A Fusarium strain JXASEPF002 and its application

Abstract

The present invention belongs to the technical field of microorganisms and their applications, and specifically relates to a strain of Fusarium JXASEPF002 and its application. Fusarium wilt ) JXASEPF002 was deposited in the China Center for Type Culture Collection on September 27, 2023, at No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with a deposit number of CCTCC NO: M20231818. The Fusarium JXASEPF002 can kill the ovarian cell line of the fall armyworm at a lower concentration (100 μg / mL), and is a potential biological control drug for the fall armyworm, with very broad potential development prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and their applications, and specifically relates to a Fusarium JXASEPF002 strain and an application thereof. Background Art

[0002] The fall armyworm (Spodoptera frugiperda) is a worldwide pest that mainly harms rice and corn crops. Currently, the main means of controlling the fall armyworm in agriculture is a combination of chemical pesticides and biological pesticides. Due to the strong migration and reproduction ability of the fall armyworm, it is very easy for the insect to develop resistance to chemical pesticides and Bt preparations under long-term selection pressure, which greatly increases the cost of pesticide application and reduces the efficacy of the pesticide. Summary of the invention

[0003] The purpose of the invention is to solve the deficiencies of the prior art and provide a Fusarium JXASEPF002 and an application thereof.

[0004] To achieve the above object, the first aspect of the present invention provides a strain of Fusarium JXASEPF002, which Fusarium foetens )JXASEPF002 has been deposited in the China Center for Type Culture Collection on September 27, 2023, with the address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number is CCTCC NO: M20231818. The Fusarium JXASEPF002 discovered in the present invention can kill the ovarian cell line of the fall armyworm at a lower concentration (100 μg / mL), and is a potential biological control drug for the fall armyworm.

[0005] As a further preferred embodiment, the gene sequence of 16S rDNA of the above-mentioned Fusarium JXASEPF002 is shown as SEQ ID No: 1.

[0006] SEQ ID NO.1:

[0007] ATTACGAGTTTCACTCCCACCCCTGTGAACATACCACTTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGT AAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACAT TGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACAGCTTGGTGTTGGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTGGCGGTCACGTCGAGCTTCCATAG CGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCCGGAGGAAAA.

[0008] The second aspect of the present invention further provides a Fusarium JXASEPF002 preparation, which is obtained by fermenting Fusarium JXASEPF002.

[0009] The third aspect of the present invention also provides a method for preparing the above-mentioned Fusarium JXASEPF002 preparation, comprising the following steps:

[0010] The Fusarium JXASEPF002 is placed in a liquid culture medium containing starch and 0.3% sucrose solution for cultivation. After the cultivation, a solid phase culture is obtained, which is soaked in ethyl acetate overnight, extracted, filtered, rotary evaporated, dried, and finally extracted with dimethyl sulfoxide to obtain a Fusarium JXASEPF002 preparation.

[0011] As a further preferred embodiment, the 0.3% sucrose solution contains 0.005% chloramphenicol.

[0012] The fourth aspect of the present invention also provides the use of the above-mentioned Fusarium JXASEPF002 and / or its fermentation liquid in the preparation of agricultural pest control agents.

[0013] The fifth aspect of the present invention also provides an agricultural pest control agent, which contains the above-mentioned Fusarium JXASEPF002 and / or its fermentation liquid.

[0014] As a further preferred embodiment, the concentration of the Fusarium JXASEPF002 is 100 μg / mL.

[0015] The sixth aspect of the present invention also provides the use of the above-mentioned agricultural pest control agent in controlling agricultural pests, wherein the agricultural pests are fall armyworm or fall armyworm.

[0016] The beneficial effects of the present invention are:

[0017] The present invention provides a Fusarium JXASEPF002, and the Fusarium JXASEPF002 can kill the ovarian cell line of the fall armyworm at a relatively low concentration (100 μg / mL), is a potential biologically derived control drug for the fall armyworm, and has very broad potential development prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Shown is the phenotype of the Greater Galleria mellonella larvae infected with Fusarium solani;

[0019] Figure 2 Shown is a diagram of the colony morphology of Fusarium spp.;

[0020] Figure 3 Shown is the morphology of Fusarium spores under a microscope

[0021] Figure 4 The following are the effects of crude extracts of Fusarium metabolites on in vitro cells of Spodoptera frugiperda: A blank control treatment for 0 min; B blank control treatment for 60 min; C negative control treatment for 60 min; D Fusarium JXASEPF002 metabolite treatment for 60 min;

[0022] Figure 5 Shown are the effects of crude extracts of Fusarium metabolism on the nuclear membrane of Spodoptera frugiperda cells in vitro: A Sf-9 cells heochst33342; B Sf-9 cells transmitted light. DETAILED DESCRIPTION

[0023] The following will be combined with the embodiments and drawings to clearly and completely describe the concept, specific structure and technical effects of the present invention, so as to fully understand the purpose, scheme and effect of the present invention. It should be noted that the embodiments and features in the embodiments of this application can be combined with each other without conflict.

