Application of miRNA168a

By consuming rice rich in miRNA168a-5p or transgenic rice, the eva1c/NOD1 signaling pathway in pancreatic islet β cells is activated, and the shortcomings in the prior art are solved in regulating insulin levels and improving sugar metabolism are achieved, and the effect of significantly improving insulin content and secretion is provided, providing an effective diabetes treatment method.

CN118697757BActive Publication Date: 2025-06-13INSTITUTE OF BIOPHYSICS CHINESE ACADEMY OF SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410007794.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-03
Publication Date
2025-06-13
Estimated Expiration
2044-01-03

AI Technical Summary

Technical Problem

The prior art is difficult to effectively treat hyperglycemia or diabetes, especially in terms of regulating insulin levels and improving sugar metabolism.

Method used

By utilizing plant miRNA168a-5p, especially by eating miRNA168a-5p rich in miRNA168a-5p, the eva1c/NOD1 signaling pathway in pancreatic islet β cells is activated, thereby enhancing insulin content and secretion and improving hyperglycemia and metabolic disorders in diabetic mice.

Benefits of technology

It significantly improves the content and secretion of insulin, improves hyperglycemia and metabolic disorders in diabetic mice, and provides a potential treatment for diabetes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118697757B_ABST
    Figure CN118697757B_ABST
Patent Text Reader

Abstract

The present invention relates to the use of miRNA168a or miRNA168a-5p in the treatment of hyperglycemia, diabetes and related disorders.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of medicine. Specifically, the present invention relates to the application of miRNA168a, such as the treatment of hyperglycemia or diabetes. Background Art

[0002] Cross-kingdom regulation of plant microRNA (miRNA) is a brand-new scientific field. In 2011, a study published by the team of Professor Chenyu Zhang of Nanjing University in Cell Research showed that the blood of humans, cows, and mice contains a variety of highly abundant plant miRNAs [3] . Moreover, miRNA168a rich in rice can be absorbed by the mouse gastrointestinal tract into the blood and maintain a certain concentration [4] . More importantly, miRNA168a-5p can directly bind to the mRNA encoding liver low-density lipoprotein receptor adaptor protein 1 (LDLRAP1) and inhibit the post-transcriptional translation process of LDLRAP1 [4] . Subsequently, more and more studies have also confirmed that a variety of plant miRNAs (including miRNA150, miRNA156a, miRNA159, miRNA167e-5p, miRNA168a, miRNA2911) can coexist with the human internal environment for a long time [4-9] and cross-kingdom regulate human genes [4,10-15] . Not only that, the latest research by Japanese scientists in 2022 showed that miRNA168a-3p can silence the expression of mitochondrial respiratory chain complex I, thereby upregulating human GLUT1 and promoting glucose metabolism in skeletal muscle cells

[16] . These tell us that the cross-kingdom regulation of human genes by plant miRNAs is an objectively existing physiological process with clear targeting, and miRNA168a is a potential medicinal small molecule enriched in rice.

[0003] miRNA168a is a member of the miR168 family and exists in many plant species. The gene expression of miRNA168a is a multi-step process, including transcription to generate primary miRNA (pri-miRNA), cleavage to generate precursor miRNA (pre-miRNA), and finally the formation of mature miRNA. First, the gene of miRNA168a is transcribed into pri-miRNA. Pri-miRNA is a relatively long RNA strand, usually catalyzed by RNA polymerase II. The transcription of pri-miRNA is generally regulated by transcription factors and other regulatory factors. Next, pri-miRNA undergoes a series of cleavage and modification events to generate pre-miRNA. This cleavage process is usually completed by the nuclear enzyme Drosha and its cofactor. Drosha is an RNase III enzyme that can recognize and cleave two domains in pri-miRNA to form a pre-miRNA of about 70-100 nucleotides with a specific secondary structure. Subsequently, pre-miRNA is transported from the nucleus to the cytoplasm. In the cytoplasm, pre-miRNA168a is further processed by the action of Dicer enzyme. Dicer is also an RNase III enzyme that can recognize and cleave a domain in pre-miRNA168a to form mature miRNA168a-5p and miRNA168a-3p. The mature miRNA binds to a member of the Argonaute (AGO) protein family to form an RNA-induced Silencing Complex (RISC). Under the guidance of RISC, miRNA can pair with the 3' untranslated region (3' UTR) of the target mRNA. This complementary pairing, mediated by RISC, can lead to translational inhibition or targeted degradation of mRNA. Therefore, the gene expression and RNA cleavage and processing process of plant miRNA168a involve the transcription of the gene to generate pri-miRNA, the cleavage of pri-miRNA to generate pre-miRNA, and the further cleavage of pre-miRNA and the formation of mature miRNA. This process is complex and precise and plays an important regulatory role in the production and function of miRNA. The present invention relates to the cross-kingdom regulatory role of mature miRNA168a-5p of plant miRNA168a in animals and plants. Summary of the Invention

[0004] The present invention discovers that eva1c / NOD1 in β cells is activated by miRNA168a-5p absorbed from plants such as rice. miRNA168a-5p is related to the diabetes index of diabetic patients, enhances the insulin content and secretion in pancreatic islet cells, and improves hyperglycemia and metabolic disorders in diabetic mice. The present invention reveals the physiological role of miRNA-mediated interaction between plants and pancreatic islet cells in promoting glucose homeostasis.

[0005] Plants such as rice are rich in miRNA168a-5p, which can be absorbed by the mouse intestine and various tissues and organs and maintain a certain concentration in the blood. So far, the cross-kingdom regulation of plant miRNAs has been gradually recognized, but the localization and levels of miRNAs in different tissues and organs are still unknown, and further studies are needed on the role of plant miRNAs in pathological processes.

[0006] The present invention discovers that there is a high similarity in the seed sequences of miRNAs (the 2nd - 8th nt of miRNA mature forms, SEQ ID NO:1) between mammals and plants. Analyzing the published miRNA sequencing data of human tissues, it is easy to find that the high levels of miR168a are mainly concentrated in the blood and pancreatic islets of normal and diabetic patients, including pancreatic islet β cells, and the concentration of this miR168a-5p in the pancreas is similar to that of the self-expressed let-7a in the human body, which indicates that miR168a-5p can reach a concentration similar to that of human miRNAs in the pancreas and pancreatic islet cells, and miR168a-5p has a physiological concentration in pancreatic islets and pancreatic islet cells.

[0007] In vivo imaging of small animals and laser confocal microscopy show that miRNA168a-5p can freely enter pancreatic islet β cells without adding any transfection reagents. These results indicate that plant miR168a-5p is very abundant in human pancreatic islet β cells, and oral administration of rice containing miRNA168a-5p can be digested and absorbed by mice, thereby increasing the insulin capacity of pancreatic islet β cells through the eva1c / NOD1 signaling pathway in pancreatic islet cells.

[0008] The present invention first reveals that the regulation of the miRNA-insulin axis may occur daily in daily life. The increase in the miRNA content in food promotes the absorption of miRNA in mice. miRNA168a-5p is enriched in the islets of Langerhans and co-localizes with insulin. These data are consistent with the sequencing results of mammalian pancreatic islet β cells and pancreas. In mice and INS-1 cell lines, the dietary intake of different concentrations of miRNA168a-5p dose-dependently increases insulin content and secretion. At the same time, as miRNA168a-5p accumulates in the pancreas, the blood glucose level decreases. Mechanistically, we demonstrate that miRNA168a-5p directly binds to the eva1c mRNA to silence the expression of the protein eva1c, thereby leading to the activation of the downstream target NOD1 of eva1c at the transcriptional level.

