Osadr1 and ostir genes for enhancing broad-spectrum disease resistance in rice and application thereof

By overexpressing the OsADR1 and OsTIR genes in rice, the problem of rice varieties being breached by rice blast fungus and sheath blight fungus after widespread planting was solved, achieving highly efficient enhanced resistance to rice blast and sheath blight, and providing a new approach to disease-resistant breeding.

WO2026086115A1PCT designated stage Publication Date: 2026-04-30CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Filing Date
2025-04-10
Publication Date
2026-04-30

AI Technical Summary

Technical Problem

Existing rice varieties are susceptible to infection by rice blast fungus and sheath blight fungus after widespread planting, and lack broad-spectrum disease resistance gene targets.

Method used

By overexpressing the OsADR1 and OsTIR genes in rice, these genes can be introduced into rice plants using Agrobacterium-mediated transformation or gene editing technology to enhance their resistance to rice blast and sheath blight.

Benefits of technology

It significantly improved the resistance of rice to rice blast and sheath blight, provided new breeding targets, and promoted the cultivation of disease-resistant plant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025088176-FTAPPB-I100001
    Figure PCTCN2025088176-FTAPPB-I100001
  • Figure PCTCN2025088176-FTAPPB-I100002
    Figure PCTCN2025088176-FTAPPB-I100002
  • Figure PCTCN2025088176-FTAPPB-I100003
    Figure PCTCN2025088176-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a use of genes OsADR1 and OsTIR in enhancing broad-spectrum disease resistance in rice. The genes OsADR1 and OsTIR can enhance resistance in rice against diseases such as rice blast and sheath blight, and thus play a valuable role in the development of new disease-resistant rice varieties.
Need to check novelty before this filing date? Find Prior Art

Description

OsADR1 and OsTIR genes for enhancing broad-spectrum disease resistance in rice and their applications Technical Field

[0001] This invention belongs to the field of agricultural biotechnology, specifically, it relates to the use of genes OsADR1 and OsTIR in improving the broad-spectrum disease resistance of rice and creating disease-resistant rice germplasm resources. Background Technology

[0002] Rice blast pathogens evolve rapidly in nature. After a resistant variety has been widely planted for 3-5 years, some physiological races of rice blast will eventually break through the rice's immune defenses, leading to susceptibility. Therefore, elucidating the immune signaling pathways of broad-spectrum resistant NLRs against rice blast can provide new targets for rice molecular breeding.

[0003] In the article "Grant JJ, Chini A, Basu D, Loake GJ. Targeted activation tagging of the Arabidopsis NBS-LRR gene, ADR1, conveys resistance to virulent pathogens. Mol Plant Microbe Interact. 8, 669-80 (2003)", the authors used activation tags to mutagenesis transgenic Arabidopsis lines containing a chimeric PR1::luciferase (LUC) reporter gene. Cell lines were screened using high-throughput LUC imaging, and a mutant exhibiting enhanced PR1 gene expression, activated disease resistance (adr)1, was identified. This plant showed resistance to the biotic pathogens *Peronospora parasitica* and *Erysiphe cichoracearum*, but not to the necrotic fungus *Botrytis cinerea*. In the article "Bonardi V, Tang S, Stallmann A, Roberts M, Cherkis K, Dangl JL. Expanded functions for a family of plant intracellular immune receptors beyond specific recognition of pathogen effectors. Proc Natl Acad Sci US A. 108, 16463-8 (2011)", the adr1 triple mutant showed a more susceptible phenotype to Hpa Emco5 and Pto DC3000 compared to the wild type or single mutant. These two articles indicate that ADR1 in Arabidopsis thaliana is involved in disease resistance, but the three ADR1s in Arabidopsis thaliana exhibit functional redundancy in basal resistance.

[0004] In the articles “Li X, Clarke JD, Zhang Y, Dong X. Activation of an EDS1-mediated R-gene pathway in the snc1 mutant leads to constitutive, NPR1-independent pathogen resistance. Mol Plant Microbe Interact. 14, 1131-9 (2001)” and “Jacob P, Hige J, Song L, Bayless A, Russ D, Bonardi V, El Kasmi F, Wünsch L, Yang Y, Fitzpatrick CR, McKinney BJ, Nishimura MT, Grant MR, Dangl JL. Broader functions of TIR domains in Arabidopsis immunity. Proc Natl Acad Sci US A. 14, e2220921120 (2023)”, the authors mentioned that the TNL proteins SNC1 and SADR1, which contain TIR domains, are involved in Arabidopsis disease resistance. In the article "Nishimura MT, Anderson RG, Cherkis KA, Law TF, Liu QL, Machius M, Nimchuk ZL, Yang L, Chung EH, El Kasmi F, Hyunh M, Osborne Nishimura E, Sondek JE, Dangl JL. TIR-only protein RBA1 recognizes a pathogen effector to regulate cell death in Arabidopsis. Proc Natl Acad Sci US A.7,E2053-E2062(2017)" and "Wan L, Essuman K, Anderson RG, Sasaki Y, Monteiro F, Chung EH, Osborne Nishimura E, DiAntonio A, Milbrandt J, Dangl JL, Nishimura MT. TIR domains of plant immune receptors are NAD +The study, "Claving enzymes that promote cell death. Science 365, 799-803 (2019)," indicates that TIR-only proteins RBA1 and BdTIR can mediate cell death in plants, but it does not report whether TIR-only proteins are involved in plant disease resistance. Summary of the Invention

[0005] In further studies on the pathogenesis of diseases such as rice blast and sheath blight, we identified several genes that can effectively resist rice blast pathogens such as TH12 and sheath blight pathogens such as RH-9, including the genes OsADR1 and OsTIR. Overexpression of the genes OsADR1 and OsTIR can effectively improve the resistance of rice to diseases such as rice blast, sheath blight, false smut, and / or bacterial blight. Based on this, the present invention includes the following technical solutions.

