Rice calcium and magnesium accumulation gene CMC1 and its encoded protein and applications
By cloning the rice calcium and magnesium accumulation gene CMC1 and using the CRISPR/Cas9-MH vector for gene editing, the accumulation of calcium and magnesium in rice grains was regulated, solving the problem of insufficient calcium and magnesium content in rice grains and improving the nutritional quality of rice.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-22
- Publication Date
- 2026-03-13
AI Technical Summary
There is limited research on the mechanisms of calcium and magnesium accumulation in rice grains in existing technologies, making it difficult to effectively increase the calcium and magnesium content of rice, thus affecting nutritional quality and the supplementation of mineral elements in the diet.
The rice calcium and magnesium accumulation gene CMC1 was cloned and identified. Gene editing was performed using the CRISPR/Cas9-MH vector to construct CMC1 knockout and overexpression vectors to regulate the accumulation of calcium and magnesium ions in grains.
It significantly alters the calcium and magnesium accumulation levels of rice at different growth stages, increases the calcium and magnesium content in grains, promotes the translocation of calcium and magnesium from the roots to the aboveground parts, and improves the nutritional quality of rice.
Smart Images

Figure CN118685420B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic bioengineering, specifically to the application of the rice calcium and magnesium accumulation gene CMC1 in increasing the calcium and magnesium content of rice. Background Technology
[0002] Rice is one of the world's most important food crops, a staple food for over 3 billion people globally, and also a major food source in my country. With the development of agricultural technology and advancements in breeding and cultivation techniques, rice yields have been steadily increasing. Simultaneously, rising living standards have led to a growing emphasis on rice quality. Domestic and international breeders and consumers generally agree on the evaluation indicators for rice quality, which include milling quality, appearance quality, cooking and eating quality, and nutritional quality (Li Ran, Qian Qian, Gao Zhenyu. Research progress on genetics and breeding improvement of rice quality. Biotechnology Bulletin, 2022, 38(4):4-19). Among these, the mineral content of rice falls under nutritional quality, and improvements in this area are of great significance.
[0003] Rice is not only a source of energy for people, but it can also supplement the body with mineral elements that are lacking. The growth and development of plants are also inseparable from mineral elements, which include macroelements (nitrogen, phosphorus, potassium), mesoelements (calcium, magnesium, sulfur, silicon) and microelements (zinc, iron, manganese, etc.) (Li Xiuli, Dai Zhigang, Chen Zhiwei, Chen Zhen, Zhai Jinghua, Ji Xiaomei, Le Youzhang. Research progress on the nutrient effects of mineral elements on kiwifruit. Hubei Agricultural Sciences, 2020, 59(16):5-10+16). Mineral elements play an important role in the growth and development of rice, and the effects of each mineral element are related, affecting the yield and quality of rice (Cao XM, Sun HY, Wang CG, Ren XJ, Liu H, Zhang ZJ. Effects of late-stage nitrogen fertilizer application on the starch structure and cooking quality of rice. Journal of the Science of Food and Agriculture, 2018, 98(6):2332-2340). Among them are calcium and magnesium, which play important roles and are closely related.
[0004] Calcium is one of the essential elements for biological growth and plays a key role in growth, development, metabolism and signal transduction (Pan Ruizhi. Plant Physiology [M]. Beijing: Higher Education Press, 2001: 12-15. Weng X, Li H, Ren C, Zhou Y, Zhu W, Zhang S, Liu L. Calcium regulates growth and nutrient absorption in Poplar seedlings. Frontiers in Plant Science, 2022, May 10; 13: 887098.). Calcium is crucial for the growth of rice. To produce 6.2-8.0 tons of rice, 24.3-35.4 kg of calcium needs to be absorbed from the soil (Dai Pingan, Yi Guoying, Zheng Shengxian, et al. Effects of different ratios of sulfur, magnesium and calcium nutrients on the quality and yield of rice [J]. Crop Research, 1999, (3): 31-35.). Calcium deficiency can severely affect the normal growth and development of plants. For example, calcium deficiency in rice can cause damage to meristematic tissues. Calcium deficiency can also affect the normal photosynthesis of leaves, resulting in stunted growth (Ren HM, Zhao XH, Li WJ, Hussain J, Qi GN, Liu SK. Calcium signaling in plant programmed cell death. Cells, 2021, 10(5):1089.). At the same time, calcium ions are also important signaling molecules in plants, and plants can transmit external signals by regulating the concentration of calcium ions inside and outside cells.
