A strain of Acremonium schrenkiana WS-21 and its application in controlling wheat powdery mildew

Abstract

The invention discloses a strain of Acremonium crossbranch WS-21 and its application in preventing and controlling wheat powdery mildew, belonging to the technical field of plant disease biological control. The invention discloses a strain of Acremonium crossbranch WS-21 of the genus Broomrape, and the deposit number is CGMCC No.41343. The Acremonium crossbranch WS-21 of the genus Broomrape disclosed by the invention has a good inhibitory effect on the spore germination of wheat powdery mildew, and has a better field control effect compared with chemical agents, and can be used for the prevention and control of wheat powdery mildew. The spore germination inhibition rate of wheat powdery mildew can reach up to 87.29%, and the field control effect reaches 70.03%; at the same time, the antibacterial rates of the strain to Pseudomonas graminearum and Fusarium graminearum are 68.50% and 78.99% respectively, with good antagonistic effect, providing new strain resources for the development of biological bacterial agents with broad-spectrum antibacterial activity.

Description

Technical Field

[0001] The invention relates to the technical field of plant disease biocontrol, and more specifically to a strain of Acremonium schrenckii WS-21 and application thereof in preventing and controlling wheat powdery mildew. Background Art

[0002] Wheat powdery mildew is one of the important diseases in wheat production and is common worldwide. In recent years, with the promotion of dwarf varieties, the improvement of irrigation and water and fertilizer conditions, the increase in the multiple cropping index, and the fact that most of the promoted varieties in actual production are susceptible varieties, wheat powdery mildew has been widely reported in the vast wheat-growing areas. At present, the prevention and control of wheat powdery mildew mainly relies on chemical pesticides. However, the long-term application of chemical agents will increase the risk of pathogen resistance to fungicides, leading to a continuous increase in the number of chemical application and drug concentration; coupled with the phenomenon of excessive use of drugs in actual agricultural operations, it leads to a waste of manpower, material and financial resources, and also poses a hidden danger to the environment and the safety of humans and animals. Therefore, the research and development of safe, efficient and pollution-free biological control agents has become a major focus in solving the prevention and control of wheat powdery mildew.

[0003] Many researchers have carried out the screening and identification of wheat powdery mildew biocontrol bacteria. At present, several potential biocontrol strains that have an inhibitory effect on the germination of wheat powdery mildew spores and have a good control effect on powdery mildew in indoor potted plants have been isolated and identified; these include actinomycetes, Trichoderma, yeast, and Nocardia spp. However, due to the constraints of complex environmental factors in the field on the biocontrol effect of biocontrol bacteria, the stability and control effect of biocontrol bacteria in the field are poor. At present, there is a lack of efficient and practical biocontrol bacteria in production practice, which limits the development of research on biological control of wheat powdery mildew. The development of efficient and stable biocontrol bacteria and microbial agents is still the primary task to solve the problem of wheat powdery mildew biocontrol. Up to now, the application of Acremonium crossbranch of the genus Cladosporium to the control of wheat powdery mildew has not been reported at home and abroad.

[0004] Therefore, providing a strain of Acremonium alternifolium WS-21 and its application in preventing and controlling wheat powdery mildew is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0005] In view of this, the present invention provides a strain of Acremonium crossbranchii WS-21 and its application in preventing and controlling wheat powdery mildew, solving the problem of insufficient quantity and prevention effect of existing wheat powdery mildew biological agents. The fermentation liquid extract of Acremonium crossbranchii of the genus Scoparia has a significant inhibitory effect on the conidia of wheat powdery mildew, and the control effect of its fermentation liquid on wheat powdery mildew in the field can reach 70%, which can be developed and utilized as an excellent biological agent resource.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] A strain of Sarocladium implicatum WS-21, with a deposit number of CGMCCNo.41343, has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, referred to as CGMCC, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is June 20, 2024, and the classification name is Sarocladium implicatum.

[0008] Furthermore, the strain Acremonium alternifolium WS-21 is used in preventing and controlling wheat powdery mildew.

[0009] Furthermore, the strain Acremonium WS-21 is used in preventing and controlling Fusarium graminearum and Pseudoceromyces graminearum.

[0010] Furthermore, a microbial agent contains the Acremonium schrenkiana WS-21.

[0011] Further, the preparation method of a microbial agent comprises the following specific steps: inoculating Acremonium crossbranchii WS-21 on a PDA culture medium, culturing in a mold incubator at 25°C for 5 days to prepare seed bacteria; inoculating 10 seed bacteria blocks with a diameter of 6 mm in a 150 mL YPB culture medium, and shaking and fermenting in liquid at 25°C and 180 rpm for 15 days to form a fermentation liquid, and obtaining a fermentation liquid agent; the concentration of live bacteria of Acremonium crossbranchii WS-21 of the genus Broomrape in the agent is 5×10 8 CFU / mL.

