity of the allotetraploid.
2. The method of claim 1, wherein, The method further includes amplifying the maternal and paternal parents using the specific primer pair.
3. The method of claim 1, wherein, The observation steps include confirming the acquisition of an allotetraploid when both maternal and paternal bands are present in the sample.
4. The method according to any one of claims 1-3, wherein, The steps for obtaining the embryo include: using Chinese cabbage '72049' as the female parent and arugula inbred line 'ASTRO' as the male parent, hybridizing and pollinating during the bud stage, taking the ovary 7 days after pollination, performing embryo rescue under sterile conditions, and performing doubling treatment.
5. Use of primer pairs in identifying allotetraploid hybrids of maternal Chinese cabbage '72049' and paternal arugula 'ASTRO', wherein the primer pairs consist of forward primer 5'-3': CCATATGGTGCGCCGTCTAT and reverse primer 5'-3': ACTCGGACAAAGACACGGAC.
6. Use of the kit in identifying allotetraploids resulting from intergeneric hybridization of maternal Chinese cabbage '72049' and paternal arugula 'ASTRO', the kit comprising primer pairs consisting of a forward primer 5'-3': CCATATGGTGCGCCGTCTAT and a reverse primer 5'-3': ACTCGGACAAAGACACGGAC.
7. The use as described in claim 6, wherein, The kit further includes genomic DNA of Chinese cabbage '72049' and genomic DNA of arugula 'ASTRO'.
Citation Information
Patent Citations
Use method and application for breaking distant hybridization obstacle of Chinese cabbage by using AS-SRK46
CN115211366A