Recombinant strains of Zymomonas mobilis

Abstract

The present application relates to the technical field of Zymomonas mobilis, specifically to a recombinant strain for Zymomonas mobilis, and especially to the technical field of using starch to produce ethanol. The recombinant strain can realize simultaneous saccharification and fermentation of starch to produce ethanol at low temperature, omitting the liquefaction step of the traditional process, and can also reduce the amount of amylase, greatly reducing energy and equipment investment, reducing production costs, and having higher utilization efficiency and higher final product yield.

Description

Technical Field

[0001] The present application relates to the technical field of Zymomonas mobilis, specifically to a recombinant strain for Zymomonas mobilis, and especially to the technical field of producing ethanol from starch. Background Art

[0002] Zymomonas mobilis is a natural facultative anaerobic Gram-negative bacterium that produces ethanol. It has a unique ED metabolic pathway and high sugar fermentation efficiency. It also has the characteristics of an ideal industrial cell factory, such as high ethanol production, low product volume, strong ethanol tolerance, high osmotic pressure resistance, and no need for additional oxygen during the fermentation process. At present, the production and fermentation of products such as PHB, 2,3-butanediol, isobutanol and lactic acid have been achieved in Zymomonas mobilis. In addition, Zymomonas mobilis has a high tolerance to lignocellulosic hydrolysate, and cellulosic ethanol production has been commercialized. At the same time, the research on the mechanism related to tolerance to inhibitors in the hydrolysate is also relatively mature. In addition, through synthetic biology and metabolic engineering, Zymomonas mobilis can be transformed into chassis cells that use lignocellulosic hydrolysate to produce different platform compounds. However, like other ethanol-producing strains such as Saccharomyces cerevisiae, Zymomonas mobilis does not have the ability to use starch as a carbon source to produce ethanol. Starch needs to be enzymatically hydrolyzed into glucose before it can be used for fermentation to produce ethanol.

[0003] The traditional starch fermentation process to produce ethanol requires two enzymes: α-amylase (EC3.2.1.1) and glucoamylase (EC3.2.1.3). α-amylase plays a vital role in the hydrolysis of starch. It can quickly and randomly hydrolyze α-1,4 glycosidic bonds to produce maltose and various oligosaccharides, and saccharifying enzymes can hydrolyze oligosaccharides into glucose. In this process, the starch raw material needs to be boiled and sprayed into starch molecules at above 100°C, then liquefied at 80-90°C for at least 30 minutes by α-amylase, and then saccharified at 65°C by glucoamylase. This process requires a lot of energy input and special equipment to achieve liquefaction and saccharification, which increases the processing cost, accounting for about 30-40% of the total cost of bioethanol production.

[0004] In addition, the prior art also provides a cold-processed (40°C-50°C) saccharification method, which utilizes the synergistic action of a cocktail enzyme composed of α-amylase and glucoamylase to hydrolyze granular starch into fermentable sugars at a sub-gelatinization temperature (around 50°C), or to perform simultaneous saccharification and fermentation (SSF). However, this process is not treated at high temperature and cannot effectively control the growth of miscellaneous bacteria to achieve a sterilization effect. This makes this process more susceptible to contamination by lactic acid bacteria and wild yeasts than the traditional production process of high-temperature gelatinized starch, resulting in reduced ethanol production and a large loss of profits. Severe lactic acid bacteria contamination may even cause the factory to shut down. Summary of the invention

[0005] The present application provides a recombinant strain of Zymomonas mobilis, which can be used to ferment various types of starch raw materials (for example, slurry of ground grains and granular starch, high fructose corn syrup or commercial pure starch) to produce ethanol. In particular, the recombinant strain can achieve simultaneous saccharification and fermentation of starch to produce ethanol at low temperatures, omitting the liquefaction step of the traditional process, and can also reduce the amount of amylase used, greatly reducing energy and equipment investment, reducing production costs, and having higher utilization efficiency and higher final product yield. To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, the embodiment discloses a recombinant strain of Zymomonas mobilis, which carries a recombinant vector outside the nucleus of the Zymomonas mobilis, wherein the recombinant vector carries a coding sequence of a fusion protein, and the fusion protein is shown in SEQ ID NO.1.

[0007] In the second aspect, the embodiment discloses a method for constructing a recombinant strain of Zymomonas mobilis. The construction method comprises: synthesizing a coding sequence as shown in SEQ ID NO.2; obtaining a recombinant vector carrying the coding sequence; and transferring the recombinant vector into the Zymomonas mobilis.