[0012] Furthermore, the method for using the microbial agent comprises the following specific steps: diluting the agent 10 times with sterile water to make the concentration of live bacteria in the dilution liquid 5×10 7 CFU / mL, sprayed on wheat leaves at the adult stage, every 1m 2 The dosage of wheat field fungus agent is 60mL.

[0013] It can be seen from the above technical scheme that compared with the prior art, the present invention discloses a strain of Acremonium crossbranching WS-21 and its application in preventing and controlling wheat powdery mildew, which has the following beneficial effects: the fermentation liquid extract of Acremonium crossbranching WS-21 of the genus Scopulariopsis of the present invention has an inhibition rate of 87.29% on the conidia germination of wheat powdery mildew; the fermentation liquid of Acremonium crossbranching WS-21 of the genus Scopulariopsis is used for the prevention and control of wheat powdery mildew caused by infection of wheat powdery mildew, and the prevention effect in the field adult stage is 70.03%.

[0014] The fermentation broth extract of Acremonium WS-21 of the genus Scopulariopsis has good antagonistic effects on the main pathogens of wheat, Fusarium graminearum (which causes stem base rot and fusarium head blight of wheat) and Fusarium graminearum (which causes fusarium head blight of wheat), provides a new strain resource for the development of biological bacterial agents with broad-spectrum antibacterial activity, and has good research and application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0016] Figure 1 The accompanying drawing shows an inhibition test of the fermentation broth extract of Acremonium WS-21 of the genus Sphaerocephala on the germination of conidia of wheat powdery mildew;

[0017] Among them, a: water agar medium control; b: extract of fermentation broth after shaking culture for 3 days; c: extract of fermentation broth after shaking culture for 7 days; d: extract of fermentation broth after shaking culture for 11 days; e: extract of fermentation broth after shaking culture for 15 days;

[0018] Figure 2 The accompanying drawing shows the colony morphology of Acremonium WS-21 of the genus Acremonium of the present invention;

[0019] Among them, a: colony morphology under solid culture conditions; b: microscopic observation under solid culture conditions; c: microscopic observation of morphology under liquid culture conditions;

[0020] Figure 3 The accompanying drawing shows the antibacterial spectrum of Acremonium WS-21 of the genus Acremonium of the present invention;

[0021] Among them, 1: Pseudomonas graminearum 14LY24-2; 2: Fusarium graminearum 14ZK1-4; a: normal PDA culture control; b: liquid YPB culture medium; c: 11-day fermentation broth extract treatment; d: 15-day fermentation broth extract treatment. DETAILED DESCRIPTION

[0022] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0023] PDA medium: 200 g potato, 20 g glucose, 20 g agar powder, add distilled water to 1000 mL, natural pH, sterilize at 121°C for 30 min.

[0024] YPB medium: 10 g yeast extract, 20 g peptone, 20 g glucose, add distilled water to 1000 mL, natural pH, sterilize at 121 °C for 30 min.

[0025] Example 1 Identification of Sarocladium implicatum WS-21

[0026] (1) Isolation and purification of the biocontrol fungus Acremonium WS-21 of the genus Cladosporium

[0027] Use a sterilized scalpel to scrape the abnormally growing powdery mildew conidia, smear them on the PDA medium, and culture them in the mold incubator at 25°C in the dark for 5 days. Use a sterile toothpick to pick the isolate grown in the medium and transfer it to the medium PDA, repeat once for purification, and obtain the purified Acremonium of the genus Acropora. Morphological characteristics and microscopic observations were performed.

[0028] (2) Extraction of the fermentation broth extract of Acremonium WS-21

[0029] The purified Acremonium WS-21 of the genus Cladosporium was inoculated on PDA culture medium and solid cultured in a mold incubator at 25°C for 5 days. The pathogen colonies were punched into circular mycelium blocks with a diameter of 6 mm using a sterilized puncher. Ten blocks with a diameter of 6 mm were inoculated into 150 mL YPB culture medium and liquid culture was carried out by shaking at 25°C and 180 rpm. The fermentation broth of 3, 7, 11 and 15 days of shaking culture was taken from the clean bench, first filtered with four layers of sterile gauze and then filtered again with a 0.2 μm filter to obtain the fermentation broth extract of the biocontrol bacteria WS-21.