[0005] Magnesium is the central atom that makes up chlorophyll and is an important component of chlorophyll, playing a role in maintaining the stability of chloroplast structure. When plants are deficient in magnesium, chloroplast structure is damaged, the number of grana decreases, and the number of thylakoids is reduced, severely affecting plant photosynthesis (Wu W., Peters J., Berkowitz GA. Surface charge-mediated effects of magnesium). 2+ on K +Flux across the chloroplast envelope are associated with regulation of stromal pH and photosynthesis. Plant Physiology, 1991, 580-587.). Studies have also found that under the influence of magnesium ions, the chlorophyll-protein complex is closer to the photosystem PSII, thereby increasing the photosynthetic area of PSII and improving the plant's light energy utilization efficiency (Chen Liangbi, Cai Dan, Zhang Linan, Song Shaowen, Luo Xuan, Chen Yijun, Li Junfeng, Xu Tao, Mao Dandan. Research progress on magnesium ion transport and magnesium stress response mechanisms in plants. Life Science Research, 2021, 25(5):442-447). When magnesium ions are insufficient in chloroplasts, photosynthetic electron transport slows down, leading to a decrease in photosynthetic efficiency and affecting plant growth and development. Meanwhile, magnesium is an essential element for the human body, which can maintain the stability of the human nucleic acid structure, inhibit nerve excitation, participate in the synthesis of multiple proteins in the human body, and regulate muscle contraction (Zhang Zhongcheng, Xu Zhiyun, Zhang Sujie. Magnesium and human health. Trace Elements and Health Research, 2006, (4): 67-69.). Many enzymes related to energy metabolism in the human body require magnesium activation to function, and these enzymes are closely related to human growth and development (Chaudhary DP, Sharma R, Bansal DD. Implications of magnesium deficiency in type 2 diabetes: A review. Biological Trace Elemment Research, 2010, 134(2): 119-129).
[0006] Efficient ion transport in plants often occurs through specific ion transport proteins. Calcium ion absorption by plant roots primarily occurs via the apoplast pathway, with the main absorption site being the root tip region before the formation of the Casparian strip (Marschner H (1995). Mineral nutrition of higher plants, 2nd edn. London: Academic Press). Active calcium ion absorption and transport in plants mainly occurs through three pathways: calcium ion channels, Ca2+ channels, and calcium transport mechanisms. 2+ -ATPase and Ca 2+ / H +Antitransport proteins, etc. (White PJ. The pathways of calcium movement to thexylem. Journal of Experimental Botony, 2001, 52(358): 891-899.). Plants have a complex mechanism for the absorption and transport of magnesium ions, which maintains normal life activities by regulating the dynamic balance of magnesium ions. The main way plants absorb magnesium from the outside world is through the roots, which absorb it from the external environment, transport it to the aboveground parts through the xylem via transpiration, and then transport it by transport proteins on the cell membranes and organelle membranes of various tissues. Therefore, the activity of transport proteins is closely related to the transport efficiency of magnesium ions (Chen Liangbi, Cai Dan, Zhang Linan, Song Shaowen, Luo Xuan, Chen Yijun, Li Junfeng, Xu Tao, Mao Dandan. Research progress on magnesium ion transport and magnesium stress response mechanism in plants. Life Science Research, 2021, 25(5): 442-447). Currently reported magnesium ion transport proteins are divided into two types, namely Mg 2+ / H + Transporter proteins and CorA-like Mg 2+ Transporter proteins (Li Li, Zhang Xinxin. Plant Mg) 2+ Transporters regulate Mg under magnesium stress 2+ Advances in the molecular mechanisms of magnesium transport. Genomics and Applied Biology, 2020, 39(10):4695-4699. The absorption, transport, and accumulation of these two metal elements, as well as the relationship between them at the level of accumulation, are still unclear. There is limited research on the transport and accumulation mechanisms of magnesium in plants, especially rice. Further cloning of genes related to calcium and magnesium accumulation and functional studies are needed. Discovering genes related to improving the accumulation of mineral elements in rice grains, thereby increasing the calcium and magnesium content in the grains, will help improve the nutritional quality of rice and alleviate the problem of calcium and magnesium deficiency in the diet.
