SNP molecular marker, KASP detection primer and application closely linked to the branch length of cauliflower curd
By developing SNP molecular markers closely linked to the branch length of cauliflower spheres and designing KASP detection primers, using the KASP platform to perform branch phenotype detection of cauliflower spheres, the complexity of branch length identification of cauliflower spheres in the prior art was solved, and a fast, accurate and high-throughput detection effect was achieved.
Patent Information
- Application Number
- CN202410578138.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-10
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2044-05-10
AI Technical Summary
The prior art is difficult to quickly, accurately and with high throughput to identify the branch length of cauliflower spheres, and the traditional methods are complex and cumbersome to operate.
SNP molecular markers closely linked to the branch length of cauliflower spheres were developed, and KASP detection primers were designed. The KASP platform was used to detect the branch phenotype of cauliflower spheres, and the genotype was identified through fluorescence PCR amplification and signal analysis.
It realizes rapid, accurate and high-throughput identification of the branch length of cauliflower spheres, simplifies the operation process, and improves detection efficiency and accuracy.
Smart Images

Figure CN118685550B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to molecular markers of cauliflower curd phenotypes, in particular to SNP molecular markers closely linked to the branching length of cauliflower curds, KASP detection primers, and their applications in identifying or detecting cauliflower curd branching phenotypes, belonging to the field of SNP molecular markers of cauliflower curd branching phenotypes and their applications. Background Art
[0002] Compared with other Brassica vegetables, the most significant feature of cauliflower (Brassica oleracea var. botrytis L.) is its unique edible organ, the "curd". The branching length of cauliflower curds is a key agronomic trait of cauliflower and also a key factor affecting the yield, quality, and firmness of cauliflower. Studying the molecular basis of the formation of cauliflower curd branching length and developing closely linked molecular markers are of great significance for cauliflower resource evaluation, creation, and new variety breeding.
[0003] With the rapid development of high-throughput sequencing technology, single nucleotide polymorphism (SNP) markers have gradually become the most popular choice due to their relatively low cost, high throughput, good stability and reproducibility, uniform distribution in the genome, and easy detection. Among them, the KASP platform has the advantages of high precision, high throughput, and cost-effectiveness, and has been widely used in genetic diversity analysis, fingerprint map construction, genome-wide association analysis, seed purity or authenticity identification, and molecular marker-assisted breeding of various crops such as wheat, rice, cotton, cucumber, and broccoli.
[0004] Currently, the research on the branching length of cauliflower curds is still at the level of QTL mapping. Limited reports have mapped genes related to the pedicel length of cauliflower curds to chromosomes 2 and 6 of cauliflower. CN106399498 A discloses a molecular marker-assisted selection method for the pedicel length of cauliflower curds, which realizes the identification of the pedicel length of cauliflower curds through enzymatic digestion reaction and electrophoresis detection, not only with low throughput but also with a complex and cumbersome operation process. Summary of the Invention
[0005] One of the objectives of the present invention is to provide SNP molecular markers closely linked to the branching length of cauliflower curds;
[0006] Another objective of the present invention is to provide KASP detection primers for detecting or amplifying the SNP molecular markers closely linked to the branching length of cauliflower curds;
[0007] The third objective of the present invention is to apply the SNP molecular markers closely linked to the branching length of cauliflower curds or the KASP detection primers for detecting or amplifying the SNP molecular markers closely linked to the branching length of cauliflower curds to the detection or prediction of cauliflower curd branching phenotypes;
[0008] A fourth object of the present invention is to provide a method for detecting the floret branching phenotype of cauliflower;
[0009] A fifth object of the present invention is to provide a PCR detection kit for detecting the floret branching phenotype of cauliflower.
[0010] To achieve the above object, the main technical solutions adopted by the present invention include:
[0011] One aspect of the present invention is to provide an SNP molecular marker (Chr8:11387967) that is closely linked to the floret branching length of cauliflower, and its nucleotide sequence is the 8th chromosome of the cauliflower reference genome 'C-8'. The SNP locus is located at nucleotide 11387967, and the base at this position is G or A; wherein, when the genotype of this SNP locus is G:G, the phenotype corresponding to this genotype is the short floret branching phenotype; when the genotype of this SNP locus is G:A or A:A, the phenotype corresponding to this genotype is the long floret branching phenotype.