[0006] This invention provides the use of genes OsADR1 (NCBI number LOC4352659 or XP_015619838) and OsTIR (NCBI number LOC4343631 or XP_015646306) in improving plant disease resistance.

[0007] Specifically, the disease resistance refers to resistance to plant diseases caused by plant pathogens such as rice blast fungus and / or sheath blight fungus.

[0008] In one specific embodiment, the rice blast fungus (Magnaporthe.oryzae) is TH12, and the sheath blight fungus is Rhizoctonia solani Kühn, for example, RH-9.

[0009] The aforementioned plants can be monocotyledonous plants, preferably grass crops, selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum.

[0010] In one embodiment, the crop is rice, and correspondingly, the plant disease is rice blast, sheath blight, rice false smut, and / or bacterial leaf blight, etc.

[0011] Preferably, the above-mentioned uses are to use the genes OsADR1 and OsTIR for phytoremediation, to improve plant disease resistance, or to breed disease-resistant plant varieties.

[0012] In one specific implementation, the above-mentioned uses are to perform plant repair, improve plant disease resistance, or cultivate disease-resistant plant varieties by overexpressing the genes OsADR1 and / or OsTIR in plants.

[0013] Optionally, the genes OsADR1 and / or OsTIR are overexpressed in plants such as rice using the following methods:

[0014] A. Cloning the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, transforming plants using Agrobacterium-mediated transformation to obtain transgenic plants overexpressing the genes OsADR1 and / or OsTIR; and / or

[0015] B. By cloning the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence into a plant chromosome using gene editing technology, obtaining transgenic plants that overexpress the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence; and / or

[0016] C. Place the existing gene OsADR1 or its coding sequence and / or OsTIR or its coding sequence in the plant genome, such as rice, under the regulation of a functionally enhanced promoter, such as the 35S promoter or the Ubi promoter.

[0017] Optionally, the gene editing technology described in step A may be selected from the following group: pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, pTF102;

[0018] The Agrobacterium species mentioned are, for example, Agrobacterium tumefaciens, Agrobacterium EHA105, and Agrobacterium GV3101. For example, the above-mentioned recombinant plasmids are transferred into Agrobacterium strains using the freeze-thaw method to form engineered microorganisms for transforming plant plants.

[0019] Preferably, the plant is rice, such as TP309 or ZH11.

[0020] This invention identified the role of OsADR1 and OsTIR in the resistance of rice to the fungal diseases rice blast and sheath blight. Using the field inoculation method for rice blast and sheath blight reported in existing literature, transgenic lines containing knockout and overexpression of the OsADR1 and OsTIR genes were inoculated, and their resistance was observed. The experimental results showed that OsADR1 overexpressing lines in rice exhibited strong resistance to rice blast race TH12 after inoculation. Simultaneously, OsADR1 overexpressing lines showed resistance to sheath blight, indicating the key role of OsADR1 in the fight against fungal diseases. Overexpression lines of the TIR-only protein OsTIR in rice also showed strong resistance to rice blast race TH12.

[0021] Given the important role of OsADR1 and OsTIR in rice disease resistance, they can serve as new breeding targets. They are of great value for repairing agronomic traits of plants infected by rice blast fungus and / or sheath blight fungus, improving plant disease resistance, or breeding disease-resistant plant varieties. Attached Figure Description

[0022] Figure 1 shows the autoimmune phenotype of rod1 suppressed by gene srd3. (A) Plant morphology of TP309, rod1, and srd3. The srd3 mutant plants exhibit a growth phenotype similar to wild-type TP309. Scale bar, 10 cm. (B) Leaf phenotype of TP309, rod1, and srd3. The leaves of the srd3 mutant do not show a lesion-like phenotype. Scale bar, 1 cm. (C) DAB staining of TP309, rod1, and srd3. DAB staining shows that the accumulation of H2O2 in the leaves of the srd3 mutant is comparable to that of TP309 and lower than that of rod1. Scale bar, 1 cm. (D) srd3 restores rod1's resistance to rice blast. TP309, rod1, and srd3 were inoculated with rice blast fungus (TH12), and the severity of disease was assessed seven days after inoculation. The growth of rice blast fungus MoPOT2 inoculated with rice leaves was calculated using qRT-PCR with rice Ubiquitin as an internal control. Data are presented as mean ± sd (n = 3, independent samples). Two-tailed t-tests were used for data analysis, with asterisks indicating statistical significance (**P < 0.01). Scale bar, 1 cm.

[0023] Figure 2 shows the map-based cloning of the SRD3 gene. (A) Agarose gel electrophoresis of the srd3 gene linkage markers. (B) Fine map-based cloning of srd3. SRD3 was initially located in a 310-kb region on chromosome 12. Further localization using a localization population of 1220 mutant individuals, along with novel INDEL (insertion / deletion) and CAPS (enzyme-amplified polymorphic sequence) markers, narrowed the SRD3 site to a 14-kb region. (C) Comparison of the DNA sequences of rod1 and srd3 within the 14-kb region revealed a SNP in the first exon of LOC_Os12g39620, resulting in a mutation from A to T at the 30th amino acid position of OsADR1.

[0024] Figure 3 shows that the genetically complementary lines suppressed the autoimmune phenotype of rod1. (A) OsADR1 knockout plant lines in the rod1 background. Target sites were selected at the first and second exons of OsADR1, representing two loss-of-function lines of OsADR1. (B) Plant morphology of TP309, rod1, srd3, OsADR1-KO / rod1, and complementary lines. Scale bar, 10 cm. (C) Leaf phenotype of TP309, rod1, srd3, OsADR1-KO / rod1, and complementary lines. Scale bar, 1 cm. (D) DAB staining of TP309, rod1, srd3, OsADR1-KO / rod1, and complementary lines. Scale bar, 1 cm.