[0024] Example 1

[0025] Isolation, screening, purification, identification and preservation of strains

[0026] (1) Isolation, screening and purification of strains:

[0027] It was isolated from the soil of Wuzhifeng Mountain, Shangyou County, Ganzhou City, Jiangxi Province. Specifically, a certain amount of soil was taken into a transparent plastic bowl, and 10 4-5 instar wax moth larvae that had just been pretreated with high temperature were placed in each soil sample (to prevent wax moth larvae from making webs). During the experiment, the container was turned over every day to allow wax moth to fully contact the soil. The soil samples were placed in an environment of 23±2 ℃ and in a dark environment. Observe daily, pick out the dead larvae, and after surface disinfection, place them separately in a culture dish with moist sterile filter paper. The experiment lasted for about 14 days until most of the larvae entered the adult state. After the hyphae or spores grew out, use an inoculation loop to gently pick a few spores or hyphae of the entomogenous fungus on the infected larvae and place them on a PDA medium (containing 50 µg / mL chloramphenicol and 100 µg / mL streptomycin sulfate) plate, which was placed in a mold incubator at 25±1 ℃ for dark culture. When the hyphae have grown all over the plate, cut a small piece of culture medium containing hyphae from the edge of the colony and transplant it to another culture medium plate to wait for colonies to form. Repeat this method for at least 5 generations until the colony morphology is typical and free of foreign bacteria, and then molecular and morphological identification can be performed.

[0028] Figure 1 The phenotype of the dead wax moth larvae infected by the strain is shown. Note: After 8 days of full contact with the soil, the wax moth larvae die, and then the larvae become hard and grow white hyphae. The hyphae are picked and isolated and cultured on PDA medium.

[0029] (2) Morphological, physiological and biochemical characteristics of the strain:

[0030] Figure 2 The strain is flocculent on potato dextrose agar (PDA) medium, with the front side starting white and gradually turning into lavender, and the back side lavender. The hyphae are septate, colorless, and branched. The conidia are colorless, round, and attached individually or in chains ( Figure 3 ).

[0031] (3) Molecular biological identification of strains:

[0032] Molecular biology was used to assist in identification. The fungal genomic DNA extraction kit was used to extract the strain DNA, and the internal transcribed spacer region ( ITS) PCR amplification was performed with universal primers ITS5: 5′-GGAAGTAAAAGTCGTAACAAGG-3′ (SEQ ID No: 2) and ITS-4: 5′-TCCTCCGCTTATTGATATGC-3′ (SEQ ID No: 3). The sequence results were compared with BLAST in the National Center for Biotechnology Information (NCBI) database.

[0033] In summary, the strain was identified as Fusarium Fusarium foetens .

[0034] Example 2

[0035] Toxicity test of the fermentation product of Fusarium JXASEPF002 (CCTCC NO: M20231818) against Spodoptera frugiperda

[0036] (1) Preparation of crude extract of Fusarium JXASEPF002 metabolites

[0037] The fungus (Fusarium) purified in Example 1 was picked up for mycelium (blocks), inoculated into starch medium (supplemented with 0.3% sucrose solution and 0.005% chloramphenicol) and cultured at room temperature for 4 weeks. The scaled-up solid phase culture was combined and soaked in ethyl acetate overnight and extracted twice. The mycelium in the organic solvent was filtered out through Whatmann No.1 filter paper. Finally, the separated ethyl acetate extract was dried at room temperature using a rotary vacuum evaporator, and the fungal extract was dissolved in dimethyl sulfoxide (DMSO) to prepare a fungal secondary metabolite concentrate (crude extract) for standby use;

[0038] (2) Toxicity test of crude extracts of Fusarium JXASEPF002 metabolites against fall armyworm larvae

[0039] Dilute the fermentation crude extract to 10 mg / mL with Tween, weigh 1 g of artificial feed and mix it with 100 μL of the diluted crude extract, cut it into small particles after full absorption, and evenly distribute it into a 24-well cell culture plate. Put a 2-year-old fall armyworm larva that has been starved in advance into each well of the cell plate. After 2d-7d, investigate the number of dead insects and calculate the final mortality rate. Each treatment has 24 insects and repeat 3 times. In this example, 10% DMSO is used as the control group. After seven days of treatment with 10% DMSO, the mortality rate of fall armyworm is only 6.94%, while after 7 days of treatment with crude extract, the mortality rate of fall armyworm is 79.17%.

[0040] Example 3

[0041] Toxicity test of the fermentation products of Fusarium JXASEPF002 (CCTCC NO: M20231818) against in vitro cells of Spodoptera frugiperda

[0042] (1) Toxicity of crude extracts of Fusarium JXASEPF002 metabolites to the Spodoptera frugiperda cell line Sf-9

[0043] Sf-9 cells in the logarithmic growth phase were cultured at 2×10 4 Inoculate each well of a 96-well cell culture plate and culture at 28°C overnight. Discard the supernatant, wash gently twice with sterile PBS, and divide into 2 groups, each with 18 wells. Add 80 μL of PBS to the first group as a CK control, and add the pre-diluted crude extract to the second group at a gradient concentration of 100, 50, 25, 12.5, and 6.25 μg / mL. Place in a 28°C incubator and examine under a microscope every 10 minutes to observe cell morphology changes and (take photos with an eyeless inverted microscope (Evos FL Auto), take three white light fields of view in each well to observe whether there is cell lesions).