[0009] Islet NOD1 has been found to be a target for a series of host physiological responses and plays an important role in regulating glucose metabolism in the body. We found that miRNA168a-5p dose-dependently upregulates NOD1. Along with this regulation, NOD1 restores the cytoplasmic distribution of insulin in β cells and increases with the increase in insulin content and secretion. Silencing of NOD1 blocks the effect of miRNA168a-5p on promoting insulin content. These results indicate that NOD1 is involved in the functional response of β cells to miRNA168a-5p.

[0010] The present invention presents a "diabetes treatment" rice. This rice is derived from a transgenic rice line overexpressing miRNA168a, enabling diabetic patients to absorb more miRNA168a-5p when consumed. The intake of rice (rice) containing miRNA168a-5p localizes it to the islets of Langerhans, increases the insulin capacity of pancreatic islet β cells, and better maintains islet cell function and insulin release through the eva1c / NOD1 signaling pathway. It stably alleviates the hyperglycemia symptoms of db / db mice and hyperglycemia, dysregulation, obesity, and even death caused by high-fat diet-induced diabetes. More importantly, this brand-new mechanism targeting NOD1 opens up the application of miRNA and shows an effect of pharmacodynamic superposition with other anti-diabetic drugs. This food-based drug intervention can more easily prevent and treat diabetes while reducing the treatment cost. It will no longer burden people with "taking medicine" but become a "food therapy" for curing diabetes.

[0011] Specifically, the present invention relates to the following aspects:

[0012] 1. Use of miRNA168a or miRNA168a-5p in the preparation of a medicament for reducing blood glucose levels in a mammal (such as a human) or in the preparation of a medicament for treating hyperglycemia or diabetes (preferably type II) or diabetes-related disorders, wherein the sequence at positions 2-8 at the 5'-end of miRNA168a or miRNA168a-5p is as shown in SEQ ID NO: 1, and the diabetes-related disorders are insufficient insulin secretion induced by a high-fat diet, hyperinsulinemia, hypercholesterolemia, hypertension, and obesity.

[0013] 2. Use of a reagent for increasing the expression of miRNA168a or miRNA168a-5p in the preparation of a reagent for reducing blood glucose levels in a mammal (such as a human), wherein the sequence at positions 2-8 at the 5'-end of miRNA168a or miRNA168a-5p is as shown in SEQ ID NO: 1.

[0014] 3. Use of a reagent for delivering miRNA168a or miRNA168a-5p to pancreatic islet cells of a mammal (such as a human) in the preparation of a medicament for reducing blood glucose levels in a mammal (such as a human), wherein the sequence at positions 2-8 at the 5'-end of miRNA168a or miRNA168a-5p is as shown in SEQ ID NO: 1.

[0015] 4. The use according to any one of items 1-3, wherein miRNA168a or miRNA168a-5p is obtained from rice, white sugarcane, sugarcane, corn, Aegilops tauschii, wheat, corn, Brachypodium distachyon, barley, sorghum, radish, Arabidopsis thaliana, tomato, soybean, Brassica napus, Arabidopsis lyrata, turnip, Populus trichocarpa, or Vriesea carinata.

[0016] 5. The use according to any one of items 1-4, wherein the sequence of miRNA168a is as shown in SEQ ID NO: 3 or 4, and the sequence of miRNA168a-5p is as shown in SEQ ID NO: 2 or any one of SEQ ID NOs: 5-18.

[0017] 6. A method for preparing a plant for reducing blood glucose in a mammal (such as a human), characterized by overexpressing miRNA168a or miRNA168a-5p in a plant containing miRNA168a, wherein the sequence at positions 2-8 at the 5'-end of miRNA168a or miRNA168a-5p is as shown in SEQ ID NO: 1.

[0018] 7. The method according to item 6, wherein the overexpression is carried out by transfecting a plant with an expression vector containing miRNA168a or miRNA168a-5p.

[0019] 8. The method according to item 6 or 7, wherein the plant is selected from rice, white sugarcane, sugarcane, corn, Aegilops tauschii, wheat, corn, Brachypodium distachyon, barley, sorghum, radish, Arabidopsis thaliana, tomato, soybean, Brassica napus, Arabidopsis lyrata, turnip, Populus trichocarpa or Vriesea carinata, preferably wherein the sequence of miRNA168a is as shown in SEQ ID NO:3 or 4, and the sequence of miRNA168a-5p is as shown in any one of SEQ ID NO:2 or 5-18.

[0020] 9. The method according to any one of items 6-8, wherein the sequence of miRNA168a is as shown in SEQ ID NO:3 or 4, and the sequence of miRNA168a-5p is as shown in SEQ ID NO:2.

[0021] Therefore, combining the research background and the data from previous studies, we believe that deeply revealing the interaction between rice miRNA and pancreatic islet cells can establish new anti-diabetic methods and treatment concepts, providing new solutions to alleviate the urgent clinical needs of diabetes prevention and treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Content and distribution of rice miRNA168a-5p and other miRNAs in staple foods and mice.

[0023] Figure 2 : Localization of miRNA168a-5p in the pancreas after mice ingest miRNA168a-5p.

[0024] Figure 3 : miRNA168a-5p actively enters pancreatic islet cells. (A) Oral administration induces miRNA168a (red) to enter the islets, as indicated by the arrow. (B) Transmembrane transport of miRNA168a-5p in the human insulin 1.1B4 cell line.

[0025] Figure 4 : miRNA168a-5p enters cells through insulin-secreting cells and regulates glucose metabolism in vivo. (A) Experimental procedures using diets injected with AAV-miR168a-5p, including normal diet, stale rice, fresh rice, and normal diet. (B-D) Body weight, glucose tolerance test, and insulin release of mice treated with different diets. (E) Detection of miRNA168a and insulin levels and their co-localization in insulin cells in normal mice using in situ hybridization and immunohistochemical staining. *, P<0.05; **, P<0.01.

[0026] Figure 5: Potential target genes downstream of miRNA168a-5p. (A) Schematic description of the double-stranded structure formed by the interaction between eva1c and miRNA168a-5p. The potential binding sites of miRNA168a-5p to eva1c mRNA are highly conserved among species (nt 2-8). (B) Downstream prediction of eva1c target genes by Genemania.

[0027] Figure 6 : Regulation of downstream genes eva1c and NOD1 by miRNA168a-5p in pancreatic islet β cells. (A-C) Western blot was used to detect the levels of Eva1c and NOD1 in mouse islets. Mice were fed with normal diet, expired rice, fresh rice, or normal diet injected with AAV-miR168a for Western blot detection (A), statistical analysis (B), and immunohistochemical staining (C). *, P<0.05; **, ##P <0.01.

[0028] Figure 7 : Regulation of the eva1c / NOD1 pathway by miRNA168a-5p. (A) Schematic of luciferase reporter plasmids carrying the firefly luciferase coding sequence with complementary sites (CS), WT or mutant eva1c. (B-D) Western blot analysis of eva1c and NOD1 expression in pancreatic islet β cells. (E and F) Insulin secretion was measured from INS-1 cells 72 hours after transfection with miR168a-5p, eva1c gene, eva1c siRNA, or NOD1 siRNA. Cells were incubated in 2.8 or 16.7 mM glucose for 1 hour. Data are shown as mean ± SEM (n = 3 independent biological experiments). Data are presented as mean ± SEM. *, P <0.05; **, P <0.01.