[0007] Only the sequence described in Seq ID No:1 is publicly available on NCBI; previous gene family analyses have found that it belongs to the calmodulin family (Boonburapong B, Buaboocha T. Genome-wide identification and analyses of the rice calmodulin and related potential calcium sensor proteins. BMC Plant Biology, 2007, 7:4); however, its function is unknown. Summary of the Invention
[0008] The technical problem to be solved by this invention is to provide the rice calcium and magnesium accumulation gene CMC1 and its encoded protein and its applications.
[0009] To solve the above-mentioned technical problems, the present invention provides a rice calcium and magnesium accumulation gene CMC1, the nucleotide sequence of which is shown in Seq ID No: 1.
[0010] As an improvement to the rice calcium and magnesium accumulation gene CMC1 of the present invention: the cDNA nucleotide sequence of gene CMC1 is shown in SeqID No: 2.
[0011] The present invention also provides the protein encoded by the above-mentioned gene CMC1, the amino acid sequence of which is shown in Seq ID No: 3.
[0012] The present invention also provides a knockout vector containing the above-mentioned gene CMC1: the vector is based on CRISPR / Cas9-MH, and the editing target site sequence located in the exon of gene CMC1 is inserted between the BsaI-BsaI restriction sites of the base vector.
[0013] The present invention also provides an overexpression vector containing the above-mentioned gene CMC1, which is obtained by inserting the CDS sequence (Seq ID No: 2) of gene CMC1 between the KpnI-SacI restriction sites of the base vector, using pCAMBIA1300-UBi as the base vector.
[0014] The present invention also provides a host cell containing the above-mentioned genes, wherein the host cell is an Escherichia coli cell or an Agrobacterium cell.
[0015] The present invention also provides the use of gene CMC1: to regulate the accumulation of calcium and magnesium in rice grains, that is, to use the above-mentioned rice calcium and magnesium accumulation gene CMC1 to regulate the content of calcium and magnesium ions in grains.
[0016] An improvement to the use of the gene CMC1 of the present invention: a knockout vector or an overexpression vector is transformed into monocotyledonous plant (e.g., rice) cells, and the transformed monocotyledonous plant cells are then cultured into plants.
[0017] This invention also provides a method for regulating the accumulation of calcium and magnesium in rice grains:
[0018] The knockout vector CRISPR / Cas9-MH-CMC1 was transformed into rice cells to obtain knockout mutants. Rice materials without Cas9 markers were screened in the progeny, and the calcium and magnesium content of the rice grains bred was reduced.
[0019] Transforming rice cells with the overexpression vector pCAMBIA1300-UBi-CMC1 resulted in an increase in calcium and magnesium content in the rice grains.
[0020] The technical solution provided by this invention is as follows:
[0021] The rice calcium and magnesium accumulation gene CMC1 of this invention has the sequences shown in (a) and (b):
[0022] (a) Genomic nucleotide sequence shown in Seq ID No: 1;
[0023] (b) cDNA nucleotide sequence shown in Seq ID No: 2;
[0024] The genomic nucleotide sequence of 93-11 shown in Seq ID No: 1 contains 3076 nucleotides, and the cDNA sequence of 93-11 shown in Seq ID No: 2 contains 450 nucleotides (including the terminator TGA).