[0025] Figure 4 shows the positive regulation of rice disease resistance by the OsADR1 gene. (A) Disease phenotypes of representative lines TP309, OsADR1-KO, and OsADR1-OE 7 days after inoculation with rice blast (race TH12). The growth of the rice blast fungus MoPOT2 (the housekeeping gene for rice blast) was calculated by qRT-PCR using rice Ubiquitin as an internal control. Data are mean ± sd (n = 3, biologically independent samples). Scale bar, 1 cm. (B) Disease phenotypes of representative lines TP309, OsADR1-KO, and OsADR1-OE 7 days after inoculation with sheath blight (R. solani AG1-IA isolate RH-9). Scale bar, 1 cm.

[0026] Figure 5 shows that the autoimmune phenotype of rod1 depends on the TIR-only protein OsTIR. Specifically, (A)srd18 has a G-to-A mutation at position 296 of OsTIR (LOC_Os07g37950), resulting in Gly99-Asp(OsTIR)... G99D (A) Mutation. (B) OsTIR knockout plant lines in rod1 background. (C) Plant morphology of TP309, rod1, srd18, and OsTIR-KO / rod1. Scale bar, 10cm. (D) Leaf phenotype of TP309, rod1, srd18, and OsTIR-KO / rod1. Scale bar, 1cm. (E) DAB staining of TP309, rod1, srd18, and OsTIR-KO / rod1. Scale bar, 1cm.

[0027] Figure 6 shows the positive regulation of rice disease resistance by the OsTIR gene. Among them, the disease phenotypes of representative lines TP309, OsTIR-KO, and OsTIR-OE were observed 7 days after inoculation with rice blast (race TH12).

[0028] Figure 7 shows the structural maps of the recombinant plasmids that overexpress the genes OsADR1 and OsTIR, respectively. Among them, (A) is the map of plasmid pCambia1300-OsADR1; (B) is the map of plasmid pUN1301-OsTIR-GFP. Detailed Implementation

[0029] Plants are constantly threatened by various pathogenic microorganisms (fungi, bacteria, viruses, and nematodes, etc.) throughout their entire life cycle, causing reduced crop yields and lower quality, posing a major threat to agricultural production worldwide. To control agricultural pests and diseases, my country uses large quantities of pesticides annually, placing enormous pressure on the ecological environment and public health. Breeding pest-resistant varieties is a crucial means of green pest control in crops, and research on plant immunity provides a theoretical basis and significant value for production practices.

[0030] In the research on the discovery and breeding value evaluation of new disease resistance genes in grain crops (a major project of the National Science and Technology Innovation 2030 Program of the Ministry of Agriculture and Rural Affairs, project number: 2023ZD0407001), our research group identified some genes that play an important role in maintaining the disease resistance of rice. For example, we found that the genes OsADR1 and OsTIR can promote the broad-spectrum disease resistance of rice plants, including resistance to diseases such as rice blast and sheath blight.

[0031] The protein OsADR1 encoded by the gene OsADR1 (NCBI number LOC4352659 or XP_015619838) belongs to the NLR protein family and contains 859 amino acids.

[0032] The protein OsTIR encoded by the gene OsTIR (NCBI number LOC4343631 or XP_015646306) contains 229 amino acids.

[0033] Although this invention has tested the function of genes OsADR1 and OsTIR in rice to resist infection by rice blast fungus and sheath blight fungus, those skilled in the art can expect that genes OsADR1 and OsTIR can also be extended to other gramineous crops such as wheat, corn, soybean, barley, oats, rye, and sorghum to improve the plant's resistance to infection by rice blast fungus and / or sheath blight fungus. Therefore, genes OsADR1 and OsTIR can also be used in disease resistance breeding to create disease-resistant plant germplasm resources.

[0034] To achieve the expression of genes OsADR1 and OsTIR in plants such as rice, gene expression cassettes or expression constructs can be constructed using genes OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence as exogenous genes. These expression cassettes / expression constructs can then be operatively linked to plasmid vectors through subcloning to obtain recombinant plasmids. The recombinant plasmids can then be transformed into host cells to obtain transformants, i.e., genetically engineered bacteria or recombinant bacteria, or they can be transformed into plants through Agrobacterium-mediated transformation to obtain transgenic plants.

[0035] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0036] As used herein, the terms “(disease resistance) improved,” “enhanced,” or “strengthened” can mean an increase of at least 10% relative to a reference level (e.g., wild-type rice), such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times relative to a reference level.

[0037] As used herein, the term "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express the target genes OsADR1 and OsTIR. Typically, it includes the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; additionally, it may optionally include signal peptide encoding sequences such as mCherry (red fluorescent protein), GFP (green fluorescent protein), or YFP (yellow fluorescent protein); these elements are operatively linked.

[0038] As used herein, an "expression construct" or "expression building block" refers to a recombinant DNA molecule containing the intended gene OsADR1 or its coding region sequence or OsTIR or its coding region sequence, which may contain one or more gene expression cassettes. The "construct" is typically contained within an expression vector (plasmid vector).

[0039] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0040] As used herein, “operationally linked” or “operationally connected” refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene OsADR1 or OsTIR, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby the promoter region is “operationally linked” to the nucleic acid sequence.

[0041] The nucleic acid constructs described in this invention can be manipulated in various ways to ensure the expression of the genes OsADR1 or OsTIR. The nucleic acid constructs can be manipulated according to the different expression vectors or requirements before insertion into the vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

[0042] In some embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. The gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence can be cloned into many types of vectors, such as plasmids, phage particles, phage derivatives, animal viruses, and granules. Cloning vectors can be used to provide the coding sequence of the protein or polypeptide of the present invention. Expression vectors can be provided to cells in the form of bacterial or viral vectors. Expression of the gene OsADR1 or OsTIR is typically achieved by operably linking the OsADR1 or OsTIR nucleic acid sequence to a promoter and incorporating the construct into an expression vector. This vector is suitable for replication and integration into eukaryotic cells. Typical expression vectors contain expression control sequences that can be used to regulate the expression of the desired nucleic acid sequence.

