A combination of small interfering and short hairpin RNA sequences of fructokinase KHK and its application

Abstract

The present invention provides a combination of small interfering and short hairpin RNA sequences of fructokinase KHK, and also provides an application for preparing drugs for metabolic bone diseases. The small interfering and short hairpin RNA sequences of the present invention have high stability and low off-target effects, and have high specificity and transfection effects in vivo; in vivo studies have shown that the expression of endogenous fructose marker KHK and urinary fructose is significantly increased in osteoporosis models induced by diabetes and ovariectomy, and high fructose induces obvious osteoporosis changes in trabecular bone of aged mice; in vitro experiments have shown that the small interfering and short hairpin RNA sequences can effectively promote the osteogenic differentiation of mesenchymal stem cells and increase the expression of osteogenic differentiation marker osteopontin; it can be used for the preparation of drugs for treating metabolic bone diseases, and has great clinical application and research value.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and medical technology, and particularly relates to a combination of small interfering and short hairpin RNA sequences of fructokinase KHK and its application. Background Art

[0002] Globally, obesity and diabetes are showing a severely out-of-control trend. The two are important components of the metabolic syndrome. In addition to causing a complex syndrome of metabolic disorders, the metabolic syndrome can also cause changes related to bone metabolism. Bone is a highly dynamic tissue. Bone marrow stromal cells exist in the bone marrow microenvironment and can differentiate into various cells such as osteoblasts, adipocytes, and chondrocytes. The bone marrow metabolic conditions are determinants of the biological balance between osteoblast-mediated bone formation and bone marrow adipogenesis. Multiple factors such as endogenous hormones and drug therapies can affect this delicate balance and change the ratio of osteoblasts to adipocytes in the bone marrow. Therefore, the regulation of the bone metabolism mechanism under the background of metabolic disorders remains an urgent problem to be solved.

[0003] Fructose and glucose are both hexose isomers with the chemical formula C6H 12 O6. With the wide application of the synthesis of high-fructose syrup through glucose isomerization in modern industry, excessive fructose intake leads to insulin resistance, obesity, and elevated blood lipids, thus resulting in the metabolic syndrome. The phosphorylation of fructokinase KHK is the first step in the metabolism of fructose in the body. The endogenous fructose metabolic pathway is complex. The exogenous intake of fructose such as soft drinks leads to the formation of more endogenous fructose intermediates by fructokinase KHK, resulting in tissue and organ changes such as liver and kidney damage, pancreatic islet function damage, and ectopic fat distribution, and forming metabolic diseases with energy metabolism disorders such as obesity and diabetes. At present, the research on endogenous fructose-related fructokinase mainly focuses on the aspect of the metabolic syndrome, and there is less research on the regulation of bone metabolism. The independent mechanism of endogenous fructose acting on bone metabolism and its therapeutic application in metabolic bone diseases are not yet clear. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a combination of small interfering and short hairpin RNA sequences of fructokinase KHK and its application in view of the deficiencies of the above-mentioned prior art. The small interfering and short hairpin RNA of fructokinase KHK of the present invention have high stability and low off-target effects, have high specificity and transfection efficiency in vivo, and have great clinical application and research value.

[0005] To solve the above technical problem, the technical solution adopted by the present invention is: a combination of small interfering and short hairpin RNA sequences of fructokinase KHK, and the combination of small interfering and short hairpin RNA sequences includes a combination of small interfering and short hairpin RNA sequences a and / or a combination of small interfering and short hairpin RNA sequences b;

[0006] The small interfering and short hairpin RNA sequence combination a includes a small interfering RNA basic sequence a and a short hairpin RNA sequence a;

[0007] The nucleotide sequence of the small interfering RNA basic sequence a is shown as SEQ ID NO.1; the nucleotide sequence of the short hairpin RNA sequence a is shown as SEQ ID NO.2;

[0008] The small interfering and short hairpin RNA sequence combination b includes a small interfering RNA basic sequence b and a short hairpin RNA sequence b;

[0009] The nucleotide sequence of the small interfering RNA basic sequence b is shown as SEQ ID NO.3; the nucleotide sequence of the short hairpin RNA sequence b is shown as SEQ ID NO.4.