[0029] Figure 8 : miRNA168a transgenic callus reduces blood glucose in db / db mice. (A) Effect of AAV transfection on miRNA168a expression levels in organs; (B, C, and D) Effects of db / db mice fed with callus with different miRNA168a levels on mouse body weight, food intake, and blood glucose; **, ##, P<0.01.

[0030] Figure 9:Effect of overexpressing miRNA168a-5p on blood glucose in db / db mice. (A) Experimental procedure of AAV-miR168a-5p treatment by i.p. (intraperitoneal injection) 10 weeks after AAV injection. (B-H) Body weight, fasting and postprandial glucose, insulin release, GTT, ITT and survival rate of AAV-treated db / db mice. **, P<0.01.

[0031] Figure 10 :Relationship between blood miRNA168a-5p and type II diabetes.

[0032] Figure 11 :Protective effect of AAV overexpressing miRNA168a-5p on HFD-induced metabolic syndrome mice. (A) Effect of AAV transfection on the expression level of miRNA168a-5p in organs; (B, C and D) Effects of overexpressing miRNA168a-5p in HFD mice on body weight, food intake and blood glucose of mice; (E-H) Effects of overexpressing miRNA168a-5p on glucose tolerance and insulin resistance in HFD mice at different weeks and stages. *, #, P<0.05; **, ##, P<0.01.

[0033] Figure 12 :Effect of AAV overexpressing miRNA168a-5p on blood indexes of HFD-induced metabolic syndrome mice at 35 weeks. (A) Triglyceride level; (B) Cholesterol level; (C) Non-free fatty acid level.

[0034] Figure 13 :Combined use of miRNA168a with other antidiabetic drugs. (A) Experimental process of co-treating miR168a callus with Exendin-4 or metformin once a day for 9 days. (B-D) Blood glucose monitoring in db / db mice treated with miRNA168a, Exendin-4 or metformin within 9 days. Data are expressed as mean ± SEM. *, P<0.05; **, P<0.01, #, P<0.05.

[0035] Figure 14 :Improvement of glucose tolerance by delivery of miRNA168a. After gavage with the positive vector containing miRNA168a, the change of glucose tolerance in diabetic mice was observed using GTT. *, P<0.05; **, P<0.01.

[0036] Figure 15 :Comparison of the regulation of eva1c gene by miRNA168a-5p from rice (osa), tomato (sly) and white radish (rad). Specific implementation manner

[0037] The embodiments of the present invention will be described in detail below in conjunction with examples. Those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. For those without specific technical or conditions noted in the examples, the techniques or conditions described in the literature in the field (for example, referring to "Molecular Cloning: A Laboratory Manual" by J. Sambrook et al., translated by Huang Peitang et al., Third Edition, Science Press) or according to the product instructions are followed. For reagents or instruments without the manufacturer noted, they are conventional products that can be obtained through market purchase.

[0038] Experimental procedures:

[0039] 1. Animal experiments

[0040] C57BL6n mice, db / db mice and nude mice (male, 8 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. and were raised in a SPF-class mouse breeding room with free access to water and food. All animal breeding and other experimental operations complied with the relevant management requirements and experimental animal ethics requirements.

[0041] 2. Construction of metabolic syndrome mice

[0042] Construction of HFD (high-fat diet) diabetic mice: Order several 4-week-old C57BL6n mice and continuously feed them a 60% high-fat diet for more than 12 weeks. When the average body weight of the mice approaches 45 g per mouse, the random blood glucose is higher than 11.1 mmol / L, and the fasting blood glucose is higher than 7 mmol / L, the model is successfully made (Song R, et al., Nature. 2013).

[0043] db / db mice: Homozygous db / db mice have a gene mutation in the leptin receptor and are a type 2 diabetes model characterized by hyperglycemia, obesity, hyperinsulinemia, and difficulty in wound healing. A random blood glucose level > 20 mmol / L confirms the diabetic phenotype of db / db mice (Joseph M, et al., Wound Repair and Regeneration. 2007).

[0044] 3. Detection of glycolipid metabolism indexes in mice

[0045] (a) Glucose tolerance test: The mice were fasted overnight (16 h), and then glucose (2 g∙kg −1 ) was injected intraperitoneally. For the insulin tolerance test, the mice were randomly grouped and injected intraperitoneally with bovine insulin (0.75 U∙kg −1, Sigma-Aldrich). Glucose and insulin concentrations were measured using an Accu-Chek glucose meter (Roche Diagnostics) and an ELISA kit from Linco Research (catalog number EZRMI-13K), respectively. Serum triglyceride and cholesterol concentrations were measured using Wako diagnostic kits (catalog numbers 290-63701 and 294-65801, respectively).

[0046] (b) Metabolic cage experiment: For metabolic rate analysis, mice were individually housed in an environment with a 12-hour light / dark cycle. A comprehensive animal metabolic monitoring system (CLAMS; Columbus Instruments) continuously evaluated oxygen consumption (VO 2 ) and carbon dioxide production (VCO 2 ) over 72 hours. Energy expenditure was calculated using the formula: Energy expenditure = (3.815 + 1.232 × VCO 2 -max) × VO2-max (Song RS, et al., Nature. 2013).

[0047] 4. Localization and detection of miRNA

[0048] The metabolism and tissue localization of miRNA in mice were detected and traced using a small animal in vivo imager illumina3 (illumina 3, PE). The intracellular localization of miRNA was observed and detected using a fast super-resolution laser confocal microscope (LSM980, Zeiss), and the levels of cellular mitochondrial ROS, mitochondrial membrane potential, and superoxide were detected in combination with a flow cytometer BD FACSCalibur-2.

[0049] 5. Construction and identification of transgenic callus

[0050] (a) Agrobacterium construction: The designed guide RNAs (target 1: gggctcgcttggtgcagatc ggg, SEQ ID NO:19; target 2: ccgccttgcaccaagtgaat cgg, SEQ ID NO:20) were synthesized and ligated onto the plant vector of crispr-cas9 (pYL-HU-U3-tRNA, purchased from Biorun Ink, Wuhan, China), and the plasmid was transformed into Agrobacterium (EHA105 / pCAMBIA1305.1) to construct Agrobacterium with miRNA168a knockout. Primers were designed (upstream: cgatGGTCTCacaacttttaaatgtgttagtatgtttttaaaaaaaatgcgaaggaact, SEQ ID NO:21;

[0051] Downstream: cagtGGTCTCatacaaccaaactcaggatagccaccaaaaattaggggaaattccaact, SEQ ID NO: 22) was used to PCR amplify the target sequence of MIR168a in the own gene of Nipponbare (Genbank: LM379327.1). The PCR product was ligated onto the plant gene expression vector (pBWA(V)HS-35s-gfp, purchased from Biorun Ink, Wuhan, China), and the plasmid was transformed into Agrobacterium to construct Agrobacterium with miRNA168a knockout.