[0043] Gene knock-in vectors can be used to integrate the gene OsADR1 or its coding sequence and / or OsTIR or its coding sequence described herein into a region of interest in the host genome. Typically, in addition to the polynucleotide sequence described herein, gene knock-in vectors may also contain 5' and 3' homologous arms required for genomic homologous recombination. In some embodiments, the nucleic acid constructs described herein contain 5' homologous arms, the polynucleotide sequence described herein, and 3' homologous arms. When using gene knock-in vectors, CRISPR / Cas9 technology can be used simultaneously to homologously recombine the polynucleotide sequence into the site of interest. CRISPR / Cas9 technology guides the Cas9 nuclease to modify the genome at the insertion site by designing guide RNAs targeting the target gene, resulting in increased homologous recombination efficiency in the modified gene region, thus homologously recombinating the target gene OsADR1 or OsTIR sequence fragment contained in the gene knock-in vector into the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as the Cas9 nuclease, are well known in the art.

[0044] Methods well known to those skilled in the art can be used to construct nucleic acid constructs. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, and in vivo recombination techniques. The DNA sequence can be efficiently ligated to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: the lac or trp promoter of *E. coli*; the PL promoter of *λ* phage; eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, early and late SV40 promoters, LTRs of retroviruses, and other known promoters that control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. Furthermore, the expression vector preferably contains one or more selective marker genes to provide phenotypic traits for selecting host cells for transformation, such as dihydrofolate reductase, neomycin resistance, and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline, ampicillin resistance, or chloramphenicol for *E. coli*, *Agrobacterium*, etc.

[0045] When the polynucleotides of this invention are expressed in higher eukaryotic cells, the insertion of an enhancer sequence into the vector will enhance transcription. Enhancers are cis-acting factors of DNA, typically approximately 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0046] Vectors containing appropriate DNA sequences and appropriate promoters or control sequences can be used to transform appropriate host cells so that they can express proteins.

[0047] When constructing transgenic plants using the traditional Agrobacterium-mediated transformation method, the methods for constructing transgenic plants include:

[0048] 1) Provide Agrobacterium carrying an expression vector, said expression vector containing the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence;

[0049] 2) Contact plant cells, tissues, or organs with Agrobacterium in step 1) to transfer the coding sequence into the plant cells and integrate it into the chromosomes of the plant cells;

[0050] 3) Select plant cells or tissues into which the coding sequence has been introduced; and

[0051] 4) Regenerate plants from the plant cells or tissues in step 3).

[0052] In our study, we identified a class of RNL OsADR1 and TIR-only proteins, OsTIR, involved in the immune signaling pathway in rice. We constructed plants overexpressing the OsADR1 promoter and Ubiquitin-driven OsTIR overexpression lines, finding that these lines exhibited strong resistance to rice blast. This will provide new insights for breeding novel disease-resistant rice varieties.

[0053] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0054] Example

[0055] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0056] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0057] The molecular biology experiments in this embodiment, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were both performed according to Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments if necessary.

[0058] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0059] The primer synthesis and gene sequencing in this embodiment were commissioned to Shanghai Bioscient Biotechnology Co., Ltd.

[0060] The molecular biology methods and transgenic plant construction methods, including the construction of OsADR1 and OsTIR overexpression recombinant plasmids and gene editing technology, in the embodiments are operated using techniques commonly used in the field.

[0061] Experimental materials include:

[0062] Wild-type rice variety: TP309

[0063] Rice blast fungus (M. oryzae): TH12

[0064] Rhizoctonia solani Kühn: Highly pathogenic strain RH-9

[0065] rod1 (preserved in this laboratory)

[0066] SRD3 and SRD18 (screened from rod1 mutagenic materials, preserved in our laboratory)

[0067] Transgenic lines (preserved in this laboratory): ROD1-KO / Kasalath, OsADR1::OsADR1 A30T / rod1, OsADR1-KO / rod1, OsADR1-KO / TP309, OsADR1-OE / TP309, OsTIR-KO / rod1, OsTIR-OE / TP309, OsTIR-KO / TP309.

[0068] These rice materials preserved in our laboratory, including plasmids overexpressing genes OsADR1 and OsTIR in the examples, and CRISPR / Cas9 plasmids used for gene editing operations, were constructed and preserved by Professor He Zuhua's research group at the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences. Any unit or individual may obtain these plasmids to verify this invention, but they may not be used for other purposes, including development, scientific research, and teaching, without the permission of the Center for Excellence in Molecular Plant Sciences, Chinese Academy of Sciences.

[0069] Gene mapping population construction: srd3 was crossed with ROD1-KO / Kasalath, and the F2 offspring population was sampled and mapped.

[0070] Some of the PCR primers used in the examples are listed in Table 1.

[0071] Table 1. Some PCR primers used in the examples

[0072] In Table 1, "-F" in the name represents positive; "-R" represents negative.

