Nanobodies, recombinant nanobodies, recombinant plasmids, recombinant strains and applications thereof against feline panleukopenia virus
By screening and constructing nanoantibodies, recombinant plasmids and recombinant strains against feline panleukopenia virus, the problem of lack of effective therapeutic preparations in the existing technology was solved, and efficient and safe biological treatment effects were achieved.
Patent Information
- Application Number
- CN202410850873.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-28
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2044-06-28
AI Technical Summary
There is currently a lack of effective biological therapeutics against feline panleukopenia virus, and existing vaccine immunization strategies cannot meet treatment needs.
Develop nanoantibodies against feline panleukopenia virus. Screen nanoantibody sequences with high binding adaptability from the VHH phage library of immunized alpacas. Construct recombinant plasmids and recombinant strains. Use the Pichia pastoris expression system to prepare recombinant nanoantibodies, achieving significant biological activity.
The prepared recombinant nanoantibodies have high binding compatibility with the prevalent virus strains, with a neutralization titer of 6log2, a purity of 90%, and a yield of 3mg/L, and can be used to prepare anti-feline panleukopenia virus drugs.
Smart Images
Figure CN118684765B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of antiviral drugs, and in particular to a nano antibody, a recombinant nano antibody, a recombinant plasmid, a recombinant strain and applications thereof against feline panleukopenia virus. Background Art
[0002] Feline panleukopenia (FPL) is an acute, highly pathogenic infectious disease caused by the feline panleukopenia virus (FPV), a serious threat to the health of felines. It primarily infects kittens under six months of age during their immune window period, causing clinical symptoms such as high fever, vomiting, diarrhea, bloody stools, and a sharp decrease in white blood cells. The FPV genome contains two open reading frames, encoding the nonstructural proteins NS1 and NS2, and the structural proteins VP1, VP2, and VP3. VP2 is the primary structural protein of FPV, accounting for over 90% of its total protein content. It influences FPV's antigenicity, pathogenicity, and host range, and plays a crucial role in viral infection and receptor binding. In recent years, with the development of the pet cat industry, the continued prevalence and mutation of FPV have attracted widespread attention. Currently, FPL prevention and control primarily relies on vaccination, but there is no specific treatment for FPL. Therefore, the development of safe, effective, inexpensive, and easily standardized biotherapeutic agents has become a pressing priority.
[0003] With the continuous development of new biotherapeutic agents, nanobodies have gradually become a hot topic and trend in the development of new biotherapeutic agents due to their advantages such as small molecular weight, high affinity, high specificity, and strong tissue penetration. However, there are currently no reports on the research of nanobodies against feline panleukopenia virus. Summary of the Invention
[0004] Based on this, the present invention addresses the gap in the field of nanoantibodies against feline panleukopenia virus and proposes a nanoantibody, recombinant nanoantibody, recombinant plasmid and recombinant strain and their applications against feline panleukopenia virus.
[0005] The technical solutions adopted by the present invention to solve the technical problems are as follows:
[0006] The present invention provides an anti-feline panleukopenia virus nanoantibody, whose nucleotide sequence is SEQ ID NO: 1 and the encoded amino acid sequence is SEQ ID NO: 2.
[0007] Preferably, the nanobody is obtained by screening the VHH phage library of immunized alpacas using antibody library solid phase screening technology.
[0008] Preferably, the capacity of the VHH phage library of the immune alpaca is 5×10 8 indivual.
[0009] The present invention provides a recombinant plasmid prepared by utilizing the nano antibody against feline panleukopenia virus.
[0010] Preferably, the basic vector of the recombinant plasmid is a pPIC9K vector.
[0011] The present invention provides a recombinant strain prepared by utilizing the recombinant plasmid.
[0012] Preferably, the nucleotide sequence of the recombinant strain is SEQ ID NO: 3.
[0013] Preferably, the basic bacteria of the recombinant strain are Pichia pastoris X-33 competent cells.
[0014] The present invention provides a recombinant nanobody prepared using the recombinant strain.
[0015] The present invention provides an anti-feline panleukopenia virus drug, which uses the nano antibody and / or the recombinant nano antibody as an effective ingredient.