[0052] (b) Infection of Agrobacterium and identification of callus: Fresh calli of Nipponbare at different embryo ages were cultured. The prepared Agrobacterium (20 μl, OD>1, 20 ml callus system) was used. After selecting the suitable embryo age for transfection, resistant calli were screened out, subcultured for 3 - 5 generations, and after identifying the content of miRNA168a by real-time quantitative PCR, they were fed to mice.

[0053] 6. Cell culture and cell transfection

[0054] The pancreatic islet β cells used in this experiment were purchased from Lonza, USA. The cells were cultured in DMEM medium (Gibco, USA) containing fetal bovine serum (10%) at 37°C, 5% CO 2, cultured in an incubator with a humidity of 95%. The negative control (NC) and microRNA168a-5p (SEQ ID NO: 2, or SEQ ID NO: 2 containing Cy3 / Cy5 labels) used for cell transfection were synthesized by Shanghai Jierui Biotechnology Co., Ltd. Primers targeting the CDS region of the NRIP1 (NC_051346.1) gene were designed, and the target fragment was amplified by PCR. The obtained target fragments were respectively ligated with the double-digested vector pLenti-CMV-MCS-GFP-SV-puro (#73582, addgene) to construct a plasmid overexpressing NRIP1. According to the instructions of the lentivirus packaging kit (YK-LVP-05, Qiangen Ink, China), the pLenti-CMV-MCS-GFP-SV-puro vector was co-transfected with pHelper 1.0 and pHelper 2.0 into 293T cells (Shanghai Institute of the Chinese Academy of Sciences). After 4 - 6 hours of transfection, the medium was replaced with complete medium. After culturing for 48 hours, the cell supernatant rich in virus particles was collected and concentrated to obtain a high-titer lentivirus concentrate. 24 hours before transfection, pancreatic islet β cells in the logarithmic growth phase were taken, digested with trypsin, resuspended in complete medium, and pipetted and mixed well to make a cell suspension. The cells (5×10 5 / well) were seeded into 6-well plates to ensure uniform distribution of the cells in the wells. 3 hours before transfection, the original medium was removed and replaced with fresh basal medium without antibiotics and serum. According to the grouping, the lentivirus transfection solution was prepared and added to the corresponding culture wells, gently shaken and mixed well, and then cultured at 37°C, 5% CO 2 , saturated humidity. After 4 - 6 hours, the transfection mixture was removed and replaced with fresh DMEM medium, and then the culture plate was placed in the incubator for 24 - 48 hours. The siRNAs for knocking down eva1c and NOD1 were purchased from Shanghai GenePharma Co., Ltd., and lipo2000 (11668019, sigma-Aldrich) was used to transfect the siRNAs for 24 - 48 hours.

[0055] After culturing and transfection, the cells were synchronized with sugar-free KRBB (Krebs-Ringer bicarbonate buffer, Macgene, CC013) for 3 - 6 hours, and then stimulated with low glucose (2.8 mM) and high glucose (16.7 mM) for 1 - 2 hours successively. The supernatant was collected for subsequent measurement of the insulin level in the supernatant. The supernatant was analyzed for secreted insulin level (Rat / Mouse Insulin ELISA Kit, Cat. no. EZRMI-13K) using an insulin ELISA kit according to the manufacturer's instructions. The insulin level secreted by isolated islets collected by centrifugation at 1,500 rpm for 10 minutes was normalized by the number of cells, and the insulin level secreted by INS-1 cells was normalized by the intracellular protein content.

[0056] 7. miRNA Sequencing Analysis and Second-Generation Transcriptome Analysis

[0057] The miRNA content in the blood and pancreatic tissues of mice fed with rice and its miRNA before and after feeding was measured using illumina hiseq 2500. The mRNA level of islet cells was measured using illumina novaseq 6000. The differential expression of miRNA and mRNA in the experimental group and the control group tissues was analyzed using DNAstar software (Lasergene), the gene heat map was drawn using JAVA Treeviewer software, and the GO functional clustering analysis was performed using the DAVID online analysis tool.

[0058] 8. Detection and Collection of Fluorescent Images

[0059] The metabolism and tissue localization of miRNA in mice were detected and traced using a small animal in vivo imager illumina3 (illumina 3, PE). The intracellular localization of miRNA was observed and detected using a fast super-resolution laser confocal microscope (LSM980, Zeiss), and the levels of mitochondrial ROS, mitochondrial membrane potential, and superoxide in cells were detected in combination with a flow cytometer BD FACSCalibur-2.

[0060] 9. Construction and Infection of Adeno-Associated Virus

[0061] miRNA168a (SEQ ID NO:3) was cloned into pCDNA3.1 for gene expression at the cellular level. An adeno-associated virus AAV-miR168a-5p expressing miRNA168a-5p (SEQ ID NO:4) was established by Shanghai GeneChem Co., Ltd.

[0062] For adenovirus infection of mice, 100 μL of high-titer adenovirus (1 × 10 12 colony-forming units / mL) was diluted in physiological saline and injected intraperitoneally into mice at a dose of 5 × 10 9 colony-forming units / kg body weight.

[0063] 10. In situ hybridization experiment

[0064] The slides were incubated in PBS (phosphate-buffered saline) containing 40 μg / mL proteinase K, then washed twice rapidly with glycine (0.2% w / v) in PBS for 1 minute each time, followed by two PBS washes (1 minute each). Then, the tissues were fixed in 10% formaldehyde for 10 minutes. Next, two PBS washes (1 minute each) were performed. Then, the sections were acetylated in a mixture of acetic anhydride and triethanolamine (a mixture of 48 ml water, 250 μl HCl, 300 μl acetic anhydride, and 670 μl triethanolamine) for 10 minutes. After this step, a series of PBS washes were performed, 2 minutes each. Next, two additional 5-minute washes were carried out in 5XSSC (sodium chloride-sodium citrate buffer). Then, the slides were immersed in preheated (37 °C) prehybridization buffer (650 ml ultrapure formamide, 250 ml of 20XSSC, 1 ml of Tween-20 (Fisher Scientific)), and 100 μg / ml yeast RNA was added. The slides were prehybridized in a humidified hybridization chamber at 37 °C for 3 hours. During hybridization, the same prehybridization buffer was used, but with the 5'-end of the Cy3-labeled antisense RNA probe. Tissue hybridization was carried out overnight at room temperature in a humidified chamber. The next day, the slides were sealed for detection.

[0065] 11. Histological analysis

[0066] The tissues to be examined were fixed overnight with 4% paraformaldehyde (pH 7.4), embedded in paraffin, sectioned into 5-μm-thick layers, and stained with hematoxylin-eosin. Oil red O staining was performed using a commercial kit (cat. no. BA-4081; Baso Diagnostic, Inc.). Images were taken with an EVOS FL Auto microscope (cat. no. AMAFD1000; Thermo Fisher Scientific, Waltham, MA).

[0067] 12. Delivery of the positive vector to miRNA168a

[0068] Use Engels Entranster-in vivo (18668-11-1, Engreen Biosystem Co., Ltd) to co-enter cells with the synthesized miRNA168a-5p (SEQ ID NO:1). Before the GTT experiment, mice were gavaged at a dose of 1 mg per mouse. After 30 minutes of gavage, the GTT experiment was conducted.