[0012] Another aspect of the present invention is to provide KASP detection primers for detecting the SNP molecular marker (Chr8:11387967) that is closely linked to the floret branching length of cauliflower. The KASP detection primers are composed of a forward primer, a reverse primer, and a universal primer. Among them, the nucleotide sequence of the forward primer is shown as SEQ ID No.1, the nucleotide sequence of the reverse primer is shown as SEQ ID No.2, and the nucleotide sequence of the universal primer is shown as SEQ ID No.3.
[0013] Both the SNP molecular marker provided by the present invention that is closely linked to the floret branching length of cauliflower or the KASP detection primers for detecting the SNP molecular marker (Chr8:11387967) that is closely linked to the floret branching length of cauliflower can be used to detect whether the floret branching phenotype of a cauliflower sample is the short floret branching phenotype or the long floret branching phenotype.
[0014] Another aspect of the present invention is to provide a method for detecting the floret branching phenotype of cauliflower, including:
[0015] (1) Extract the genomic DNA of the cauliflower sample to be detected;
[0016] (2) Design KASP detection primers according to the SNP molecular marker that is closely linked to the floret branching length of cauliflower or the KASP detection primers for detecting the SNP molecular marker (Chr8:11387967) that is closely linked to the floret branching length of cauliflower;
[0017] (3) Using the extracted genomic DNA of the cauliflower sample to be detected as a template and the designed KASP detection primers as PCR primers, a fluorescence PCR amplification system is established; the genotype of the SNP locus of the cauliflower sample to be detected is identified by analyzing the fluorescence signal of the sample PCR product through the KASP platform; if the genotype of the SNP locus of the cauliflower sample to be detected is the G:G genotype, the inflorescence branching phenotype of the cauliflower sample to be detected is the short inflorescence branching phenotype; if the genotype of the SNP locus of the cauliflower sample to be detected is G:A or A:A, the inflorescence branching phenotype of the cauliflower sample to be detected is the long inflorescence branching phenotype.
[0018] In a preferred specific embodiment of the present invention, the KASP primer consists of a forward primer, a reverse primer and a universal primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID No.1, the nucleotide sequence of the reverse primer is shown as SEQ ID No.2, and the nucleotide sequence of the universal primer is shown as SEQ ID No.3.
[0019] Another aspect of the present invention is to provide a PCR detection kit for detecting the inflorescence branching phenotype of cauliflower, comprising: PCR mix, KASP detection primers, wherein the KASP primer consists of a forward primer, a reverse primer and a universal primer, the nucleotide sequence of the forward primer is shown as SEQ ID No.1, the nucleotide sequence of the reverse primer is shown as SEQ ID No.2, and the nucleotide sequence of the universal primer is shown as SEQ ID No.3.
[0020] In the previous research of the present invention, through omics means such as genome-wide association analysis, selective sweep analysis and haplotype analysis, a key QTL interval controlling the inflorescence branching length of cauliflower located at 79Kb on chromosome 8 of cauliflower was determined, candidate genes were screened and cloned, a molecular marker closely linked to the inflorescence branching length was developed, and KASP primers for high-throughput detection of this molecular marker were designed.
[0021] The present invention uses omics means such as genome-wide association analysis, selective sweep analysis, transcriptome and haplotype analysis to determine a key QTL interval controlling the inflorescence branching length of cauliflower located at 79Kb on chromosome 8 of cauliflower. Based on the variant site Chr8:11387967 of the cauliflower reference genome, a SNP molecular marker is developed, which is closely linked to the inflorescence branching length, so as to quickly, accurately and high-throughput identify the inflorescence branching length of cauliflower. Description of the Drawings
[0022] Figure 1Schematic diagram of the branch length of cauliflower curds (a) and phenotypic statistics of 298 high-generation inbred lines of cauliflower (b); among them, LOB represents the length of the first-order branches, and LSB represents the length of the second-order branches.
[0023] Figure 2 Schematic diagram of QTL mapping for the branch length of cauliflower curds; a is the Manhattan plot of GWAS analysis, b is the genome-wide Fst analysis, c is the genome-wide XP-EHH analysis, and d are the candidate genes within the interval.
[0024] Figure 3 Haplotype analysis of the candidate interval.