[0073] Example 1: Map-based cloning of the OsADR1 gene in the rice genome

[0074] In our laboratory, we conducted large-scale EMS and γ-ray mutagenesis on rod1 seeds, screening out plants with the same phenotype and genotype as TP309. Among them, srd3 exhibited plant morphology similar to wild-type TP309, with plant height restored to that of TP309 and no lesion-like spots appearing on the leaves (Figure 1, A and B). DAB staining results showed that the hydrogen peroxide accumulated in rod1 was restored in srd3 to that of wild-type TP309 (Figure 1, C). In addition, srd3 completely restored rod1-mediated resistance to rice blast (Figure 1, D). To clone this gene, we knocked out ROD1 in the indica rice variety Kasalath, which we named ROD1-KO. Kasa We crossed this material with srd3, and used the F2 population for gene mapping. First, we screened for SSR molecular markers evenly distributed on the 12 rice chromosomes, identifying 198 primer pairs that differed between srd3 and Kasalath. We selected approximately 20 spotted individuals and 20 unspotted individuals from the F2 population as spotted and unspotted pools for initial mapping. We found that at positions SSR12-15 and SSR12-20 on chromosome 12, all three spotted pools showed the banding pattern of the parental Kasalath, while the unspotted pool showed a heterozygous banding pattern, indicating linkage of srd3 at this position (Figure 2A). Next, we further expanded the mapping population, using approximately 1200 phenotypic individuals, to pinpoint the gene within a 14kb range (Figure 2B). There are two ORFs in this region. We designed primers to sequence the entire 14kb region and found that the base at the 88th bp of the LOC_Os12g39620 gene was mutated from G to A, which caused the 30th amino acid of the gene to be mutated from alanine to threonine (C in Figure 2).

[0075] Example 2: Construction of recombinant plasmids for overexpressing genes OsADR1 and OsTIR

[0076] The construction of the OsADR1 / OsTIR gene overexpression vector includes the following steps.

[0077] 1. Amplification of the target sequence

[0078] OsADR1 was used with genomic DNA as a template, and OsTIR was used with genomic cDNA as a template. The target fragments were amplified using high-fidelity DNA polymerase KOD FX (TOYOBO, Cat#KFX-101), following the PCR system described below:

[0079] Genomic DNA template usage: ~200 ng. Program: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 68℃ extension at 1 kb / min, approximately 35 cycles; 68℃ extension for 10 min; 16℃ for 1 min.

[0080] The primers used include:

[0081] pCambia1300-OsADR1-F:

[0082] AATTCGAGCTCGGTACCGGATATCAGGCCATTTAGCCGA,

[0083] pCambia1300-OsADR1-R:

[0084] GAATTCGATATCAAGCTTGTCTACAAGCCAGTCCAGGTT.

[0085] pUN1301-OsTIR-F:GTCGACTCTAGAGGATCCATGTCGTCCACCGGGCTTTC,

[0086] pUN1301-OsTIR-R:GCCCTTGCTCACGGTACCCAGCCTGGACATGATCA.

[0087] Rice genomic DNA extraction:

[0088] 1) Take a plant leaf about 2cm long and put it in a sampling tube. Add 400μL of TPS buffer and steel balls. Use a ball mill at 40 Hz for 1 min to crush the leaf.

[0089] 2) After a brief centrifugation at 3700 rpm, place it in a 65℃ oven for 30 min-1 h.

[0090] 3) Centrifuge at 3700 rpm for 10 min and collect 200 μL of supernatant.

[0091] 4) Centrifuge at 3700 rpm for 10 min, then take 130 μL and mix with an equal volume of isopropanol.

[0092] 5) Place in a -20℃ refrigerator for about 10 minutes to allow the sediment to settle.

[0093] 6) Centrifuge at 3700 rpm for 10 min and discard the supernatant.

[0094] 7) Add 200 μL of 75% ethanol, centrifuge at 3700 rpm for 5 min, and discard the supernatant.

[0095] 8) Place in an oven to evaporate the ethanol, then add 50 μL of ddH2O to dissolve the DNA.

[0096] TPS buffer

[0097] Extraction of total RNA from rice:

[0098] 1) Take plant leaves into a 2mL tube, add steel balls, freeze with liquid nitrogen, and then crush them using a ball mill.

[0099] 2) Add 1 mL of TRIzol (Thermofisher, 15596018) and shake to mix.

[0100] 3) Let stand at room temperature for 5 minutes, then centrifuge at 12,000 rpm at 4°C for 10 minutes.

[0101] 4) Transfer 800 μL of supernatant to a new 1.5 mL centrifuge tube, add 200 μL of chloroform, and vortex to mix.

[0102] 5) Let it stand at room temperature for 10 minutes to allow it to separate into layers, then centrifuge at 12,000 rpm at 4°C for 10 minutes.

[0103] 6) Pipette 400 μL of supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, invert to mix, incubate at room temperature for 10 min, and then centrifuge at 12000 rpm at 4 °C for 10 min.

[0104] 7) Discard the supernatant and add 1 mL of 75% ethanol to wash the precipitate. Centrifuge at 7500 rpm for 5 min and then discard the supernatant.

[0105] 8) After centrifuging for a few seconds, remove the residual liquid and dry at room temperature for 10 minutes.

[0106] 9) Add 20 μL of DEPC-treated water to dissolve the RNA. Store the RNA sample at -80℃.

[0107] RNA reverse transcription:

[0108] Refer to SuperScript TMIII. Reverse transcription was performed using the First-Strand Synthesis System (Invitrogen, Cat#18080051) reverse transcription kit, with cDNA template used for gene amplification. The specific steps are as follows:

[0109] 1) Prepare the following system:

[0110] 2) After mixing, incubate at 65°C for 5 minutes, then immediately place on ice.

[0111] 3) Add 10 μL of cDNA synthesis reaction solution to the above mixture and mix gently.

[0112] 4) React at 50℃ for 50 min, then stop the reaction at 85℃ for 5 min, and place on ice.

[0113] 5) Add 1 μL of RNase H and react at 37°C for 20 min.

[0114] 6) Store the cDNA at -20℃.