[0069] 13. Statistical analysis

[0070] Report statistical parameters and significance in the figures and legends. Data are expressed as mean ± SEM. Statistical analysis was performed using GraphPad Prism version 8.01. The Kolmogorov-Smirnov test was used to detect the normal distribution of the data set. Comparison between multiple groups was performed using one-way ANOVA followed by Tukey's multiple comparison test. Comparison between two or more groups at multiple time points was performed using two-way ANOVA followed by Sidak's or Tukey's multiple comparison test. Survival curves were evaluated using the log-rank (Mantel-Cox) test. No statistical method was used to pre-determine the sample size.

[0071] Example 1. Collection of miRNA sequencing data from human tissues

[0072] In this experiment, miRNA sequencing data from 11 different human tissues were collected from published data (SRR396642, SRR1028933, SRR1028929, etc.). The data were from human blood vessels, thyroid, normal human serum, type 2 diabetic serum, fatty liver patient serum, normal human nasal cavity, liver, lung, testis tissues, and human breast milk components, and were compared with the plant miRNA database (http: / / www.mirbase.org / ).

[0073] It was found that mature miRNA168a-5p was not only abundant in fresh rice, but also shared the same sequence in aged rice grains, rice flour, fresh corn, and even fresh wheat ( Figure 1 A). Surprisingly, the miRNA alignment also showed that miR168a-5p was present in the blood and islets of healthy and diabetic individuals. The level of miRNA168a in β cells was very high, even comparable to the level of hsa-let-7a, indicating the presence of a high level of miRNA168a in human primary β cells ( Figure 1 B)

[0074] Example 2. Localization of miRNA168a-5p

[0075] To further confirm the existence of this phenomenon in mammals, mice were fed with miRNA168a-5p (SEQ ID NO:2) labeled with a high concentration of Cy3 (10 mmol / kg), or miRNA168a precursor (10 mmol / kg), or fresh paddy rice (miRNA168a-5p is contained in the newly harvested seeds of Nipponbare) instead of feed, and then the pancreas of the mice was harvested after feeding. The imaging results of nude mice showed that mature miRNA168a-5p (red, indicated by arrows) was mainly localized in the digestive tract, including the stomach, intestine, and pancreas, after oral ingestion. However, the co-fed miRNA168a precursor did not show obvious pancreatic localization ( Figure 2 A). miRNA sequencing data also showed that miRNA168a-5p initiated from rice accumulated in the pancreas, blood, and urine in a time-dependent manner 5 days after rice feeding ( Figure 2 B). Therefore, in vivo tracking and exosome comparison indicated that mature miRNA168a-5p was transported from food through the pancreas.

[0076] Example 3.

[0077] To further study the function of the pancreas enriched with miRNA168a-5p, we used histological serial sections to observe the location of miRNA168a-5p in the pancreas harvested from miRNA168a-5p-Cy3-treated mice.

[0078] As Figure 3 shown in A, miRNA168a was mainly located in islet cells. Therefore, combined with human sequencing data, we highly suspected that orally administered miRNA168a might regulate blood glucose and insulin biological levels through pancreatic β-cell recruitment.

[0079] To verify this hypothesis, we co-cultured miRNA168a-5p-Cy3 (10 pmol / L) with human and rat pancreatic β-cells (the INS-1 cell line was a gift from Prof. Ian Sweet; https: / / uwmdi.org / faculty / ian-sweet-phd / , and the 1.1B4 cell line was purchased from the Kunming Cell Bank of the Chinese Academy of Sciences, KCB 2015017). As Figure 3 shown in B, through the green fluorescence-labeled cell membrane and purple fluorescence-labeled nucleus, it was visible that miRNA168a-5p had obvious cell membrane localization on the cells and formed a yellow overlay on the membrane. A part of miRNA168a-5p had entered the 1.1B4 cells through the cell membrane within 30 minutes. By 6 hours, most of the miRNA168a-5p-Cy3 had re-localized from the cell membrane to the cytoplasm ( Figure 3B). These results reconfirmed the phenomenon of the relocation of miRNA168a from ingested rice to pancreatic islet cells.

[0080] Example 4.

[0081] Control feed (without miRNA168a-5p), fresh rice (rich in miRNA168a-5p), aged rice (with more than half of miRNA168a-5p degraded), and rice with different doses of miRNA168a were selected.

[0082] The researchers established an adeno-associated virus (AAV) vector carrying a mammalian-modified miRNA168a (SEQ ID NO:4) to highly express miRNA168a-5p in mice. The same weight of rice and control feed (1.5 g / animal / day) was weighed, and mice were fed a fixed weight of food every day. The concentrations of miRNA168a-5p in the food were in the order of control feed < aged rice < fresh rice < AAV transfection ( Figure 4 , and the use concentration of AAV is shown in the construction and infection of adeno-associated virus). One week after intraperitoneal infection of mice with AAV, the changes in random blood glucose were recorded, and the blood glucose of mice was detected by tail bleeding. The results showed that:

[0083] When normal mice ate the same mass of rice rich in miRNA168a-5p, their food intake and body weight did not change with different foods ( Figure 4 A and 4B). The circulating miRNA168a level in mice fed fresh rice was 1-fold higher than that in mice fed aged rice. There was little miRNA168a-5p in the blood of mice fed fresh rice, while AAV-miRNA168a-5p could increase the miRNA168a-5p in the blood by 5-fold. This means that the dose of miRNA168a-5p depends on the efficiency of rice ingestion and AAV overexpression in mice, and the absorbed miRNA168a-5p in mice also shows a dose-dependent relationship. With the increase of miRNA168a in mice, both the intake of miRNA168a and the expression of AAV-miRNA168a-5p caused a significant decrease in blood glucose and an increase in blood insulin level, and were not affected by the glucose tolerance test and insulin tolerance test ( Figure 4C and 4D, see the detection of mouse glycolipid metabolism indicators for the steps). In addition, we found that insulin levels were significantly increased in miRNA168a-overexpressing mice. To further explore the source of the increased insulin levels, pancreatic islets were harvested in vivo, and the distribution of insulin and miRNA168a-5p in pancreatic islets was traced by in situ hybridization and immunofluorescence (IF) techniques. The results showed that highly expressed miRNA168a-5p was concentrated in pancreatic islets and co-localized with insulin-labeled β-cells. In addition, insulin levels in β-cells increased significantly with the increase in miRNA168a-5p ( Figure 4 E). Taken together, these data indicate that miRNA168a-5p in food localizes to pancreatic islet cells, regulating β-cell insulin levels and whole-body glucose homeostasis in mice.

[0084] Example 5.

[0085] We used the miRanda miRNA binding site prediction software to predict 7 potential target genes, including human genes NRIP1, eva1c, Map11, Myo5a, Ube2e2, ldlrap1, SPEN (Genbank accession numbers are: NG_050643, NC_000021.9, NC_000007.14, NC_000015.10, NC_000003.12, NC_000001.11). After transfection with miRNA168a, the qRT-PCR results of the cells showed that, except for the gene NRIP1, the other 6 genes were enriched, but only the gene eva1c was significantly downregulated when cultured with miRNA168a-5p in two pancreatic islet cell lines (INS-1 and 1.1B4 cell lines). In addition, sequence alignment showed that the gene eva1c in each species might share the same seed sequence to bind miRNA168a-5p ( Figure 5 A). In addition, pancreatic islet NOD1, as a regulator of insulin levels and diabetes, might serve as a downstream link of eva1c predicted in Genemania Downstream prediction (http: / / genemania.org / search / homo-sapiens / eva1c, Figure 5 B). These results suggest that eva1c / NOD1 might be the signal transduction pathway for miRNA168a-5p to regulate insulin and metabolism.