[0025] Figure 4 Box plot of haplotype analysis of the SNP molecular marker Chr8:11387967 in 298 high-generation inbred lines of cauliflower.
[0026] Figure 5 Results of genotype and phenotype detection of the SNP molecular marker Chr8:11387967 in 94 materials. Specific implementation manners
[0027] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and forms of the present invention without departing from the spirit and scope of the present invention. The description in this application and the embodiments are merely exemplary.
[0028] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0029] Unless otherwise stated, the gene positions in the present invention refer to the positions relative to the cauliflower reference genome 'C-8'.
[0030] The present invention will be described below in conjunction with embodiments. The technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.
[0031] The development of SNP molecular markers tightly linked to the branch length of cauliflower curds and the identification of the branch length of cauliflower curds are shown below.
[0032] Example 1 Development of SNP molecular markers tightly linked to the branch length of cauliflower curds
[0033] Figure 1 It is a schematic diagram of the branch length of cauliflower curds (a) and the phenotypic statistics of 298 high-generation inbred lines of cauliflower (b).
[0034] A total of 298 high-generation inbred lines of cauliflower with different branch lengths were re-sequenced. The sequencing platform was Illumina HiSeq 2000. The raw data was filtered using Trimmomatic v0.39 to remove adapters, poly-N, and low-quality fragments to obtain clean data. The clean data was aligned to the reference genome 'C-8' using BWA and samtools software, and the data format of the alignment results was converted. After SNP Calling using GATK, the vcf file was filtered using vcftools with the parameters: --maf 0.05, --max-missing 0.9. A total of 729,691 SNPs (MAF > 0.05; Quality ≥ 20; GQ ≥ 5; missing rate ≤ 0.2; depth ≥ 4) were obtained for subsequent GWAS analysis. Finally, GWAS analysis was performed using the FarmCPU and MLM models of the rMVP software, and GWAS threshold calculation was performed using GEC (Genetic type 1 Error Calculator).
[0035] Two methods (cross-population extended haplotype homozygosity (XP-EHH) based on linkage disequilibrium and Fst based on population differentiation) were used to detect selective sweeps in two cauliflower populations with extreme curd branch lengths. The Fst value was calculated using VCFtools v0.1.17 with a window size of 100 Kb and a window step of 10 Kb. Under selective scanning, windows with the top 1% Fst values were considered candidate regions. The XP-EHH value was calculated using the REHH v.3.2.2 R package (Gautier, 2017) for XP-EHH, and regions under positive selection were located by applying a threshold of -log10(p value) > 4.0.
[0036] Integrating the above three analysis methods, the QTL related to the branch length of cauliflower curds was mapped to an interval of 79 Kb on chromosome 8, and this candidate interval contains 12 annotated genes ( Figure 2 ).
[0037] Further haplotype analysis was carried out, and based on the results of haploid analysis ( Figure 3 , Figure 4 ), a SNP molecular marker (Chr8:11387967) that is tightly linked to the branch length of cauliflower curds was finally discovered. It is a G-to-A mutation at nucleotide 11387967 on chromosome 8 of the cauliflower reference genome 'C-8'. The genotype G:G corresponding to the SNP molecular marker is the genotype of the short curd branch phenotype, and the genotypes G:A or A:A corresponding to the SNP molecular marker are the genotypes of the long curd branch phenotype.
[0038] Experimental Example 1 Application Experiment of Genotype and Phenotype Determination of Cauliflower SNP Molecular Marker Chr8:11387967 in 94 Cauliflower Materials
[0039] Genomic DNA was extracted from the seedlings of 94 cauliflower lines, and the curd branch length phenotype was measured at the mature stage. KASP detection primers were designed according to the Chr8:11387967 SNP molecular marker. The sequences of the KASP detection primers are as follows:
[0040] Allele-G-F:
[0041] GAAGGTGACCAAGTTCATGCTCCTTCTGATTTTCAGGAAGGGTAC (SEQ ID NO.1);
[0042] Allele-A-F:
[0043] GAAGGTCGGAGTCAACGGATTCCTTCTGATTTTCAGGAAGGGTAT (SEQ ID NO.2);
[0044] Common-R: CGAGCTTCTTCTGTTCTCTGCAGAT (SEQ ID NO.3).
[0045] Using the above molecular marker primers, 94 cauliflower samples were identified.