[0115] 2. Purification of PCR products by agarose gel electrophoresis

[0116] Referring to the instructions for the Hlingene agarose gel DNA recovery kit (Hlingene, NG202S), the simplified steps are as follows:

[0117] 1) Separate PCR products by 1% agarose gel electrophoresis. Under UV light, cut out the target band and place it in a 1.5 mL centrifuge tube. Add 300 μL of sol solution to every 0.1 g of gel. Incubate at 65 °C for 10 min, mixing every 2-3 min until the gel is completely dissolved.

[0118] 2) Transfer the above solution to an adsorption tube, let it stand for 1 minute, then centrifuge at 12000 rpm for 1 minute and discard the waste liquid.

[0119] 3) Add 500 μL of WB rinsing solution (with anhydrous ethanol), centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0120] 4) Repeat step 3).

[0121] 5) After 2 minutes of air-free centrifugation at 12,000 rpm, transfer the adsorption column to a new centrifuge tube.

[0122] 6) Add 50 μL of ddH2O preheated at 65℃ to the adsorption column, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min.

[0123] 3. Homologous recombination of linearized vectors and PCR products

[0124] 1) Vector enzyme digestion

[0125] The pUN1301-GFP plasmid digestion system is as follows:

[0126] After gently mixing and briefly centrifuging, incubate in a 37°C water bath for 30-60 minutes.

[0127] The pCambia1300 plasmid digestion system is as follows:

[0128] 2) Recover the enzyme digestion fragments and determine their concentration, according to... The IIOne Step Cloning Kit (Vazyme, Cat#C112-02) instructions are as follows for performing the recombination reaction (20 μL system as follows):

[0129] Recombination reaction system

[0130] Water bath at 37℃ for 30 minutes.

[0131] 4. Escherichia coli competent cell transformation

[0132] 1) Take out the E. coli competent cells Mach1-T1 (Shanghai Weidi Biotechnology Co., Ltd., DL1015M) stored at -80℃ and thaw them on ice.

[0133] 2) Add 1 μL of plasmid or 10 μL of ligation product and place on ice for 30 min.

[0134] 3) Heat shock at 42℃ for 60 seconds, then place on ice for 3 minutes.

[0135] 4) Add 700 μL of liquid LB medium and incubate at 37°C in a shaker for 1 h.

[0136] 5) Spread the mixture onto a screening plate containing the corresponding antibiotic and incubate overnight.

[0137] 5. Plasmid extraction

[0138] Small-scale plasmid extraction:

[0139] Referring to the instructions for the Hlingene plasmid small-scale rapid extraction kit (Hlingene, HDP201-01), the simplified steps are as follows:

[0140] 1) Collect 2 ml of bacteria in a centrifuge tube and centrifuge at 12000 rpm for 1 min.

[0141] 2) Add 250 μL of S1 solution (with RNase A) and mix thoroughly.

[0142] 3) Add 250 μL of S2 solution and gently invert the container 5-6 times to mix. At this point, the solution will become viscous and clear.

[0143] 4) Add 350 μL of S3 solution and immediately invert to mix.

[0144] 5) Centrifuge at 12000 rpm for 10 min, and transfer the supernatant to an adsorption tube.

[0145] 6) Centrifuge at 12000 rpm for 30 seconds to 1 minute, then discard the waste liquid.

[0146] 7) Add 500 μL of WB washing solution (with anhydrous ethanol), centrifuge at 12000 rpm for 1 min, and discard the waste liquid.

[0147] 8) Repeat step 7).

[0148] 9) After 2 minutes of air-free centrifugation at 12000 rpm, transfer the adsorption column to a new centrifuge tube.

[0149] 10) Add 60 μL of ddH2O preheated at 65 °C to the adsorption column, let it stand at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min.

[0150] The spectrum of the recombinant plasmid pCambia1300-OsADR1 obtained by construction is shown in Figure 7A.

[0151] The spectrum of the recombinant plasmid pUN1301-OsTIR-GFP is shown in Figure 7B.

[0152] The functions of genes OsADR1 and OsTIR are verified or characterized in the following examples.

[0153] Example 3: Inoculation with rice blast fungus

[0154] The rice blast fungus was activated by inoculating races onto CM medium and incubating at 28°C (12h light / 12h dark) for 10–12 days. The medium was then rinsed with 0.05% Tween 20 sterile water, and the spore suspension was collected using a glass rod. After filtration through a 40μm filter membrane, the spore concentration was measured under a microscope and finally adjusted to 1×10⁻⁶. 5 Spores / mL are used for inoculation. Approximately 4 weeks after rice transplanting, insert a syringe about 2 cm below the ligule of newly emerging leaves and inject the spore solution until it overflows from the tip of the new leaf. Disease symptoms can be observed 7 days after rice blast inoculation.

[0155] CM culture medium

[0156] Adjust the pH to 6.5 with 10M NaOH, and add ddH2O to bring the total volume to 1L. Add 17.5g of agar powder per liter of culture medium.

[0157] 1000×Trace elements (100mL)

[0158] 1000×Vitamin solution (100mL)

[0159] Methods for statistical analysis of rice blast growth:

[0160] A certain amount of rice leaves infected with rice blast were crushed using liquid nitrogen. 400 μL of extraction buffer (50 mM Tris-Cl, pH 7.5; 20 mM EDTANa2, pH 8.0; 2% Sarcosine; 0.5% SDS; 5 M Urea, 5% Phenol, 0.3 M NaCl) was added and vortexed to mix. 400 μL of a 25:24:1 solution of phenol / chloroform / isoamyl alcohol was added, and the mixture was vigorously vortexed for 10 min. After centrifugation at 14000 rpm for 10 min, the supernatant was transferred to a new 1.5 ml EP tube. An equal volume of isopropanol was added, and the tube was precipitated at -20℃ for 10 min. After centrifugation at 14000 rpm for 10 min, the supernatant was discarded. The precipitate was washed with 1 mL of 75% ethanol, centrifuged at 7500 rpm for 5 min, the supernatant was removed, and the tube was dried at room temperature. Add 40 μL of ddH2O (containing 10 μg / mL RNase) to dissolve the precipitate. Detect the relative content of rice blast fungus DNA using real-time PCR.