[0025] Another object of the present invention is to provide a protein encoded by the above-mentioned gene having the sequence shown in (A):
[0026] (A) The amino acid sequence shown in Seq ID No: 3;
[0027] The protein represented by Seq ID No:3 is a protein that regulates the accumulation of calcium and magnesium ions and has 149 amino acids.
[0028] The present invention also aims to provide a knockout and overexpression vector containing the rice calcium and magnesium accumulation gene CMC1, wherein the knockout vector is... Figure 5 The CRISPR / Cas9-MH-CMC1 gene shown in Figure A underwent a frameshift mutation after gene editing, which prematurely terminated protein translation, resulting in the loss of the CMC1 protein. The overexpression vector is... Figure 5 As shown in B, the pCAMBIA1300-UBi-CMC1 vector can enhance the expression of CMC1. The present invention also aims to provide a host cell containing the aforementioned rice gene CMC1, wherein the host cell is an Escherichia coli cell, an Agrobacterium cell, or a plant cell.
[0029] The present invention also includes the use of the above-mentioned rice calcium and magnesium accumulation gene CMC1 to regulate the transport of magnesium ions to grains, including transforming rice cells with a knockout and overexpression vector constructed with the nucleotide sequence shown in the above-mentioned rice calcium and magnesium accumulation gene CMC1, and then cultivating the transformed rice cells into plants.
[0030] The aforementioned rice calcium and magnesium accumulation gene CMC1 can be used to regulate the transport of magnesium in different parts of rice and thus accumulate it in the grain.
[0031] The specific technical steps for implementing this invention are as follows:
[0032] I. Screening and Identification of Candidate Genes:
[0033] Based on the previously detected QTL site qCMC1 for magnesium accumulation in rice grains ( Figure 1 In order to clone the candidate gene of qCMC1, this invention further localizes qCMC1 to a 381kb physical region. Figure 2 Bioinformatics analysis was then performed on the genes within this interval, identifying 37 functionally annotated genes. Further analysis identified three genes potentially related to ion binding and transport. Transcriptional expression analysis of these three genes (CMC1, CMC2, and CMC3) in the young spikelets of the parental lines 93-11 and PA64s revealed a significant difference in CMC1 expression levels between PA64s and 93-11: CMC1 expression was significantly lower in PA64s spikelets compared to 93-11. Figure 3 The expression levels of the other two genes showed no significant difference between the parents 93-11 and PA64s. Figure 3 Genomic sequence analysis of the CMC1 gene from parents 93-11 and PA64s revealed a difference in the CMC1 promoter region between 93-11 and PA64s. Specifically, in the promoter region from -1193 to -1191 bp before ATG, 93-11 has three more "TAA" bases than PA64s. Figure 4 Based on the above results, this invention selects CMC1 as a candidate gene.
[0034] The nucleotide sequence of gene CMC1 is shown in Seq ID No: 1; the cDNA nucleotide sequence of gene CMC1 is shown in Seq ID No: 2; and the amino acid sequence of the protein encoded by gene CMC1 is shown in Seq ID No: 3.
[0035] II. Identification and functional analysis of the CMC1 gene:
[0036] Through transgenic technology, this invention obtained CMC1 gene overexpression and gene knockout plants. The determination of calcium and magnesium content in the grains confirmed that this invention produced rice plants with increased calcium and magnesium accumulation in the grains. Compared with wild-type Nipponbare, the calcium and magnesium content in the grains of each transgenic line showed significant differences, with a significant decrease in calcium and magnesium content in the grains of knockout plants and a significant increase in calcium and magnesium content in the grains of overexpression plants. Figure 6 This result proves that the present invention correctly cloned the calcium and magnesium accumulation gene CMC1.