[0086] Example 6.

[0087] Normal C57BL mice were fed rice containing a dose gradient of miRNA168a-5p (see Example 4) for one week to observe the effect of miRNA168a-5p on the eva1c / NOD1 signaling pathway. Immunohistochemical staining showed abundant expression of eva1c and NOD1 in pancreatic islet β cells. Western blot and immunohistochemical staining of pancreatic eva1c and NOD1 indicated that miRNA168a-5p increased the level of NOD1 in the islets while decreasing the level of islet eva1c( Figure 6 A-6C).

[0088] Example 7.

[0089] Next, we monitored whether NOD1 was involved in miRNA168a-5p-mediated insulin content and secretion.

[0090] Refer to cell culture and cell transfection. Co-transfection of eva1c-fluo (the eva1c gene was constructed into the pGL3-basic (#40342, addgene) vector to obtain eva1c-fluo) and miR168a-5p on Hela cells showed a significant decrease in luciferase mediated by eva1c expression. However, when the core binding region "CCAAGCG" of the eva1c gene was mutated to "CCATTTG", the inhibitory effect of miR168a on eva1c expression disappeared ( Figure 7 A). This result indicated that the seed sequence (2-8nt, SEQ ID NO:1) of miR168a-5p was the key binding domain that bound to eva1c mRNA and exerted its function. Subsequently, rat pancreatic islet β cells (INS-1) and human islet cells (1.1B4) were transfected with miR168a-5p and the eva1c gene respectively. The results showed that miR168a-5p could significantly reduce the level of eva1c in isolated rat and human islet cells while increasing the expression of NOD1. Supplementing eva1c could reverse the increased expression of eva1c by miR168a ( Figure 7 B-7D). In INS-1 cells, compared with scrambled miRNA, miRNA168a-5p could increase insulin secretion under both 2.8 mM or 16.7 mM glucose stimulation. Overexpression of eva1c decreased the level of NOD1 and miRNA168a-5p-induced insulin secretion, while knockdown of eva1c increased the insulin secretion level of INS-1 cells (refer to cell culture and cell transfection, Figure 7 E). In addition, knockdown of NOD1 also decreased insulin secretion, but neither silencing of miRNA168a-5p nor eva1c could restore the insulin level in NOD1-silenced β cells (refer to cell culture and cell transfection,Figure 7 F). These in vivo and in vitro data indicate that miRNA168a-5p promotes the function of pancreatic islet β cells through the eva1c / NOD1 signaling pathway.

[0091] Example 8.

[0092] Although both in vivo and in vitro data suggest that dietary miRNA168a-5p is a potential regulator of glucose metabolism, whether long-term use of miRNA168a-5p is safe and effective in alleviating hyperglycemia remains unclear. To address this important issue, we generated transgenic rice carrying Nipponbare calli (see Construction and identification of transgenic calli).

[0093] The expression levels of miRNA168a-5p were comparable in miRNA168a-5p knockout (KO) calli, miRNA168a-5p overexpression (OE) calli, and WT calli, and were similarly controlled by miRNA168a expression ( Figure 8 A, see Construction and identification of transgenic calli for specific operations).

[0094] Gene-edited calli were ground evenly with water every two days and then infused into db / db mice for one week. Although there were no miRNA-dependent differences in body weight or food intake ( Figure 8 B and 8C), transgenic rice feeding of miRNA168a OE for one week in db / db mice produced significant benefits ( Figure 8 D). Treatment with miRNA168a-5p reduced hyperglycemia from 25 mM to nearly 15 mM, but miRNA168a KO calli did not have this hypoglycemic effect ( Figure 8 D).

[0095] Example 9.

[0096] To further demonstrate the effect of long-term miRNA168a, we also injected AAV carrying the miRNA168a gene for local overexpression of miRNA168a-5p in the islets (5*10 9 pfu / kg, Figure 9 A). With body weight kept constant, islet miRNA168a-5p OE significantly and continuously reduced fasting and random blood glucose ( Figure 9 B and 9C). miRNA168a-5p OE significantly regulated fasting and postprandial glucose and insulin in db / db mice ( Figure 9D and 9E). Insulin secretion tests, glucose tolerance tests, and insulin sensitivity tests showed that miRNA168a-5p improved insulin secretion and glucose tolerance, reduced hyperglycemia, and increased the survival rate of db / db mice, while insulin sensitivity remained unchanged ( Figure 9 F, 9G, and 9H).

[0097] Therefore, long-term treatment with miRNA168a-5p effectively improved hyperglycemia in diabetic db / db mice by promoting insulin secretion with good safety.

[0098] Example 10.

[0099] Since miRNA168a-5p showed hypoglycemic effects, we speculated that the level of this miRNA168a-5p might be related to body weight, insulin level, and the progression of type II diabetes.

[0100] To explore this relationship, we recruited 20 patients newly diagnosed with diabetes and obtained their sera. The level of miRNA168a-5p in the sera of patients with type II diabetes was detected by qRT-PCR and analyzed in combination with clinical data. The results showed that circulating miRNA168a-5p was negatively correlated with the patients' BMI, fasting blood glucose level (bloodglucose), and triglyceride (TG) level, and was positively correlated with the patients' blood insulin level (insulin) ( Figure 10 A-10D). These data indicated a strong correlation between diet-derived miRNA168a-5p and glycemic control in patients with type II diabetes.

[0101] Example 11.

[0102] To further simulate the pathological process of human diabetes, a high-fat diet (HFD) containing 60% fat was fed to C57BL / 6J mice to induce the occurrence of metabolic syndrome in the mice. The distribution and localization of miRNAs were observed, and the expression of miRNA168a-5p was mainly located in the circulatory system, intestine, and pancreas ( Figure 11 A). Although there was no difference in basal food intake, when the mice were fed a high-fat diet for 8 weeks, the pre-expressed miRNA168a-5p had an obvious protective effect ( Figure 11 B-11D). Within just 10 weeks, HFD led to increased fasting and postprandial blood glucose levels in WT mice, but had no effect on AAV-miR168a-5p transfected mice ( Figure 11 C and 11D). With continuous feeding of the high-fat diet, HFD gradually caused obesity, glucose intolerance, and insulin resistance in the mice (Figure 11 C, 11E, and 11G). Sustained transfection of AAV-miRNA168a and long-term expression of miRNA168a-5p effectively improved HFD-induced obesity ( Figure 11 C) and glucose metabolism defects ( Figure 11 E and 11G). However, short-term overexpression of miRNA168a-5p did not affect changes in body weight and insulin sensitivity. It was not until the 25th week of long-term overexpression of miRNA168a-5p that there were effects of weight loss and improved insulin sensitivity ( Figure 11 F and Figure 11 G).

[0103] These results suggest great potential for using AAV to overexpress miRNA168a-5p in the treatment of diet-induced hyperglycemia, lipid metabolism disorders, obesity and other diseases, highlighting a potential treatment strategy, especially for diabetes-related metabolic disorders.

[0104] Example 12.