[0161] The results are shown in Figures 1, 4, and 6.

[0162] Example 4: Inoculation of *Rhizoctonia solani*

[0163] 1. Take the sclerotia of *Rhizoctonia solani* preserved in the laboratory and grow them on PDA solid medium at 28°C. PDA medium (1L): 200g potato (cut into small pieces and boiled in water until the potato pieces are soft, then filtered through four layers of gauze), 20g glucose, and 15g / L agar powder added to the solid medium.

[0164] 2. Once the sclerotia have grown new hyphae, cut off the well-grown and uncontaminated hyphae with a sterile blade and place them on a new PDA medium for further cultivation.

[0165] 3. Repeat step 2 until there are no other microbial contaminations on the culture medium, and continue culturing for 2-3 days until sclerotia are produced.

[0166] 4. Cut the toothpicks into small pieces of about 2cm and sterilize them.

[0167] 5. Remove the sclerotia and place them on PDA medium. After culturing for 1-2 days, spread them on sterilized toothpicks and continue to grow for 2-3 days. When the mycelium has covered the toothpicks, they can be used for inoculation with the herbaceous blight pathogen.

[0168] 6. Rice can be inoculated with sheath blight pathogen from about 2 months into its growth until before the booting stage. When inoculating, use tweezers to remove a toothpick and insert it into the second or third leaf sheath from the bottom of the rice plant.

[0169] 7. The incidence of sheath blight can be observed 7 days after inoculation with sheath blight pathogen.

[0170] The results are shown in Figure 4.

[0171] Example 5: Transformation of mature rice embryo callus

[0172] 5.1 Induction of callus in mature rice embryos

[0173] 1. Use a threshing machine to remove the husks from the rice seeds, discarding any moldy or deformed seeds.

[0174] 2. Add a small amount of 75% ethanol, shake by hand for about 30 seconds, and rinse once with sterile water.

[0175] 3. Add 25-30% (v / v) NaClO and shake on a shaker at 200 rpm for 30 minutes.

[0176] 4. Rinse with sterile water 5-6 times, and once in between, place it in a shaker and shake for 10 minutes.

[0177] 5. Place the seeds on sterile filter paper to absorb the moisture on the seed surface, and then sow the seeds on NBD medium to induce callus.

[0178] 6. After culturing in the dark for about 14 days, remove the endosperm, plumule, and radicle. The resulting callus can be used for transgenic or subculture. Subculture is performed every two weeks, and the number of subcultures depends on the state of the callus.

[0179] NBD rice screening medium (1L): NB Basal Medium (PhytoTech) 4.1g, sucrose 30g, glutamine 0.5g, proline 0.5g, hydrolyzed casein 0.5g, 1mL 2,4-D solution (1mg / mL), pH 5.8, and 4.5g / L Phytagel should be added for solids.

[0180] 5.2 Preparation of Agrobacterium-mediated transformation culture

[0181] 1. Transform the constructed plasmid into EHA105 competent cells and incubate at 28°C for two days.

[0182] 2. Select a single clone and place it in 5 mL of LB liquid medium containing the corresponding antibiotic for culture. Incubate at 28°C with shaking for 48 h.

[0183] 3. Take 1 mL of the overnight culture and transfer it to 15 mL of AB (20 mg / L Rif + 50 mg / L Kan + 100 mg / L AS) liquid medium. Incubate at 28°C until OD600 = 0.5 (about 4 hours).

[0184] AB liquid culture medium (1L): KH2PO4 3g, NaH2PO4 1g, NH4Cl 1g, MgSO4·7H2O 300mg, KCl 150mg, CaCl2 10mg, FeSO4·7H2O 2.5mg, Glucose 5g.

[0185] 5.3 Co-culture of rice callus and bacterial solution

[0186] 1. Centrifuge the bacterial culture at 5000 rpm for 10 min and discard the supernatant.

[0187] 2. Resuspend the bacterial cells in AAM containing 100 mg / L AS until the bacterial solution has an OD600 of 0.4-0.6.

[0188] 3. Co-culture the bacterial solution with rice callus tissue for 20 minutes.

[0189] 4. Blot dry the bacterial culture, pick up the callus tissue and place it on NBD solid culture medium (with 100 mg / L AS) lined with sterile filter paper. Add 1 mL of AAM (with 100 mg / L AS) culture medium to each dish to thoroughly moisten the sterile filter paper. Incubate for 2-3 days.

[0190] 5.4 Screening

[0191] Blot the callus tissue dry with sterile filter paper and transfer it to a selection medium containing hygromycin to screen for resistant callus. Change the medium every two weeks.

[0192] Screening medium:

[0193] S1: 100 mg / L carboxybenzyl + 30 mg / L Hyg

[0194] S2: 100 mg / L carboxybenzyl + 40 mg / L Hyg

[0195] S3: 100 mg / L carboxybenzyl + 50 mg / L Hyg

[0196] 5.5 Differentiation

[0197] Selected rice callus tissues were transferred to rice differentiation medium and cultured under light. The medium was changed every two weeks until the callus differentiated into seedlings.

[0198] MS rice differentiation medium (1L): M&S BASAL MEDIUM w / VITAMINS (PhytoTech) 4.43g, sucrose 30g, 6-BA 3mg / L, NAA 0.5mg / L, pH 6.3, solids require the addition of 4.5g / L Phytagel.

[0199] 5.6 Rooting

[0200] Transfer the seedlings from the differentiation medium to the rooting medium. After about 2 weeks of growth, remove the seedlings, wash off the agar medium, and culture them in water for 7 days before transplanting them into the soil.