[0030] (3) Germination inhibition test of wheat powdery mildew conidia

[0031] The spore germination test was carried out by slide culture. The specific steps are as follows: first, 0.5% water agar was prepared in a triangular flask and melted in a microwave oven for later use. 800 μL of the filtered biocontrol bacteria WS-21 fermentation broth extract and 800 μL of unsolidified water agar were mixed in a 2mL centrifuge tube at a ratio of 1:1, and then applied on a slide. The water agar medium was used as a control, and 3 replicates were set for each group. After the culture medium solidified, the spore sedimentation method was used to inoculate wheat powdery mildew (the strain was E09, donated by Researcher Zhou Yilin of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences, and propagated on the susceptible variety Jinfeng No. 1 for later use). The specific steps of inoculation are as follows: first, place the slide with the culture medium on the laboratory table, cover it with a long cylindrical device (about 25 cm in diameter and 80-90 cm in height), dig a small hole on the wall near the top of the device, take 2 mg of fresh wheat powdery mildew conidia with a clean key, place it in the small hole, blow off the conidia, and make the spores fall evenly on the slide below. Then place it in a freezing box with filter paper moisturizing, and culture it in the dark at 18°C ​​for 24 hours. Microscopic examination, record the germination rate of wheat powdery mildew conidia, and calculate the spore germination inhibition rate according to the following formula.

[0032] Spore germination inhibition rate calculation formula:

[0033] Spore germination inhibition rate (%) = (control germination rate - treatment germination rate) / control germination rate × 100

[0034] The results are shown in Table 1 and Figure 1 .

[0035] Table 1 Results of inhibition rate of WS-21 fermentation broth extract on spore germination of wheat powdery mildew

[0036]

[0037] Table 1 and Figure 1 The results showed that the extracts of the fermentation broth of the biocontrol bacteria WS-21 had different degrees of inhibitory effects on the germination of conidia of wheat powdery mildew. Among them, the inhibitory rate of the extracts of the fermentation broth after 15 days of fermentation on the germination of conidia of wheat powdery mildew was as high as 87.29%.

[0038] (4) Identification of biocontrol bacteria

[0039] Through the cultivation, microscopic morphological observation and molecular biological identification of the biocontrol fungus WS-21, it was determined to be Sarocladium implicatum. Sarocladium implicatum forms white colonies with irregular shapes on the culture medium; microscopic observation of PDA solid and YPB liquid cultures shows Figure 2 .

[0040] The strain WS-21 was amplified and sequenced using ITS primers to obtain the sequence SEQ ID NO.1.

[0041] The ITS primer sequences are as follows:

[0042] ITS1:TCCGTAGGTGAACCTGCGG;SEQ ID NO.2;

[0043] ITS4: TCCTCCGCTTATTGATATGC; SEQ ID NO.3.

[0044] The results of ITS sequencing are:

[0045] CCCACTGTGAACATACCTACGTTTCCCCTCGGCGGGCTCAGCGTTGCGGTTCTGCCGCCTCGCGTCCGCCGGGGGCACCCAAACTCGAATTTATATCGTGTATCTCTGAGGGGCGAAAGCCCGTAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCT TTGAACCGCACATTGCGCCCGCCGGCACTCCGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGGGCCCACCCCTCGCGGGGAACGGGCCCGGCGTTGGGGACCGGAGGCCGCCCCGGCGGCACCCGCCCCCTAAATTCAGTGGCGGTCGCGCCGCAGCCTCCCCTGCGTAGTAGCACACCTCGCACCGGAGAGCGGCACGGCCACGCCTCGAAACCCCCCAATTTTTCAGGT; SEQ ID NO. 1.

[0046] Sarocladium implicatum WS-21, whose deposit number is CGMCCNo.41343, has been deposited in the General Microbiology Center of China Culture Collection Administration, referred to as CGMCC, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is June 20, 2024, and the classification name is Sarocladium implicatum.

[0047] Example 2 Antibacterial spectrum analysis

[0048] Take the pseudo-graminearum Fusarium 14LY24-2 (preservation number CGMCC 3.20319) and Fusarium graminearum 14ZK1-4 (preservation number CGMCC 3.20316) preserved in this laboratory and use a cork puncher to punch out 5mm diameter fungus blocks as target bacteria for use. The 11-day and 15-day natural antibacterial bacteria WS-21 fermentation broth extracts and YPB liquid culture medium were mixed with unsolidified PDA culture medium in a ratio of 1:1 and poured into plates. At the same time, pure PDA culture medium plates were used as controls. After the culture medium solidified, the target bacteria were inoculated in the center of the plate. Each treatment was repeated 3 times and cultured in a mold incubator at 25°C. The growth diameter of the pathogen was measured for 5 days, and the inhibition rate was calculated. The results are shown in Tables 2 and Figure 3 .