[0044] Effects of crude extracts of Fusarium metabolites on in vitro cell lines of Spodoptera frugiperda Figure 4 As shown in the figure, the cells in the Fusarium crude extract treatment group showed significant changes in cell morphology at 60 minutes, with cells becoming larger, rounder, and agglomerating, with blurred cell edges, cell fragmentation, and content outflow. With the increase of culture time, Sf-9 cells treated with 100 μg / mL high-concentration fermentation broth crude extract had a fast pathological change rate and a high pathological change rate until all cells died. This shows that the toxicity of the crude extract to Sf-9 cells is time- and concentration-dependent.

[0045] (2) Effects of crude extracts of Fusarium JXASEPF002 metabolites on the nuclei of the Spodoptera frugiperda cell line Sf-9

[0046] The logarithmic phase SF-9 cells were resuspended and added to a 24-well cell culture plate with cell slides at a density of 1×10 5 Cells were cultured overnight at 28°C. The cells were washed twice with sterile PBS, treated with 50 μg / mL crude solution for 1 hour, the supernatant was removed, and the cells were gently washed twice with PBS, fixed with paraformaldehyde, stained with Hoechst 33258, carefully washed 2-3 times with PBS, and observed and photographed with an inverted fluorescence microscope.

[0047] The crude extract of Fusarium JXASEPF002 metabolites has a strong physical and chemical effect on the nuclear membrane of Spodoptera frugiperda cells in vitro, causing damage to the nuclear membrane in a short period of time, resulting in the release of nuclear substances into the cytoplasm (such as Figure 5 A) until the nuclear structure is completely destroyed and the cell eventually disintegrates, which has potential insecticidal potential.

[0048] Example 4

[0049] Toxicity test of the fermentation product of Fusarium JXASEPF002 (CCTCC NO: M20231818) against Spodoptera frugiperda

[0050] Dilute the fermentation crude extract to 10 mg / mL with Tween, weigh 1g of artificial feed and mix it with 100 μL of the diluted crude extract, cut it into small particles after full absorption, and evenly distribute it into a 24-well cell culture plate. Put a 2-instar Spodoptera litura larvae that was previously starved in each well of the cell plate. After 2d-7d, investigate the number of dead insects and calculate the final mortality rate. Each treatment has 24 insects and repeat 3 times. This embodiment uses 10% DMSO as the control group. After seven days of treatment with 10% DMSO, the mortality rate of fall armyworm was only 4.17%, while after 7 days of treatment with crude extract, the mortality rate of Spodoptera litura was 40.28%.

[0051] Although the description of the present invention has been quite detailed and specifically describes several described embodiments, it is not intended to be limited to any of these details or embodiments or any particular embodiment, but should be regarded as providing a broad possible interpretation of these claims in view of the prior art by reference to the appended claims, thereby effectively covering the intended scope of the present invention. In addition, the above description of the present invention is based on the embodiments foreseeable by the inventor, and its purpose is to provide a useful description, and those non-substantial changes to the present invention that have not yet been foreseen may still represent equivalent changes to the present invention.

Claims

1. A strain of Fusarium JXASEPF002, characterized in that: The Fusarium spp. Fusarium foetens ) JXASEPF002 was deposited in the China Center for Type Culture Collection on September 27, 2023, with the address being No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the deposit number being CCTCC NO: M20231818.

2. A Fusarium JXASEPF002 preparation, characterized in that: The product is obtained by fermenting the Fusarium JXASEPF002 described in claim 1.

3. The method for preparing the Fusarium JXASEPF002 preparation according to claim 2, characterized in that: The following steps are involved: The Fusarium JXASEPF002 was placed in a liquid culture medium containing starch and 0.3% sucrose solution for cultivation. After the cultivation, a solid phase culture was obtained, which was soaked in ethyl acetate overnight, extracted, filtered, rotary evaporated, dried, and finally dissolved in dimethyl sulfoxide to obtain a Fusarium JXASEPF002 preparation.

4. The preparation method according to claim 3, characterized in that: 0.3% sucrose solution contains 0.005% chloramphenicol.

5. Use of the Fusarium JXASEPF002 and / or its fermentation liquid according to claim 1 in the preparation of an agricultural pest control agent, characterized in that: The agricultural pest is the fall armyworm.

6. An agricultural pest control agent, characterized in that: Contains the Fusarium JXASEPF002 according to claim 1 and / or its fermentation liquid.

7. The agricultural pest control agent according to claim 6, characterized in that: The concentration of the Fusarium JXASEPF002 is 100 μg / mL.

8. Use of the agricultural pest control agent according to claim 7 in controlling agricultural pests, characterized in that: The agricultural pest is the fall armyworm.

Images