[0008] In a third aspect, the embodiment discloses a recombinant vector, which includes a basic vector and the coding sequence shown in SEQ ID NO.2 inserted into the basic vector.

[0009] In a fourth aspect, an embodiment discloses a method for biosynthesizing ethanol, which comprises: obtaining the recombinant strain described in the first aspect; inoculating the recombinant strain into a culture medium containing starch for culturing; and collecting ethanol from the culture medium.

[0010] In the fifth aspect, the embodiments disclose the use of the recombinant strain described in the first aspect in producing ethanol from starch. BRIEF DESCRIPTION OF THE DRAWINGS

[0011] Figure 1 The hydrolysis circle diagram of the recombinant strain (combinant) and the control strain (control) on 1.5% starch RMG5 plates.

[0012] Figure 2 This is a comparison chart of the effects of simultaneous saccharification and fermentation of the recombinant strain (combinant) and the control strain (control) in 5% starch medium for 12 hours.

[0013] Figure 3 This is a graph showing the results of simultaneous saccharification and fermentation of ethanol by the recombinant strain (combinant) and Zymomonas mobilis carrying an empty pEZ15a vector (control) in 5% wheat starch medium. DETAILED DESCRIPTION

[0014] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0015] The embodiment discloses a recombinant strain of Zymomonas mobilis, which carries a recombinant vector outside the nucleus of the Zymomonas mobilis cell, wherein the recombinant vector carries a coding sequence of a fusion protein, and the fusion protein is shown in SEQ ID NO.1.

[0016] In some embodiments, the coding sequence is shown as SEQ ID NO. 2. In some embodiments, the coding sequence comprises a gene encoding α-amylase.

[0017] The term "encoding for" includes reference to nucleotides and / or amino acids that correspond to other nucleotides or amino acids in a transcriptional and / or translational sense.

[0018] The terms "protein" and "polypeptide" are used interchangeably and refer to any polymer of amino acids (dipeptides or peptides of higher order amino acids) linked by peptide bonds or modified peptide bonds. Polypeptides of less than about 10-20 amino acid residues are often referred to as "peptides". The polypeptides of the present invention may contain non-peptide components, such as carbohydrate groups. Carbohydrate and other non-peptide substituents may be added to the polypeptide by the cell producing the polypeptide, and may vary with the cell type. Polypeptides are defined herein according to their amino acid backbone structure; substituents such as carbohydrate groups are generally not specified, but may still be present.

[0019] A "fusion protein" is a hybrid protein expressed by a nucleic acid molecule comprising the nucleotide sequences of at least two genes. In this way, a fusion protein comprises at least two amino acid sequences that are not related to each other in nature.

[0020] Among them, "Zymomonas mobilis" only refers to strains of Zymomonas mobilis, such as Zymomonas mobilis ZM4 strain, ZM4-dCas12a strain (obtained by referring to "Shen Wei: Construction and application of dual reporter gene system and CRISPR-Cas12a genome editing system in Zymomonas mobilis [D]. Hubei University; 2020." method), ZM4-dCas12a-Dldh strain ("Shen W., Zhang J., Geng B., et al. Establishment and application of a CRISPR-Cas12a assisted genome editing system in Zymomonas mobilis [J]. Microb Cell Fact, 2019, 18 (1): 162"), ZMNP strain (CN115806922A), HAP strain (CN115851569A).

[0021] The recombinant strain provided in the embodiments of the present application can be used to ferment various types of starch raw materials (such as slurry of ground grains and granular starch, high fructose corn syrup or commercial pure grade starch) to produce ethanol, with higher energy efficiency and high final product yield.

[0022] To this end, the embodiment also provides a method for biosynthesizing ethanol, which comprises: obtaining the recombinant strain; inoculating the recombinant strain into a culture medium containing starch for culturing; and collecting ethanol from the culture medium.

[0023] To this end, the embodiment also adopts the application of the recombinant strain in producing ethanol from starch.

[0024] Hereinafter, the present application will be described in more detail through more specific embodiments, but the present application is not limited to these embodiments.

[0025] 1. Construction of recombinant vector

[0026] The embodiment also discloses a recombinant vector, which includes a basic vector and the coding sequence inserted into the basic vector.