[0049] Antibacterial rate calculation formula:

[0050] Inhibition rate (%) = (control colony diameter - treated colony diameter) / control colony diameter × 100

[0051] Table 2 Antibacterial spectrum results of biocontrol bacteria WS-21

[0052]

[0053] Table 2 and Figure 3 The results showed that the inhibition rates of the fermentation broth extracts of Acremonium crossbranching WS-21 of the genus Scopulariopsis after 11 days and 15 days of shaking cultivation against Fusarium graminearum were 44.98% and 68.50%, respectively; the inhibition rates of the fermentation broth extracts of Acremonium crossbranching WS-21 of the genus Scopulariopsis after 11 days and 15 days of shaking cultivation against Fusarium graminearum were 24.07% and 78.99%, respectively.

[0054] Example 3 Field control test of biocontrol bacteria WS-21 fermentation liquid

[0055] The liquid was fermented under shaking conditions of 25°C and 180 rpm for 15 days to form a fermentation liquid. The concentration of live bacteria of Acremonium WS-21 of the genus Acremonium in the inoculant was 5×10 8 CFU / mL, dilute 10 times to make the concentration of live bacteria in the fermentation liquid 5×10 7 CFU / mL as a bacterial liquid preparation can be used to prevent and treat wheat powdery mildew. 0.1% Tween 80 as a surface dispersant was added to the bacterial liquid preparation for the test treatment, and the dosage was 1.2L / 20m 2 At the same time, 15% triadimefon wettable powder was used as a control treatment, with a dosage of 2.4g / 20m 2, set up 3 replicates, planted wheat powdery mildew seedlings in the field in early March, sprayed for the first time in late April, and sprayed for the second time 7 days later. The severity of wheat powdery mildew disease was investigated in early and mid-May, and the disease grade was calculated according to the wheat powdery mildew grading standard, and the disease index and field control effect of the fermentation liquid of the biocontrol bacterium WS-21 were calculated.

[0056] Disease classification adopts the industry standard GB / T 17980.1-17980.53-2000 Pesticide Field Efficacy Test Guidelines (I) Isolation method for fungicide control of powdery mildew in cereals (based on leaves):

[0057] Level 0: no disease;

[0058] Level 1: The lesion area accounts for less than 5% of the entire leaf area;

[0059] Level 3: The lesion area accounts for 6% to 15% of the entire leaf area;

[0060] Level 5: The lesion area accounts for 16% to 25% of the entire leaf area;

[0061] Level 7: The lesion area accounts for 26% to 50% of the entire leaf area;

[0062] Level 9: The lesion area accounts for more than 50% of the entire leaf area.

[0063] The disease index calculation formula is:

[0064] Disease index = ∑ (number of diseased plants at each level × value of the disease level) / (total number of plants surveyed × highest level value) × 100

[0065] Calculation formula for prevention effect:

[0066] Prevention effect (%) = (control disease index - treatment disease index) / control disease index × 100

[0067] The results are shown in Table 3.

[0068] Table 3 Disease index and prevention effect of different treatments and application times

[0069]

[0070] The results in Table 3 show that the control effect of two applications is better than that of one application. After two applications, the control effect of the fermentation liquid of the biocontrol bacteria WS-21 is 70.03%, and the control effect of the chemical agent triadimefon is 69.18%. The control effect of the biocontrol bacteria WS-21 is better than that of triadimefon, and it has important development and application value.

[0071] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Acremonium affine Sarocladium implicatum )WS-21, characterized in that Its deposit number is CGMCC No.41343.

2. Use of the strain Acremonium alternifolium WS-21 according to claim 1 in preventing and controlling wheat powdery mildew.

3. Use of the Acremonium WS-21 strain according to claim 1 in preventing and controlling Fusarium graminearum and Pseudoceromyces graminearum.

4. A microbial agent, characterized in that: Contains the Acremonium WS-21 described in claim 1.

5. The method for preparing a microbial agent according to claim 4, characterized in that: The specific steps are as follows: inoculate Acremonium WS-21 on PDA culture medium, culture in a mold culture box at 25°C for 5 days to prepare seed bacteria; inoculate 10 seed bacteria blocks with a diameter of 6 mm in 150 mL YPB culture medium, shake and ferment in liquid at 25°C and 180 rpm for 15 days to form a fermentation liquid, and obtain a fermentation liquid inoculum; the concentration of live Acremonium WS-21 of the genus Acremonium in the inoculum is 5×10 8 CFU / mL; The YPB medium was composed of 10 g yeast extract, 20 g peptone, and 20 g glucose, and distilled water was added to make the volume 1000 mL, natural pH value, and sterilized at 121° C. for 30 min.

6. The method for using a microbial agent according to claim 4, characterized in that: The specific steps are as follows: dilute the bacterial agent 10 times with sterile water to make the concentration of live bacteria in the dilution liquid 5×10 7 CFU / mL, sprayed on wheat leaves at the adult stage, every 1m 2 The dosage of wheat field fungus agent is 60mL.

Images