[0037] The present invention uses map-based cloning technology, further locates the BC4F2 population of PA64s and 93-11, and combines gene annotation, gene sequencing and transcriptional expression analysis to determine the calcium and magnesium accumulation gene CMC1, and identifies the gene function through transgenic knockout and overexpression experiments. The cloning and application of the CMC1 gene provide a theoretical basis and basic materials for cultivating rice varieties enriched with beneficial nutrient elements, and are of great significance to the breeding practice of improving rice quality.
[0038] In summary, the CMC1 gene can effectively change the calcium and magnesium accumulation levels at different growth stages of rice. This gene can effectively promote the transport of calcium and magnesium from the roots to the above-ground parts, thereby regulating the calcium and magnesium contents in rice grains. The cloning and knockout application of this gene can lay a foundation for studying the molecular mechanism of calcium and magnesium accumulation in rice grains, and provide guidance for breeding and production aiming at improving rice quality.
[0039] It should be noted that: The currently known rice genes related to calcium and magnesium accumulation are mainly transport proteins or channel proteins that directly transport calcium and magnesium ions. Their chromosomal loci are different from those of the CMC1 gene of the present invention. Brief Description of the Drawings
[0040] The following further elaborates on the specific implementation manners of the present invention in conjunction with the drawings.
[0041] Figure 1 is the distribution of QTL of magnesium content in rice grains on the chromosome;
[0042] Figure 2 is the further location using the BC4F2 segregation population of PA64s and 93-11 consisting of 4904 individual plants; * indicates a significant difference at the 0.01 < P < 0.05 level by t-test compared with 93-11;
[0043] Figure 3 is the transcriptional expression analysis of 3 ion-binding transport-related genes (CMC1, CMC2, CMC3) in the young panicles of the parents; the values represent the mean and standard deviation of biological replicates; ** indicates a highly significant level at the 0.001 < P < 0.01 level by t-test;
[0044] Figure 4 is the difference in the promoters of the CMC1 gene between 93-11 and PA64s;
[0045] Figure 5It is a schematic diagram of the vector and transgenic identification. (A) CRISPR / Cas9-MH-CMC1 knockout vector. (B) pCAMBIA1300-UBi-CMC1 overexpression vector. (C) Sequencing sequences near the editing sites of wild-type and gene knockout plants. (D) Relative expression levels of the CMC1 gene in Nipponbare (NPB), mutants (CMC1-CR), and overexpression lines (CMC1-OE-1, CMC1-OE-2). Values represent the mean and standard deviation of three biological replicates; * indicates a significant difference at the 0.01 < P < 0.05 level by t-test, and ** indicates a highly significant difference at the 0.001 < P < 0.01 level by t-test;
[0046] Figure 6 It is the calcium and magnesium contents in the grains of Nipponbare, knockout mutants, and overexpression plants. Calcium content (A) and magnesium content (B) in the grains of Nipponbare NPB, mutant plants CMC1-CR, and overexpression plants CMC1-OE; Values represent the mean and standard deviation of three biological replicates; * indicates a significant difference at the 0.01 < P < 0.05 level by t-test, and ** indicates a highly significant difference at the 0.001 < P < 0.01 level by t-test. Specific implementation manners
[0047] The present invention will be further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:
[0048] Example 1: QTL mapping and candidate gene determination
[0049] 1. Rice materials
[0050] Indica rice varieties are (Oryza sativa L. indica) "93-11" and "PA64s". A recombinant inbred line population (RIL) was constructed with 93-11 and PA64s as parents, and a BC4F2 segregating population obtained by backcrossing and selfing PA64s with 93-11.