[0027] Wherein, "basic vector" can be a vector, a viral vector, a phage or an artificial chromosome. Expression vector can also be an integrative vector or a non-integrative vector. An integrative vector can be a vector of a type that is integrated into the genome of a mobilizing Zymomonas cell as a whole. Alternatively, an integrative vector can also be a vector of a type that is integrated into the genome of a mobilizing Zymomonas cell by only a portion thereof (e.g., an expression unit). Expression vector can also be a DNA vector or an RNA vector (e.g., a retrovirus). "Basic vector" can also be a widely used expression vector. Examples of such expression vectors include pUC (e.g., pUC19, pUC18), pSTV, pBR (e.g., pBR322), pHSG (e.g., pHSG299, pHSG298, pHSG399, pHSG398), RSF (e.g., RSF1010), pACYC (e.g., pACYC177, pACYC184), pMW (e.g., pMW119, pMW118, pMW219, pMW218), pQE (e.g., pQE30), and derivatives thereof.

[0028] In one embodiment, the "basic vector" is pEZ15A. pEZ15A is obtained by referring to the method provided in "Yang S, Mohagheghi A, Franden MA, et al. Metabolic engineering of Zymomonas mobilis for 2,3-butanediol production from lignocellulosic biomass sugars [J]. Biotechnol Biofuels, 2016, 9 (1): 189." To obtain pEZ15A encoding different genes (such as resistance genes), different marker genes can be inserted into it by referring to "Construction and Application of Vector pUC19-CM-D [J]. Anhui Agricultural Science, 2010, Public Methods, Issue 19".

[0029] Using the DNA molecule shown in SEQ ID NO.2 as a template, PCR amplification was performed with INP-TEV-F (SEQ ID NO.3) and INP-TEV-R (SEQ ID NO.4) to obtain a first nucleotide sequence with a pEZ15A homology arm at the 5' end. Using the α-amylase gene encoding Geobacillus stearothermophilus as a template, PCR amplification was performed with TEV-AMY-F (SEQ ID NO.5) and AMY-R (SEQ ID NO.6) to obtain a second nucleotide sequence with a connecting peptide homology arm at the 5' end and a pEZ15A homology arm at the 3' end. Using 15Apot-F (SEQ ID NO.7) and 15Apot-R ​​(SEQ ID NO.8) as primers, pEZ15A was amplified by reverse PCR to obtain a fragment of pEZ15A.

[0030] Using seamless cloning technology, the first nucleotide sequence with a pEZ15A homology arm at the 5' end and the second nucleotide sequence with a connecting peptide homology arm at the 5' end and a pEZ15A homology arm at the 3' end were connected into a coding sequence and inserted into pEZ15A. Specifically, 1.5 μL of the first nucleotide sequence with a pEZ15A homology arm at the 5' end and the second nucleotide sequence with a connecting peptide homology arm at the 5' end and a pEZ15A homology arm at the 3' end were added to the PCR tube, 1 μL of the pEZ15A amplification fragment, 1 μL of buffer and 0.5 μL of T5 exonuclease. Among them, the molecular weight ratio of the gene fragment to the vector fragment is about 3:1. After mixing evenly, place on ice for 5 minutes, add 50 μL of susceptible Escherichia coli DH5α, place on ice for 30 minutes, heat shock at 42°C for 45 seconds, add 900 μL of LB culture medium, and culture at 37°C 220rpm for 1 hour. 5000rpm, 5min centrifugation to collect bacteria, discard the supernatant, add 100uL sterile water, mix well, and spread on LB plates with spectinomycin resistance and 1.5% starch (100μg / mL spectinomycin). The gene fragment and the vector are connected through homologous recombination of homologous arms under the action of T5 exonuclease. Correctly connected positive strains can grow on the plate and produce hydrolysis circles.

[0031] A single colony with a hydrolysis circle around it was picked up, and colony PCR was performed using the primer pair 15A-F (GGCAAAGCCACCCTATTTTTAG, SEQ ID NO.9) and 15A-R (CACTTCACTGACACCCTCAT, SEQ ID NO.10). The vector was extracted from the verified positive colony and verified by sequencing to obtain the recombinant vector pEZ15a-InaK-TEV-Amy.

[0032] The colony PCR reaction system, calculated in 10 μL, includes: 0.25 μL upstream primer, 0.25 μL downstream primer, 5 μL 2×T5SuperPCRMix (Beijing Qingke), 1 μL template (single colony diluted and mixed in 10 μL ddH2O), 3.5 μL ddH2O. The colony PCR amplification program includes: 1 cycle: pre-denaturation at 98°C for 5 min; 24 cycles: denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 45 s; 1 cycle: final extension at 72°C for 3 min.