[0046] The entire KASP detection process was completed on the Douglas Scientific Array Tape platform. First, the content and purity of DNA were detected with a UV spectrophotometer, and then the following procedures were carried out: (1) Dilution: According to the cauliflower genome size, DNA was diluted using a TECAN liquid automated workstation; (2) PCR system preparation: The DNA working solution, PCR mix, and primers were added to the 384 PCR reaction Array Tape on the Nexar workstation; (3) PCR amplification: The PCR reaction was completed in a Soellex water bath; among them, the PCR reaction program is shown in Table 1.
[0047] Table 1 KASP PCR reaction procedure
[0048]
[0049]
[0050] (4) Fluorescence signal reading: Perform fluorescence intensity scanning and detection on Araya, and analyze and read the data in the corresponding software. If only the fluorescence signal corresponding to the primer Allele-G-F with a fluorescent linker sequence is detected in the sample PCR product, the detected locus is the G:G genotype; if only the fluorescence signal corresponding to the primer Allele-A-F with a fluorescent linker sequence is detected in the sample PCR product, the detected locus is the A:A genotype. If both fluorescence signals corresponding to the primers Allele-G-F and Allele-A-F with fluorescent linker sequences are detected simultaneously, the detected locus is the G:A genotype.
[0051] Table 2 Detection results of genotypes and phenotypes of the Chr8:11387967 SNP molecular marker in 94 cauliflower samples
[0052]
[0053]
[0054] The statistical results are shown in Table 2; according to the results in Table 2 and Figure 5 it can be seen that: for 30 cauliflower materials, the genotype at the Chr8:11387967 locus is G:G, the length of the primary curd branches is less than 2.9 cm, and the average length is 2.76 cm; for 63 cauliflower materials (35 of which are G:A and 28 are A:A), the genotype is G:A or A:A, the length of the primary curd branches is greater than 3.9 cm, and the average length is 6.07 cm; for 1 material, no fluorescence signal was detected.
Claims
1. KASP detection primers for detecting or amplifying SNP molecular markers tightly linked to the branch length of cauliflower curds, characterized in that, The KASP detection primer consists of two upstream primers for genotyping and one common primer; wherein, the nucleotide sequences of the two upstream primers for genotyping are shown as SEQ ID No.1 and SEQ ID No.2 respectively, and the nucleotide sequence of the common primer is shown as SEQ ID No.
3.
2. Use of the KASP detection primer according to claim 1 in detecting or identifying the cauliflower curd branching phenotype.
3. A method for detecting the inflorescence branching phenotype of cauliflower, characterized in that, Including: (1) Extract the genomic DNA of the cauliflower sample to be detected; (2) Design KASP detection primers according to the SNP molecular marker tightly linked to the cauliflower curd branching length; the KASP detection primer consists of two upstream primers for genotyping and one common primer; wherein, the nucleotide sequences of the two upstream primers for genotyping are shown as SEQ ID No.1 and SEQ ID No.2 respectively, and the nucleotide sequence of the common primer is shown as SEQ ID No.3; (3) Using the extracted genomic DNA of the cauliflower sample to be detected as a template and the designed KASP detection primer as a PCR primer to establish a fluorescence PCR amplification system; analyzing the fluorescence signal of the sample PCR product through the KASP platform to identify the genotype of the SNP locus of the cauliflower sample to be detected; if the genotype of the SNP locus of the cauliflower sample to be detected is the G:G genotype, the cauliflower curd branching phenotype of the cauliflower sample to be detected is the short curd branching phenotype; if the genotype of the SNP locus of the cauliflower sample to be detected is G:A or A:A, the cauliflower curd branching phenotype of the cauliflower sample to be detected is the long curd branching phenotype.
4. A PCR detection kit for detecting the inflorescence branching phenotype of cauliflower, comprising: PCR mix, KASP detection primer, characterized in that the KASP detection primer consists of two upstream primers for genotyping and one common primer; wherein, the nucleotide sequences of the two upstream primers for genotyping are shown as SEQ ID No.1 and SEQ ID No.2 respectively, and the nucleotide sequence of the common primer is shown as SEQ ID No.3.
Citation Information
Patent Citations
Molecular marker assisted selection method for cauliflower flower ball pedicel length
CN106399498A