[0051] 2. Further mapping of qCMC1
[0052] Previously, the parental indica types (93-11) and indica types (PA64s), as well as the recombinant inbred line (RIL) population constructed with 93-11 and PA64s as parents, were planted in two environments in Hangzhou and Lingshui. QTL analysis was performed on the magnesium content of the grains of the RIL populations in Hangzhou and Lingshui, and a total of 8 QTL loci were detected ( Figure 1The enhancing genes all come from PA64s; qCMC1 in the same region of rice chromosome 1 can be detected in both Hangzhou and Lingshui (QTL mapping of phenotypic data in Hangzhou and Lingshui was performed using the multi-region mapping method of MultiQTL software), indicating that qCMC1 is less affected by the environment, so qCMC1 was studied.
[0053] To clarify the specific gene regulating rice grain magnesium content within this interval, this invention further localized qCMC1. PA64s was crossed with 93-11 to obtain F1, which was then backcrossed with 93-11 for 3 generations and self-crossed for 1 generation to obtain the BC4F2 segregating population. Insertion-deletion (INDEL) markers L1 and L6 (Table 1) were used to screen this segregating population, from which exchange plants (plants with different genotypes on both sides of the marker) were selected. Four new INDEL markers L2–L5 (Table 1) were then developed between L1 and L6. Combining the genotype data and grain magnesium content phenotypic data of the recombinant plants, qCMC1 was finally further localized to an approximately 381 kb interval between markers L4 and L5. Figure 2 ).
[0054] Table 1. INDEL markers for further positioning the development of qCMC1
[0055]
[0056]
[0057] 3. Gene prediction and comparative analysis:
[0058] Annotated genes related to ion binding and transport within a 381kb region were screened, and three genes, CMC1, CMC2, and CMC3, met the screening criteria. Combined with gene transcriptional expression level analysis, it was found that the expression level of CMC1 differed significantly between the 93-11 and PA64s spikelets. Figure 3 The expression levels of CMC2 and CMC3 in the young spikelets of the parental lines 93-11 and PA64s showed no significant difference. Figure 3 Furthermore, gene sequencing revealed an INDEL difference between the CMC1 gene promoter region at 93-11 and PA64s. Figure 4 Based on the above results, CMC1 was ultimately selected as the candidate gene.
[0059] Example 2: Plant Transformation and Functional Analysis
[0060] 1. Obtaining CMC1 gene knockout mutants
[0061] CMC1 was knocked out using the CRISPR / Cas9-MH gene editing vector (provided by Professor Liu Yaoguang's research group at South China Agricultural University). The sequence ATTAGGGCAG AACCCCACTG in the CDS region of the CMC1 gene was selected as the editing target site (i.e., the editing target sequence located in the exons of the CMC1 gene). The primer sequences for vector construction are as follows:
[0062] CMC1-sgRNA-F:GGCATTAGGG CAGAACCCCA CTG
[0063] CMC1-sgRNA-R:AAACCAGTGG GGTTCTGCCC TAA
[0064] FR-F:CTCCGTTTTA CCTGTGGAAT CG
[0065] FR-R:CGGAGGAAAA TTCCATCCAC
[0066] B1-F:TTCAGAGGTCT CTCTCGCACT GGAATCGGCA GCAAAGG
[0067] B1-R:AGCGTGGGTCTCGTCAGGGT CCATCCACTCCAAGCTC
[0068] SP1: CCCGACATAG ATGCAATAAC TTC
[0069] SP2:GCGCGGTGTC ATCTATGTTA CT
[0070] CMC1 gene knockout vector construction steps:
[0071] Preparation of target adapters: Take 10 μl of each of CMC1-sgRNA-F and CMC1-sgRNA-R primers and put them into 80 μl of water. Incubate at 94°C for 1 minute and cool to room temperature to form primer dimers.
[0072] sgRNA expression cassette preparation reaction system: 1 μl U3 plasmid (provided by Liu Yaoguang's research group at South China Agricultural University); 1 μl target adapter; 0.5 μl restriction endonuclease BsaI (NEB); 0.5 μl T4 ligase (NEB); 1 μl T4 buffer; 6 μl lddH2O.
[0073] sgRNA expression cassette preparation reaction procedure: (1) 37℃, 5 minutes; (2) 20℃, 5 minutes; repeat steps (1)-(2) for 7 cycles.