[0010] Preferably, the small interfering and short hairpin RNA sequence combination a further includes one or more of a small interfering RNA tail modification sequence a, a small interfering RNA cholesterol modification sequence a1, and a small interfering RNA cholesterol modification sequence a2;

[0011] The sequences of the sense and antisense strands of the small interfering RNA tail modification sequence a are:

[0012] 5’-GCAGCGGAUAGAGGAGCACAAdTdT-3’;

[0013] 5’-CGUCGCCUAUCUCCUCGUGUUdTdT-3’;

[0014] The sequences of the sense and antisense strands of the small interfering RNA cholesterol modification sequence a1 are:

[0015] 5’-mGmCmAGCGGAUAGAGGAGCAmCmAmAdTdT-Chol-3’;

[0016] 5’-phos-mCmGmUCGmCfCfUmAfUmCUmCCmUCmGmUmGmUmUd TdT-3’;

[0017] The sequences of the sense and antisense strands of the small interfering RNA cholesterol modification sequence a2 are:

[0018] 5’-mGmCmAGCGGAUAGAGGAGCAmCmAmAdTdT-Chol-3’;

[0019] 5’-phos-mCmGmUfCmGmCfCfUmAfUmCfUmCfCmUfCmGfUmGmU mUdTdT-3’;

[0020] The small interfering and short hairpin RNA sequence combination b further includes one or more of a small interfering RNA tail modification sequence b, a small interfering RNA cholesterol modification sequence b1, and a small interfering RNA cholesterol modification sequence b2;

[0021] The sequences of the sense and antisense strands of the small interfering RNA tail modification sequence b are:

[0022] 5’-CAUCAUCAAUGUGGUGGACAAdTdT-3’;

[0023] 5’-GUAGUAGUUACACCACCUGUUdTdT-3’;

[0024] The sequences of the sense and antisense strands of the small interfering RNA cholesterol modification sequence b1 are:

[0025] 5’-mCmAmUCAUCAAUGUGGUGGAmCmAmAdTdT-Chol-3’;

[0026] 5’-phos-mGmUmAGUmAfGfUmUfAmCAmCCmACmCmUmGmUmUdTdT-3’;

[0027] The sequences of the sense and antisense strands of the small interfering RNA cholesterol modification sequence b2 are:

[0028] 5’-mCmAmUCAUCAAUGUGGUGGAmCmAmAdTdT-Chol-3’;

[0029] 5’-phos-mGmUmAfGmUmAfGfUmUfAmCfAmCfCmAfCmCfUmGmUmUdTdT-3’.

[0030] The present invention also provides the use of the above-mentioned small interfering and short hairpin RNA sequence combination of fructokinase KHK, and the small interfering and short hairpin RNA composition of fructokinase KHK is used for preparing a drug for metabolic bone disease.

[0031] The mode of action of the drug for treating metabolic bone disease is to achieve the curative effect of treating diabetes and osteoporosis induced by ovarian castration by regulating the osteogenic differentiation of mesenchymal stem cells. The present invention proves the possibility that endogenous fructose inhibitors affect metabolic bone turnover and related diseases by regulating the osteogenic differentiation of mesenchymal stem cells, and has good effects on various in vivo and in vitro metabolic bone disease models, providing a possibility for the clinical application of endogenous fructose inhibitors in treating metabolic bone disease.

[0032] The present invention has the following advantages compared with the prior art:

[0033] 1. The small interfering and short hairpin RNA sequences of the present invention are used to prepare drugs for treating metabolic bone diseases, having high stability and low off-target effects, and having high specificity and transfection effects in vivo.

[0034] 2. Currently, the research on fructokinase KHK mainly focuses on metabolic syndrome, and there is no research on bone metabolism. The present invention proves the possibility that small interfering and short hairpin RNA sequences affect metabolic bone turnover and related diseases by regulating the osteogenic differentiation of mesenchymal stem cells: in vivo studies show that the expression of endogenous fructose marker KHK and urinary fructose is significantly increased in osteoporosis models induced by diabetes and ovariectomy, and high fructose induces obvious osteoporosis changes in trabecular bone of aged mice; in vitro experiments show that small interfering and short hairpin RNA sequences can effectively promote the osteogenic differentiation of mesenchymal stem cells and increase the expression of osteogenic differentiation marker osteopontin. The small interfering and short hairpin RNA sequences of the present invention are used to prepare drugs for treating metabolic bone diseases, having good effects on various in vivo and in vitro metabolic bone disease models, providing the possibility for the clinical application of small interfering and short hairpin RNA sequences in treating metabolic bone diseases.

[0035] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Description of the Drawings

[0036] Figure 1 It is a schematic three-dimensional structure diagram of short hairpin RNA sequence a and short hairpin RNA sequence b (SEQ ID NO.2 and 4) in Example 1 of the present invention.