[0033] 2. Recombinant Zymomonas mobilis

[0034] In some embodiments, the recombinant Zymomonas mobilis is obtained by transferring the above-obtained recombinant vector into Zymomonas mobilis.

[0035] For example, Z.mobilis subsp.mobilis ZM4 (ATCC3182) frozen at -80°C was quickly dissolved and resuspended with RMG5 (5% glucose, 1% yeast extract, 0.2% K2HPO4), cultured in a 30°C incubator to activate the strain, cultured overnight for 12 to 16 hours, transferred to RMG5 liquid culture medium and cultured in a 30°C incubator until OD600nm was about 0.3, centrifuged at 4°C, 5000rpm for 10 minutes, collected the cells, washed with sterile water and 10% glycerol, and finally slowly resuspended with 10% glycerol to obtain competent ZM4-Δ0028.

[0036] Add about 40μg of vector to 50μL competent ZM4-Δ0028, mix well and place on ice for 5min, transfer to a 1mm electroporation cup and electroporate for 5.0ms, the electroporation conditions are 200Ω, 25μF, 1.8kv. Transfer the liquid in the electroporation cup after electroporation to 1mL RMG5 medium (5% glucose, 1% yeast extract, 0.2% K2HPO4), incubate at 30℃ for 4-6h, evenly spread on RMG5 plates with spectinomycin resistance (100μg / mL spectinomycin), seal with sealing film and place in a 30℃ incubator for culture. Screen positive colonies and verify by colony PCR (colony PCR verification conditions are the same as above). Activate the verified positive colonies in RMG5 medium containing spectinomycin and preserve the bacteria with glycerol.

[0037] 3. Simultaneous saccharification and fermentation test:

[0038] The recombinant strain was activated and cultured in RMG2 liquid medium (2% glucose, 1% yeast extract, 0.2% K2HPO4) supplemented with spectinomycin for 18 h. The bacterial solution was then added to 5% wheat starch liquid medium (5% gelatinized wheat starch, 1% yeast extract) containing spectinomycin for cultivation. The initial OD 600 The pH was controlled at about 0.1, and the ZM4 strain (Zymomonas mobilis subsp.mobilis ZM4 = ATCC 31821) without pEZ15A was transferred as a control, and about 100U of saccharifying enzyme was added per gram of starch, and samples were taken every 12 hours. The sample was centrifuged at 12000rpm, and the supernatant was taken after 2 minutes and filtered into an HPLC injection bottle with a 0.22μm filter. The ethanol present in the supernatant was determined by an HPLC system (HPLC, Shimadzu, Japan) equipped with a BioRad Aminex HPX-87H column (Bio-Rad, Hercules, CA, USA) and a refractive index detector (refractive index detector, RID). During the detection, the column temperature was set at 60°C, 5mM H2SO4 was used as the mobile phase, and the flow rate was 0.5mL / min.

[0039] After the 5% wheat starch medium is sterilized and gelatinized, the starch absorbs water and expands to produce large insoluble starch blocks. Compared with the control group, the recombinant strain that can display α-amylase on the cell surface can liquefy starch more quickly, and the ethanol production rate has obvious advantages. In 24 hours, the ethanol production of the recombinant strain is 11.014g / L, while the ethanol production of the control group is only 5.614g / L, and the ethanol production of the recombinant strain is 198.19% of that of the control group. In 36 hours, the ethanol production of the recombinant strain is 13.235g / L, and the ethanol production of the control group is 6.626g / L, and the ethanol production of the recombinant strain is 199.74% of that of the control group. In about 48 hours, the fermentation of the recombinant strain ends, while the control group still has starch that has not been converted into glucose in 72 hours. This shows that the recombinant strain can realize the simultaneous saccharification and fermentation of starch to produce ethanol at low temperature, omitting the liquefaction step of the traditional process, and can also reduce the amount of amylase, greatly reducing energy and equipment investment, reducing production costs, and having higher utilization efficiency and higher final product yield.

[0040] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A recombinant strain of Zymomonas mobilis, which carries a recombinant vector outside the nucleus of the Zymomonas mobilis, wherein the recombinant vector carries a coding sequence of a fusion protein, and the fusion protein is as shown in SEQ ID NO.

1. The Zymomonas mobilis is the Zymomonas mobilis ZM4 strain.

2. A method for biosynthesizing ethanol, comprising: Obtaining the recombinant strain according to claim 1; inoculating the recombinant strain into a culture medium containing starch for culturing; Ethanol was collected from the culture broth.

3. Use of the recombinant strain according to claim 1 in producing ethanol from starch.

Images