[0105] C57BL / 6J mice were fed a high-fat diet (HFD) containing 60% fat to induce the occurrence of metabolic syndrome in the mice. As the intervention time of miRNA168a-5p was extended, blood indexes measured after 35 weeks of feeding showed that triglycerides, cholesterol, and non-esterified fatty acids in the blood of AAV-miR168a-5p-transfected mice were significantly reduced ( Figure 12 A, 12B, and 12C), indicating that miRNA168a-5p expression has an obvious lipid-lowering effect in diabetic mice.

[0106] Example 13.

[0107] Since the mechanism of miRNA168a targeting ev1ac / NOD1 signaling is different from that of current clinical hypoglycemic drugs, it has the potential for additive effects with other clinical anti-diabetic drugs (including GLP-1 receptor agonist (Exendin-4) and metformin).

[0108] As Figure 13 shown in the experimental procedure in A, callus overexpressing miRNA168a and metformin were intragastrically administered every other day. We observed that the miRNA168a transgenic food itself could reduce blood glucose levels ( Figure 13 B). Moreover, there was an additive effect of miRNA168a with other clinical anti-diabetic drugs. Exendin-4 and metformin both significantly reduced hyperglycemia to 16.4 mM and 18.32 mM, respectively ( Figure 13C and 13D). After feeding with miRNA168a callus, the blood glucose of db / db mice decreased to less than 10 mM ( Figure 13 C and 13D), these results strongly suggest that transgenic foods rich in miRNA168a have broad application prospects in clinical applications.

[0109] Example 14.

[0110] Load miRNA168a-5p (SEQ ID NO:2) with positive ions and intragastrically administer it to mice at 1 mg / kg before detecting glucose tolerance (see the delivery of miRNA168a by positive vectors). After 30 minutes, detect the changes in glucose tolerance of mice. The results show that it can also significantly reduce the blood glucose of mice and improve the impaired glucose tolerance of HFD and db / db mice ( Figure 14 ). It shows that using drug delivery of miRNA168a-5p can also improve the symptoms of diabetes and reduce blood glucose.

[0111] Example 15.

[0112] Overexpress eva1c at the Hela cell level and co-transfect osa (rice)-miR168a-5p, sly (tomato)-miR168a-5p, rad (white radish)-miR168a-5p at the same time. The results show that miR168a-5p (SEQ ID NO:2, 16, 18) with the same seed sequence can inhibit the expression of eva1c mRNA and protein levels ( Figure 15 ). This result suggests that miRNA168a-5p from other species has a similar function to rice miRNA168a-5p and regulates the eva1c / NOD1 pathway. We speculate that miRNA168a-5p from different species with some differences at the 3' end may all play a similar role in regulating glucose and lipid metabolism in mice.

[0113] References:

[0114] 1. Jia W, Weng J, Zhu D, Ji L, Lu J, Zhou Z, Zou D, Guo L, Ji Q, Chen L, Chen L, Dou J, Guo X, Kuang H, Li L, Li Q, Li X, Liu J, Ran X, Shi L, Song G, Xiao X, Yang L, Zhao Z, Chinese Diabetes S. Standards of medical care for type 2 diabetes in China 2019. Diabetes Metab Res Rev 2019, 35(6): e3158.

[0115] 2. Chinese Elderly Type 2 Diabetes P, Treatment of Clinical Guidelines Writing G, Geriatric E, Metabolism Branch of Chinese Geriatric S, Geriatric E, Metabolism Branch of Chinese Geriatric Health Care S, Geriatric Professional Committee of Beijing Medical Award F, National Clinical Medical Research Center for Geriatric D. [Clinical guidelines for prevention and treatment of type 2 diabetes mellitus in the elderly in China (2022 edition)]. Zhonghua Nei Ke Za Zhi 2022, 61(1): 12 - 50.

[0116] 3. Chen X, Ba Y, Ma L, Cai X, Yin Y, Wang K, Guo J, Zhang Y, Chen J, Guo X, Li Q, Li X, Wang W, Zhang Y, Wang J, Jiang X, Xiang Y, Xu C, Zheng P, Zhang J, Li R, Zhang H, Shang X, Gong T, Ning G, Wang J, Zen K, Zhang J, Zhang CY. Characterization of microRNAs in serum: a novel class of biomarkers for diagnosis of cancer and other diseases. Cell Res 2008, 18(10): 997-1006.

[0117] 4. Zhang L, Hou D, Chen X, Li D, Zhu L, Zhang Y, Li J, Bian Z, Liang X, Cai X, Yin Y, Wang C, Zhang T, Zhu D, Zhang D, Xu J, Chen Q, Ba Y, Liu J, Wang Q, Chen J, Wang J, Wang M, Zhang Q, Zhang J, Zen K, Zhang CY. Exogenous plant MIR168a specifically targets mammalian LDLRAP1: evidence of cross-kingdom regulation by microRNA. Cell Res 2012, 22(1): 107-126.

[0118] 5. Liang G, Zhu Y, Sun B, Shao Y, Jing A, Wang J, Xiao Z. Assessing the survival of exogenous plant microRNA in mice. Food Sci Nutr 2014, 2(4): 380-388.

[0119] 6. Yang J, Farmer LM, Agyekum AA, Elbaz-Younes I, Hirschi KD. Detection of an Abundant Plant-Based Small RNA in Healthy Consumers. PLoS One 2015, 10(9): e0137516.

[0120] 7. Yang J, Farmer LM, Agyekum AA, Hirschi KD. Detection of dietary plant-based small RNAs in animals. Cell Res 2015, 25(4): 517-520.

[0121] 8. Sanchita, Trivedi R, Asif MH, Trivedi PK. Dietary plant miRNAs as an augmented therapy: cross-kingdom gene regulation. RNA Biol 2018, 15(12): 1433-1439.

[0122] 9. Beatty M, Guduric-Fuchs J, Brown E, Bridgett S, Chakravarthy U, Hogg RE, Simpson DA. Small RNAs from plants, bacteria and fungi within the order Hypocreales are ubiquitous in human plasma. BMC Genomics 2014, 15: 933.

[0123] 10. Yang J, Hotz T, Broadnax L, Yarmarkovich M, Elbaz-Younes I, Hirschi KD. Anomalous uptake and circulatory characteristics of the plant-based small RNA MIR2911. Sci Rep 2016, 6: 26834.

[0124] 11. Pastrello C, Tsay M, McQuaid R, Abovsky M, Pasini E, Shirdel E, Angeli M, Tokar T, Jamnik J, Kotlyar M, Jurisicova A, Kotsopoulos J, El-Sohemy A, Jurisica I. Circulating plant miRNAs can regulate human gene expression in vitro. Sci Rep 2016, 6: 32773.

[0125] 12. Chin AR, Fong MY, Somlo G, Wu J, Swiderski P, Wu X, Wang SE. Cross-kingdom inhibition of breast cancer growth by plant miR159. Cell Res 2016, 26(2): 217-228.

[0126] 13. Fabbri M, Paone A, Calore F, Galli R, Gaudio E, Santhanam R, Lovat F, Fadda P, Mao C, Nuovo GJ, Zanesi N, Crawford M, Ozer GH, Wernicke D, Alder H, Caligiuri MA, Nana-Sinkam P, Perrotti D, Croce CM. MicroRNAs bind to Toll-like receptors to induce prometastatic inflammatory response. Proc Natl Acad Sci U S A 2012, 109(31): E2110-2116.