[0074] The first round of sgRNA expression cassette PCR reaction system consisted of: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl sgRNA expression cassette; 1 μl each of primers FR-F and FR-R; and 21 μl ddH2O.
[0075] The first round of amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 25 cycles.
[0076] The second-round amplification sgRNA expression cassette PCR reaction system consisted of: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl of the first-round amplification product; 1 μl each of primers B1-F and B1-R; and 21 μl ddH2O.
[0077] The second round of amplification procedure is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 25 cycles.
[0078] The sgRNA and CRISPR / Cas9-MH gene editing vector were digested with restriction endonuclease BsaI at 37°C for 15 minutes. The digestion reaction system consisted of: 1 μl of the second-round amplified sgRNA expression cassette; 1 μl of CRISPR / Cas9-MH plasmid; 0.5 μl of restriction endonuclease BsaI (NEB); and 12.5 μl of ddH2O.
[0079] Add 0.5 μl of T4 ligase and 1.7 μl of T4 buffer to the product and perform a ligation-cleavage reaction. The reaction program is as follows: (1) 37℃, 5 minutes; (2) 10℃, 5 minutes; (3) 20℃, 5 minutes; (4) 12℃, hold. Repeat steps (1)-(3) for 20 cycles.
[0080] The above reaction products were transformed into E. coli cells, and the transformed single colonies were identified by PCR. The reaction system was as follows: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); single colonies picked; 0.2 μl each of primers SP1 and SP2; 4.6 μl ddH2O.
[0081] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 60℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.
[0082] Single colonies containing the CMC1 gene-specific target sequence were screened using primer SP2 sequencing, and the plasmid extracted was the desired recombinant knockout vector CRISPR / Cas9-MH-CMC1.
[0083] CRISPR / Cas9-MH-CMC1, with a CMC1-specific target site introduced, was transformed into rice (Nipponbare). The sequences at both ends of the target site were amplified using knockout identification primers, followed by sequencing identification.
[0084] The knockout identification primer sequences are as follows:
[0085] CMC1-CRISPR-F:ATAAGTGCCC TAGAGGTAAA TTGTTTG
[0086] CMC1-CRISPR-R:TCACTTGGCC ATCATCACCT T
[0087] PCR reaction system for identifying mutant transgenic plants: 5 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers CMC1-CRISPR-F and CMC1-CRISPR-R; 2.6 μl lddH2O.
[0088] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 60℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.
[0089] By comparing with Seq ID No:1, CMC1 gene knockout mutants were obtained. All six gene knockout mutants obtained carried a single-base insertion mutation. Figure 5 C), therefore, the nucleotide sequence of the gene knockout mutant is shown in Seq ID No: 4. Using CRISPR / Cas9 vector identification primers, plants without the Cas9 tag in the offspring were screened to obtain stably inherited mutant rice.
[0090] PCR reaction system for Cas9 tag identification of mutant transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers SP1 and SP2; 2.6 μl ddH2O.
[0091] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 60℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.
[0092] 2. Obtaining CMC1 gene overexpression lines
[0093] The CDS sequence (Seq ID No: 2) of the CMC1 gene was amplified and ligated between the KpnI and SacI molecules in the vector pCAMBIA1300-UBi (provided by Aibiv Biotechnology Co., Ltd.) to obtain the pCAMBIA1300-UBi-CMC1 fusion expression vector. The correctly sequenced plasmid was transformed into rice (Nipponbare), and two overexpressing transgenic plants were obtained by PCR and sequencing. Figure 5 D). The primer sequences involved are as follows:
[0094] CMC1-OVER-F: CTCACCATGG ATCCGGTACC ATGGCGGACC AGCTCACC
[0095] CMC1-OVER-R: TGTTACTTCT GCAGGAGCTC CTTGGCCATC ATCACCTTCA C
[0096] Ubi-F: GCTCGGAGAA GACGATGGTG
[0097] PCR reaction system for CDS sequence amplification of CMC1 gene: 25 μl 2×Phanta Flash Master Mix (Nanjing Novozymes); 2 μl cDNA obtained by reverse transcription of total RNA from 93-11 aerial parts; 1 μl each of primers CMC1-OVER-F and CMC1-OVER-R; 21 μl ddH2O.