[0016] The beneficial effects of the present invention are:
[0017] The present invention provides a nanobody against feline panleukopenia virus, whose nucleotide sequence is SEQ ID NO: 1 and the encoded amino acid sequence is SEQ ID NO: 2. This nanobody is obtained by screening a VHH phage library of immunized alpacas using antibody library solid-phase screening technology; its immune antigen is the currently prevalent feline panleukopenia virus strain SH01, and the screened nanobody has higher binding compatibility with the prevalent virus strain.
[0018] The present invention provides a recombinant plasmid prepared using the anti-feline panleukopenia virus nanoantibody, wherein the basic vector of the recombinant plasmid is preferably a pPIC9K vector.
[0019] The present invention provides a recombinant strain prepared using the recombinant plasmid, wherein the nucleotide sequence of the recombinant strain is preferably SEQ ID NO: 3, and the basic bacteria of the recombinant strain are preferably Pichia pastoris X-33 competent cells.
[0020] The present invention provides a recombinant nanobody prepared using the recombinant strain, wherein the yield of the recombinant nanobody reaches 3 mg / L and the purity reaches 90%. The recombinant nanobody is prepared using a Pichia pastoris expression system and can react with feline panleukopenia virus, with a neutralization titer of 6 log2 on FK81 cells, which is reported for the first time. The recombinant nanobody has significant biological activity and can be used to prepare an anti-feline panleukopenia virus drug. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Identification results of the VHH phage library of immune alpacas used for screening nanobody sequences.
[0022] Figure 2 ELISA test results for solid phase screening of the VHH phage library of immune alpacas for screening nanobody sequences.
[0023] Figure 3 The figure shows the map of the recombinant plasmid pPIC9K-FPV-Nb009 used to prepare the recombinant strain.
[0024] Figure 4 This is the PCR identification result of the recombinant strain used to express the recombinant nanobody FPV-Nb009.
[0025] Figure 5 This is the Western blot identification result of the recombinant nanobody FPV-Nb009. DETAILED DESCRIPTION
[0026] The present invention provides an anti-feline panleukopenia virus nanoantibody, whose nucleotide sequence is SEQ ID NO: 1 and the encoded amino acid sequence is SEQ ID NO: 2.
[0027] Preferably, the nanobody is obtained by screening the VHH phage library of immunized alpacas using antibody library solid phase screening technology.
[0028] Preferably, the capacity of the VHH phage library of the immune alpaca is 5×10 8 indivual.
[0029] The present invention provides a recombinant plasmid prepared by utilizing the nano antibody against feline panleukopenia virus.
[0030] Preferably, the basic vector of the recombinant plasmid is a pPIC9K vector.
[0031] The present invention provides a recombinant strain prepared by utilizing the recombinant plasmid.
[0032] Preferably, the nucleotide sequence of the recombinant strain is SEQ ID NO: 3.
[0033] Preferably, the basic bacteria of the recombinant strain are Pichia pastoris X-33 competent cells.
[0034] The present invention provides a recombinant nanobody prepared using the recombinant strain.
[0035] The present invention provides an anti-feline panleukopenia virus drug, which uses the nano antibody and / or the recombinant nano antibody as an effective ingredient.
[0036] The following is a clear and complete description of the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0037] 1. Sources
[0038] Feline triple vaccine was purchased from Zoetis (Suzhou) Animal Health Products Co., Ltd.
[0039] Adult healthy alpacas were purchased from Jiangsu Dengyuanhe Biotechnology Co., Ltd.
[0040] Camel peripheral blood lymphocyte separation medium was purchased from Beijing Solebow Technology Co., Ltd.
[0041] RNA extraction kit and reverse transcription kit were purchased from Nanjing Novozymes Biotech Co., Ltd.
[0042] The pComb3Xss plasmid was purchased from Nanjing Yifeixue Biotechnology Co., Ltd.
[0043] Restriction endonucleases Sac I and Spe I were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.
[0044] T4 ligase was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.
[0045] Competent Escherichia coli TG1 was purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0046] Feline panleukopenia virus strain SH01 was purchased from Harbin Zhengkang Biotechnology Co., Ltd.
[0047] The pPIC9K vector was purchased from Thermo Fisher Scientific (China) Co., Ltd.
[0048] Restriction enzymes EcoRI and NotI were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.