[0201] 1 / 2MS rice rooting medium (1L): M&S BASAL MEDIUM w / VITAMINS (PhytoTech) 2.165g, sucrose 20g, pH 6.3, solids require the addition of 4.5g / L Phytagel.

[0202] Example 6: DAB staining for the detection of H2O2 accumulation

[0203] 1. Take rice leaves and immerse them in DAB staining solution. Vacuuming can be used to ensure that the leaves are completely immersed in the DAB staining solution.

[0204] 2. Reaction under light at room temperature for 8-12 hours.

[0205] 3. After the reaction is complete, remove the leaves and immerse them in a 95% ethanol solution for decolorization in a boiling water bath for 10 minutes. Decolorize in the 95% ethanol solution for at least 4 hours until decolorization is complete.

[0206] 4. Observe whether brown spots appear on the leaves (the polymer formed by the reaction of DAB and H2O2 is brown).

[0207] DAB staining solution

[0208] Results and Discussion

[0209] Our laboratory isolated and identified a genetically stable natural line, rod1, from breeding materials, derived from a natural variation of the japonica rice variety TP309. rod1 exhibits strong resistance to the three major rice diseases: rice blast, bacterial blight, and sheath blight. Studies have shown that ROD1 encodes a calcium-dependent phospholipid-binding protein. ROD1 promotes H2O2 degradation by activating the catalase CatB, and its stability can be finely regulated by a pair of E3 ubiquitin ligases, RIP1 and APIP6. The fungal effector Avrpiz-t structurally mimics ROD1 and activates the same ROS scavenging cascade to suppress host immunity and promote virulence. To further investigate the role of ROD1, a key regulator of broad-spectrum disease resistance in rice, in the disease resistance signaling pathway, we screened rod1 repressor lines to refine the ROD1 disease resistance signaling pathway.

[0210] We found that the repressor srd3 completely restored the autoimmune phenotype and disease resistance of rod1 (Figure 1). Through map-based cloning, we identified a gene homologous to the Arabidopsis ADR1 family, which we named OsADR1 (Figure 2). Genetic complementation experiments confirmed that OsADR1 is the functional gene (Figure 3). Inoculation of OsADR1 overexpressing lines with rice blast race TH12 revealed significantly enhanced disease resistance compared to wild-type TP309, with no lesions appearing on the leaves. The OsADR1 overexpressing lines also exhibited resistance to sheath blight (Figure 4).

[0211] Although the rice genome does not encode any TNL genes, it contains five proteins containing TIR domains, including four TIR-NBARC-TPRs (TNPs) proteins (LOC_Os01g55530, LOC_Os08g38970, LOC_Os09g30380, LOC_Os011g36760) and one TIR-only protein containing only the TIR domain (LOC_Os07g37950), which we named OsTIR. We amplified and sequenced the five TIR-containing proteins in srd mutants and found that one of them, srd18, had a mutation in the TIR-only gene OsTIR. The mutation at position 296 of OsTIR, from G to A, caused the amino acid at position 99 to change from glycine (G) to aspartic acid (D). To confirm whether the autoimmune phenotype of rod1 depends on OsTIR, we constructed a transgenic line of OsTIR-KO in the rod1 background, obtaining two homozygous lines with different mutation types. We found that the OsTIR-KO / rod1 line completely restored the autoimmune phenotype of rod1 (Figure 5). When we inoculated the OsTIR-overexpressing lines with rice blast race TH12, we found that the OsTIR-overexpressing lines exhibited significantly enhanced resistance compared to wild-type TP309 (Figure 6).

[0212] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

[0213] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be construed as an admission that such documents are prior art or common general knowledge.

Claims

1. The use of genes OsADR1 and OsTIR in improving plant disease resistance.

2. The use as described in claim 1, characterized in that, The disease resistance refers to resistance to plant diseases caused by rice blast fungus and / or rice sheath blight fungus.

3. The use as described in claim 2, characterized in that, The rice blast fungus (Magnaporthe.oryzae) is TH12, and the sheath blight fungus is Rhizoctonia solani Kühn RH-9.

4. The use as described in claim 2, characterized in that, The plants are grass crops, selected from rice, wheat, corn, soybean, barley, oats, rye and sorghum.

5. The use as described in claim 4, characterized in that, The crop is rice, and the plant diseases are rice blast, sheath blight, rice false smut, and / or bacterial blight.

6. The use as described in claim 1, characterized in that, The genes OsADR1 and OsTIR can be used for phytoremediation, improving plant disease resistance, or breeding disease-resistant plant varieties.

7. The use as described in claim 6, characterized in that, Plant repair, disease resistance enhancement, or the cultivation of disease-resistant plant varieties can be achieved by overexpressing the genes OsADR1 and / or OsTIR in plants.

8. The use as described in claim 7, characterized in that, Overexpress the genes OsADR1 and / or OsTIR in plants using the following methods: A. Cloning the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence into a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, transforming plants using Agrobacterium-mediated transformation to obtain transgenic plants overexpressing the genes OsADR1 and / or OsTIR; and / or B. By cloning the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence into a plant chromosome using gene editing technology, obtaining transgenic plants that overexpress the gene OsADR1 or its coding region sequence and / or OsTIR or its coding region sequence; and / or C. Place the existing genes OsADR1 and / or OsTIR in the plant genome under the regulation of a functionally enhanced promoter.

9. The use as described in claim 8, characterized in that, The gene editing technology described in step A is selected from the following group: pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1301, pCAMBIA2301, pBI121, pTF102; The Agrobacterium species are selected from the following group: Agrobacterium tumefaciens, Agrobacterium EHA105, and Agrobacterium GV3101.

10. The use as described in any one of claims 6-9, characterized in that, The plant in question is rice.