[0037] Figure 2 It is an experimental diagram of the influence of small interfering and short hairpin RNA sequences of fructokinase KHK on in vivo models of osteoporosis induced by diabetes and ovariectomy in Example 2 of the present invention. Among them, A is the urinary fructose level of mice in the osteoporosis model induced by diabetes; B is the KHK mRNA expression level of mice in the osteoporosis model induced by diabetes; C is the urinary fructose level of mice in the osteoporosis model induced by ovariectomy; D is the KHK mRNA expression level of mice in the osteoporosis model induced by ovariectomy; E is the trabecular bone staining of aged mice induced by high fructose.

[0038] Figure 3 It is an experimental diagram of the osteogenic differentiation of mesenchymal stem cells induced by small interfering and short hairpin RNA sequences of fructokinase KHK in Example 3 of the present invention. Among them, A is the alizarin red S staining after the osteogenic differentiation of mesenchymal stem cells induced by small interfering and short hairpin RNA sequences of fructokinase KHK; B is the expression of osteopontin after treating mesenchymal stem cells with small interfering and short hairpin RNA sequences of fructokinase KHK. Sample size = 6 per group, P < 0.05. Detailed Description of the Embodiments

[0039] Example 1

[0040] The design principle of the small interfering and short hairpin RNA sequences of fructokinase KHK in this embodiment is that the ID of the KHK gene is 16548, the transcript ID is NM_008439 (KHK-C), the species is mouse, the design region is the coding sequence region, and two different short hairpin or small interfering RNA sequences are designed and verified simultaneously to prevent off-target effects. The specific design schemes of the short hairpin RNA and the small interfering RNA are as follows:

[0041] S1. In the design process of the small interfering RNA sequence of fructokinase KHK, the target mRNA used is the Khk mRNA mutant 2 NM_008439.4 (SEQ ID NO.5) encoding the KHK-C subtype protein NP_032465.2

[0042] S2. The computer designs multiple segments of small interfering RNA based on the above target mRNA, as shown in Table 1 specifically:

[0043] Table 1 Sequence list of the small interfering RNA design scheme 1

[0044] Target position Target sequence RNA oligonucleotide, guide Passenger 24-46 cagaagaatggtacaaatccaag UGGAUUUGUACCAUUCUUCUG GAAGAAUGGUACAAAUCCAAG 159-181 cccttaaaggaaccaatgagtcc ACUCAUUGGUUCCUUUAAGGG CUUAAAGGAACCAAUGAGUCC 261-283 aggatgagattcagaatatgaag UCAUAUUCUGAAUCUCAUCCU GAUGAGAUUCAGAAUAUGAAG 461-483 ctggttgatacccactcaaaaag UUUUGAGUGGGUAUCAACCAG GGUUGAUACCCACUCAAAAAG 462-484 tggttgatacccactcaaaaagg UUUUUGAGUGGGUAUCAACCA GUUGAUACCCACUCAAAAAGG 491-513 ctgattaagacggttgaaactag AGUUUCAACCGUCUUAAUCAG GAUUAAGACGGUUGAAACUAG 519-541 gacaggttatcaacgaaacttct AAGUUUCGUUGAUAACCUGUC CAGGUUAUCAACGAAACUUCU 521-543 caggttatcaacgaaacttctca AGAAGUUUCGUUGAUAACCUG GGUUAUCAACGAAACUUCUCA

[0045] The sequence efficiency detection of the scheme obtained is as follows:

[0046] Table 2 Efficiency scoring table of the small interfering RNA design scheme 1

[0047]

[0048]

[0049] It can be seen from this that the small interfering RNA of the design scheme 1 has good stability and low off-target effects in theoretical calculation.

[0050] S3. The computer designs the small interfering RNA design scheme 2 according to the design scheme 1, as shown in Table 3.

[0051] Table 3 Sequence list of the small interfering RNA design scheme 2

[0052]

[0053] The sequence efficiency detection of this design scheme 2 is as follows:

[0054] Table 4 Stability scoring table of the small interfering RNA design scheme 2

[0055]

[0056]

[0057] Thus, the small interfering RNA of Design Scheme 2 has a good stability score in theoretical calculation.