[0098] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 98℃, 10 seconds; (3) 58℃, 5 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.
[0099] PCR reaction system for identification of overexpressing transgenic plants: 5 μl 2×Rapid Taq Master Mix (Nanjing Novozymes); 2 μl DNA from transgenic plant leaves; 0.2 μl each of primers Ubi-F and CMC1-OVER-R; 2.6 μl ddH2O.
[0100] The amplification program is as follows: (1) 95℃, 3 minutes; (2) 95℃, 15 seconds; (3) 58℃, 15 seconds; (4) 72℃, 20 seconds; (5) 72℃, 5 minutes; (6) 12℃, hold; repeat steps (2)-(4) for 35 cycles.
[0101] 3. Determination of CMC1 gene knockout mutant and overexpression lines expression levels and determination of calcium and magnesium content in grains.
[0102] The transcriptional expression level of the CMC1 gene in each transgenic plant was measured, confirming a significant difference compared to the wild type. Figure 5 D). These transgenic plants were planted in the Hangzhou transgenic nursery, and the calcium and magnesium contents of the grains of wild-type Nipponbare, knockout mutants, and overexpression plants were measured at maturity (i.e., from late waxy maturity to early full maturity, when more than 95% of the grains have yellowed glumes and more than 2 / 3 of the rachis have yellowed). The determination methods were based on atomic fluorescence spectrophotometry in the national standard for the determination of calcium in food (GB 5009.92-2016) and inductively coupled plasma mass spectrometry in the national standard for the determination of magnesium in food (GB5009.241-2017).
[0103] The results are as follows:
[0104] Compared with wild-type Nipponbare, the knockout mutant brown rice showed significantly lower calcium and magnesium content, while the overexpression line showed significantly higher calcium and magnesium content. Figure 6 This indicates that CMC1 is a candidate gene for controlling calcium and magnesium accumulation in rice grains.
[0105] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. Rice calcium and magnesium accumulation genes CMC1 Its uses are characterized by: Upregulates the accumulation of calcium and magnesium in rice grains; genes CMC1 The nucleotide sequence is shown in Seq ID No:
1.
2. Rice calcium and magnesium accumulation genes CMC1 Its uses are characterized by: Transforming rice cells with a knockout vector and then cultivating the transformed rice cells into plants resulted in a significant reduction in calcium and magnesium content in the rice grains. Transforming rice cells with an overexpression vector and then cultivating the transformed rice cells into plants resulted in a significant increase in the calcium and magnesium content of rice grains. Gene CMC1 The nucleotide sequence is shown in Seq ID No:
1.
3. The gene according to claim 1 or 2 CMC1 Its uses are characterized by: Gene CMC1 The cDNA nucleotide sequence is shown in Seq ID No:
2.
4. A method for regulating the accumulation of calcium and magnesium in rice grains, characterized in that: Knock out the vector CRISPR / Cas9-MH- CMC1 Rice cells were transformed to obtain knockout mutants, and rice materials without Cas9 markers were screened in the progeny. The calcium and magnesium content in the rice grains of the bred rice was reduced. The overexpression vector pCAMBIA1300-UBi- CMC1 Transforming rice cells resulted in increased calcium and magnesium content in the cultivated rice grains. Gene CMC1 The nucleotide sequence is shown in Seq ID No: 1; Gene CMC1 The knockout vector CRISPR / Cas9-MH- CMC1 Using CRISPR / Cas9-MH as a base vector, the gene located in CMC1 The exon editing target sequence is inserted between the BsaI-BsaI restriction sites of the base vector.