[0049] Escherichia coli DH5α competent bacteria were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.
[0050] Restriction endonuclease SalI was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.
[0051] Pichia pastoris X-33 competent cells were purchased from Changsha Aikebo Biotechnology Co., Ltd.
[0052] Electroporation instrument was purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd.
[0053] Sorbitol, bleomycin and affinity chromatography columns were purchased from Shanghai Beyotime Biotechnology Co., Ltd.
[0054] YPG medium and BMMY liquid medium were purchased from Beijing Solebow Technology Co., Ltd.
[0055] FK81 cells were purchased from ATCC, USA.
[0056] 2. Construction of an immune alpaca VHH phage library for screening nanobody sequences
[0057] 1. The feline triple vaccine (containing inactivated feline panleukopenia virus, feline herpes virus, and feline calicivirus) was injected subcutaneously into the neck of healthy adult alpacas at an injection volume of 3 mL / alpaca. Boost immunization was performed once on days 14, 28, 42, and 56 after immunization, and the serum antibody titer was measured at the same time. When the ELISA titer of the serum antibody reached 1:60,000, the alpaca peripheral blood was collected, and the lymphocytes were separated using a camel peripheral blood lymphocyte separation solution. RNA was extracted using an RNA extraction kit and a reverse transcription kit and reversely transcribed into cDNA. The nanoantibody (VHH) sequence of the alpaca antibody was then amplified by a two-round nested PCR method. Among them, the first-round nested PCR amplification primer sequences are CALL-1 and CALL-2, and the second-round nested PCR amplification primer sequences are VHH-P2-Sac-F and VHH-P2-Spe-R. The above primer sequence information is as follows:
[0058] CALL-1:GTCCTGGCTGCTCTTCTACAAGG;
[0059] CALL-2:GGTACGTGCTGTTGAACTGTTCC.
[0060] VHH-P2-Sac-F: GAGCTCATGGATGTGCAGCTGGTGGA;
[0061] VHH-P2-Spe-R:ACTAGTTGAGGAGACGGTGACCT.
[0062] The two-round nested PCR amplification primers CALL-1 and CALL-2, VHH-P2-Sac-F and VHH-P2-Spe-R were synthesized by General Biotechnology (Anhui) Co., Ltd.
[0063] 2. The amplified alpaca antibody nanobody (VHH) sequence and the pComb3Xss plasmid were digested with restriction endonucleases SacI and SpeI, ligated with T4 ligase and transformed into Escherichia coli TG1 competent cells. Twenty-four single colonies were picked the next day and identified by bacterial liquid PCR.
[0064] The results of bacterial liquid PCR identification are as follows Figure 1 As shown, all 24 single colonies picked were positive, and the sequences were different after sequencing, indicating that the positive rate of the VHH phage library of the immune alpaca reached 100% (24 / 24), the diversity was rich (24 / 24), and the VHH phage library of the immune alpaca was successfully constructed.
[0065] According to the calculation of RNA extraction, reverse transcription, ligation system dosage, plate count and dilution ratio, the capacity of the VHH phage library of the immune alpaca constructed in the present invention is 5×10 8 indivual.
[0066] 3. Screening of Nanobody Sequences Binding to Feline Panleukopenia Virus
[0067] The feline panleukopenia virus strain SH01 was coated on an ELISA plate, and the antibody library solid phase screening technology was used to screen out the nanoantibody (VHH) sequence that could bind to the feline panleukopenia virus.
[0068] Among them, the ELISA test results of solid phase screening are as follows Figure 2 As shown, a total of 14 nanobody (VHH) sequences were screened, among which the VHH sequence numbered Nb009 had the highest OD value, its nucleotide sequence was SEQ ID NO: 1, and the encoded amino acid sequence was SEQ ID NO: 2.
[0069] 4. Construction of recombinant plasmid pPIC9K-FPV-Nb009 for preparation of recombinant strains
[0070] The above-screened nanoantibody sequence (number Nb009) that can bind to feline panleukopenia virus and the pPIC9K vector were digested with restriction endonucleases EcoR I and Not I, respectively, and recovered by 1% agarose gel electrophoresis. The target fragments were ligated using T4 ligase and transformed into Escherichia coli DH5α competent cells. After overnight culture on the plate, single colonies were picked for sequencing and identification the next day.