[0127] 14. Mlotshwa S, Pruss GJ, MacArthur JL, Endres MW, Davis C, Hofseth LJ, Pena MM, Vance V. A novel chemopreventive strategy based on therapeutic microRNAs produced in plants. Cell Res 2015, 25(4): 521-524.

[0128] 15. Hou D, He F, Ma L, Cao M, Zhou Z, Wei Z, Xue Y, Sang X, Chong H, Tian C, Zheng S, Li J, Zen K, Chen X, Hong Z, Zhang CY, Jiang X. The potential atheroprotective role of plant MIR156a as a repressor of monocyte recruitment on inflamed human endothelial cells. J Nutr Biochem 2018, 57: 197-205.

[0129] 16. Akao Y, Kuranaga Y, Heishima K, Sugito N, Morikawa K, Ito Y, Soga T, Ito T. Plant hvu-MIR168-3p enhances expression of glucose transporter 1 (SLC2A1) in human cells by silencing genes related to mitochondrial electron transport chain complex I. J Nutr Biochem 2022, 101: 108922.

[0130] Sequence Listing:

[0131] SEQ ID NO:1, 2-8 nt sequence (seed sequence) of miRNA168a-5p

[0132] CGCUUGG

[0133] SEQ ID NO:2, Sequence of rice (Oryza sativa) miRNA168a-5p

[0134] UCGCUUGGUGCAGAUCGGGAC

[0135] SEQ ID NO:3, Precursor sequence of rice miRNA168a

[0136] cgccucgggc UCGCUUGGUGCAGAUCGGGAC ccgccgccgccgcugccggggccg GAUCCCGCCUUGC ACCAAGUGAAU cggagccg

[0137] SEQ ID NO:4, Precursor sequence of miRNA168a expressed in animals after modification:

[0138] atgctgTCGCTTGGTGCAGATCGGGACgttttggccactgactgacGTCCCGATGCACCAAGCGAcaggac

[0139] SEQ ID NO:5, Sequence of sorghum (Sorghum bicolor) miRNA168a-5p

[0140] UCGCUUGGUGCAGAUCGGGAC

[0141] SEQ ID NO:6, Sequence of white sugarcane (Saccharum officinarum) miRNA168a-5p

[0142] UCGCUUGGUGCAGAUCGGGAC

[0143] SEQ ID NO:7, Sequence of sugarcane (Saccharum sp.) miRNA168a-5p

[0144] UCGCUUGGUGCAGAUCGGGAC

[0145] SEQ ID NO:8, Sequence of maize (Zea mays) miRNA168a-5p

[0146] UCGCUUGGUGCAGAUCGGGAC

[0147] SEQ ID NO:9, Sequence of Aegilops tauschii miRNA168a-5p

[0148] UCGCUUGGUGCAGAUCGGGAC

[0149] SEQ ID NO:10, Sequence of Brachypodium distachyon miRNA168a-5p

[0150] UCGCUUGGUGCAGAUCGGGAC

[0151] SEQ ID NO:11, Sequence of Hordeum vulgare miRNA168a-5p

[0152] UCGCUUGGUGCAGAUCGGGAC

[0153] SEQ ID NO:12, Sequence of Arabidopsis lyrata miRNA168a-5p

[0154] UCGCUUGGUGCAGGUCGGGAA

[0155] SEQ ID NO:13, Sequence of Arabidopsis thaliana miRNA168a-5p

[0156] UCGCUUGGUGCAGGUCGGGAA

[0157] SEQ ID NO:14, Sequence of Brassica rapa miRNA168a-5p

[0158] UCGCUUGGUGCAGGUCGGGAA

[0159] SEQ ID NO:15, Sequence of Populus trichocarpa miRNA168a-5p

[0160] UCGCUUGGUGCAGGUCGGGAA

[0161] SEQ ID NO:16, Sequence of Solanum lycopersicum miRNA168a-5p

[0162] UCGCUUGGUGCAGGUCGGGAC

[0163] SEQ ID NO:17, Sequence of Vriesea carinata miRNA168a-5p

[0164] UCGCUUGGUGCAGGUCGGGAA

[0165] SEQ ID NO:18, Sequence of radish miRNA168a-5p

[0166] UCGCUUGGUGCAGUUCGGGAC

[0167] guideRNA target 1: gggctcgcttggtgcagatc ggg, SEQ ID NO:19;

[0168] guideRNA target 2: ccgccttgcaccaagtgaat cgg, SEQ ID NO:20

[0169] Forward primer:

[0170] CgatGGTCTCacaacttttaaatgtgttagtatgtttttaaaaaaaatgcgaaggaact, SEQ IDNO:21

[0171] Reverse primer:

[0172] CagtGGTCTCatacaaccaaactcaggatagccaccaaaaattaggggaaattccaact, SEQ IDNO:22.

Claims

1. Use of miRNA168a or miRNA168a-5p in the preparation of a drug for lowering blood glucose content in a mammal, wherein the sequence of miRNA168a is shown in SEQ ID NO: 4, and the sequence of miRNA168a-5p is shown in SEQ ID NO:

2.

2. The use according to claim 1, wherein the mammal is a human.

3. Use of miRNA168a or miRNA168a-5p in the preparation of a drug for treating hyperglycemia, wherein the sequence of miRNA168a is shown in SEQ ID NO: 4, and the sequence of miRNA168a-5p is shown in SEQ ID NO:

2.

4. Use of miRNA168a or miRNA168a-5p in the preparation of a drug for treating diabetes, wherein the sequence of miRNA168a is shown in SEQ ID NO: 4, and the sequence of miRNA168a-5p is shown in SEQ ID NO:

2.

5. The use according to claim 4, wherein the diabetes is type II diabetes.

6. Use of miRNA168a or miRNA168a-5p in the preparation of a drug for treating obesity induced by a high-fat diet, wherein the sequence of miRNA168a is shown in SEQ ID NO: 4, and the sequence of miRNA168a-5p is shown in SEQ ID NO:

2.

7. Use of an adeno-associated virus vector comprising miRNA168a in the preparation of a drug for lowering blood glucose levels in mammals, wherein the sequence of the miRNA168a is shown in SEQ ID NO:

4.

8. Use of a plant comprising miRNA168a-5p in the preparation of a medicament for lowering blood sugar content in a mammal, wherein the sequence of miRNA168a-5p is shown in SEQ ID NO: 2, and the plant is rice.

9. The use according to claim 7 or 8, wherein the mammal is a human.

10. Use of miRNA168a or miRNA168a-5p in preparing a plant for lowering blood sugar in a mammal, characterized in that Overexpressing miRNA168a or miRNA168a-5p in a plant containing miRNA168a-5p, wherein the sequence of miRNA168a is shown in SEQ ID NO: 4, and the sequence of miRNA168a-5p is shown in SEQ ID NO: 2, and the plant is selected from rice, sugarcane, corn, Aegilops tauschii, Brachypodium distichum, barley, and sorghum.

11. The use according to claim 10, wherein the mammal is a human.

12. The use according to claim 10, wherein the overexpression is performed by transfecting plants with an expression vector comprising miRNA168a or miRNA168a-5p.

13. The use according to claim 10, wherein the sugarcane is white sugarcane.

Citation Information

Patent Citations

  • Improved methods controlling gene expression

    CN101203611A