[0071] Sequencing identification results Figure 3 As shown, the recombinant plasmid identified as correct by sequencing was named pPIC9K-FPV-Nb009 and stored at -20°C for future use.
[0072] 5. Construction of a recombinant strain for expressing recombinant nanobody FPV-Nb009
[0073] After linearization of the recombinant plasmid pPIC9K-FPV-Nb009 with the restriction endonuclease Sal I, it was added to the competent cells of Pichia pastoris X-33, gently mixed, transferred to a pre-cooled electroporation cup and placed in an ice bath for 5 minutes, and then transferred to an electroporator. The electroporation parameters of the electroporator are as follows: the voltage is automatically set to 1.5kV; immediately after electroporation, 1mL of pre-cooled 1M sorbitol was added, pipetted twice and transferred to a 1.5mL centrifuge tube, and cultured in a 30℃ incubator for 1h; at room temperature, centrifuged at 4000r / min for 4 minutes, the bacteria were collected, and resuspended with 100μL YPG medium, then spread on YPG solid medium containing 100μg / mL bleomycin, cultured at 37℃ for 3 days, and single colonies were picked for PCR identification. The PCR identification results are as follows Figure 4 As shown in FIG, the length of the single colony is 357 bp. The correctly identified single colony is the recombinant strain for expressing the recombinant Nanobody, and its nucleotide sequence is SEQ ID NO: 3.
[0074] VI. Preparation of recombinant nanobody FPV-Nb009
[0075] The recombinant strain obtained above was first inoculated into 20 mL of YPG culture medium for rejuvenation. The next day, 5 mL was inoculated into a 1 L shake flask containing 250 mL of YPG culture medium. The culture was incubated overnight at 28°C and 200 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium. The cells were induced at 28°C and 200 r / min for 120 hours, during which methanol was added to a final concentration of 1% every 12 hours. The supernatant was collected and purified according to the affinity chromatography column instructions to obtain the recombinant protein. The molecular weight and purity of the recombinant protein were analyzed by SDS-PAGE and Western blot.
[0076] Western blot identification results Figure 5As shown, the relative molecular mass of the obtained recombinant protein is 14.6 kDa, which is consistent with the expected value. The recombinant protein is the prepared recombinant nanobody FPV-Nb009, with a concentration of 3 mg / L and a purity of 90%.
[0077] VII. Detection of the neutralizing activity of recombinant nanoantibody FPV-Nb009
[0078] The FK81 cells were digested by fixed virus dilution antibody method, resuspended in complete culture medium and temporarily stored in a 37°C incubator; the recombinant nanoantibody FPV-Nb009 was diluted 2-fold serially and mixed with an equal volume of 200 TCID 50 A suspension of the feline panleukopenia virus strain SH01 was mixed evenly and incubated at 37°C for 1 hour. 0.1 mL of the virus-antibody suspension was then mixed with 0.1 mL of resuspended FK81 cells. The cells were then inoculated into a 96-well plate. Virus and normal cell controls were also established and incubated at 37°C in a 5% CO2 incubator for observation. The results showed that the recombinant nanoantibody FPV-Nb009 had a neutralizing potency of 6 log2, a first reported result.
[0079] The present invention discloses a nanobody, a recombinant nanobody, a recombinant plasmid, a recombinant strain and applications against feline panleukopenia virus. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar replacements and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The products of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the products described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.
Claims
1. A nanobody against feline panleukopenia virus, characterized in that The nucleotide sequence of the nanobody is SEQ ID NO: 1, and the encoded amino acid sequence is SEQ ID NO:
2.
2. a recombinant plasmid prepared by utilizing the nano antibody against feline panleukopenia virus according to claim 1.
3. The recombinant plasmid according to claim 2, characterized in that The basic vector of the recombinant plasmid is the pPIC9K vector.
4. A recombinant strain prepared using the recombinant plasmid according to claim 3.
5. The recombinant strain according to claim 4, characterized in that The basic bacteria of the recombinant strain are Pichia pastoris X-33 competent cells.
6. An anti-feline panleukopenia virus drug, characterized in that: The drug uses the nanobody according to claim 1 as an active ingredient.