[0058] S4. Final design schemes of small interfering and short hairpin RNAs:

[0059] According to actual computer simulation screening, two sequences are finally selected as the design schemes with the highest transfection efficiency. The target mRNA used is the Khk mRNA mutant 2 (SEQ ID NO.5) encoding the KHK-C subtype protein NP_032465.2. The sequence combinations of small interfering and short hairpin RNAs of fructokinase KHK include the sequence combination a of small interfering and short hairpin RNAs (Scheme 1) and / or the sequence combination b of small interfering and short hairpin RNAs (Scheme 2);

[0060] Among them, the sequence combination a of small interfering and short hairpin RNAs includes the basic sequence a of small interfering RNA (SEQ ID NO.1) and the sequence a of short hairpin RNA (SEQ ID NO.2);

[0061] The sequence combination b of small interfering and short hairpin RNAs includes the basic sequence b of small interfering RNA (SEQ ID NO.3) and the sequence b of short hairpin RNA (SEQ ID NO.4);

[0062] Preferably, the sequence combination a of small interfering and short hairpin RNAs may further include one or more of the terminal modification sequence a of small interfering RNA, the cholesterol modification sequence a1 of small interfering RNA, and the cholesterol modification sequence a2 of small interfering RNA.

[0063] Among them, the sequences of the sense and antisense strands of the terminal modification sequence a of small interfering RNA are as shown in SEQ ID NOs. 6-7;

[0064] The sequences of the sense and antisense strands of the cholesterol modification sequence a1 of small interfering RNA are as shown in SEQ ID NOs. 8-9;

[0065] The sequences of the sense and antisense strands of the cholesterol modification sequence a2 of small interfering RNA are as shown in SEQ ID NOs. 10-11;

[0066] The sequence combination b of small interfering and short hairpin RNAs further includes one or more of the terminal modification sequence b of small interfering RNA, the cholesterol modification sequence b1 of small interfering RNA, and the cholesterol modification sequence b2 of small interfering RNA;

[0067] Among them, the sequences of the sense and antisense strands of the terminal modification sequence b of small interfering RNA are as shown in SEQ ID NOs. 12-13;

[0068] The sequences of the sense and antisense strands of the cholesterol modification sequence b1 of small interfering RNA are as shown in SEQ ID NOs. 14-15;

[0069] The sequences of the sense and antisense strands of the cholesterol-modified sequence b2 of small interfering RNA are shown in SEQ ID NOs. 16-17.

[0070] The specific design scheme is as follows:

[0071] S401. Scheme 1: The combination of small interfering and short hairpin RNA sequences a:

[0072] (1) The basic sequence of the small interfering RNA designed with this (SEQ ID NO.5) is SEQ ID NO.1:

[0073] 5’-GCAGCGGATAGAGGAGCACAA-3’;

[0074] (2) The short hairpin RNA sequence designed with this (SEQ ID NO.1) is SEQ ID NO.2, and the spatial structure is as shown in the above sequence: Figure 1 as shown in the above sequence:

[0075] 5’- CCGG GCAGCGGATAGAGGAGCACAA CTCGAG TTGTGCTCCTCTA TCCGCTGCTTTTT G -3’;

[0076] It may also include:

[0077] (3) The tail modification sequences of the small interfering RNA designed with this (SEQ ID NO.1) are SEQ ID NOs. 6-7:

[0078] SEQ ID NO.6: 5’-GCAGCGGAUAGAGGAGCACAAdTdT-3’;

[0079] SEQ ID NO.7: 5’-CGUCGCCUAUCUCCUCGUGUUdTdT-3’;

[0080] (4) The cholesterol-modified sequences of the small interfering RNA designed with this (SEQ ID NO.1) are sequence a1 or sequence a2:

[0081] ① Sequence a1:

[0082] SEQ ID NO.8: 5’-mGmCmAGCGGAUAGAGGAGCAmCmAmAdTdT-C hol-3’;

[0083] SEQ ID NO.9: 5’-phos-mCmGmUCGmCfCfUmAfUmCUmCCmUCmGm UmGmUmUdTdT-3’;

[0084] ② Sequence a2:

[0085] SEQ ID NO.10: 5’-mGmCmAGCGGAUAGAGGAGCAmCmAmAdTdT-Chol-3’;

[0086] SEQ ID NO.11: 5’-phos-mCmGmUfCmGmCfCfUmAfUmCfUmCfCmUf CmGfUmGmUmUdTdT-3’;

[0087] S402, Scheme 2: Combination b of small interfering and short hairpin RNA sequences:

[0088] (1) The basic sequence of the small interfering RNA designed with this (SEQ ID NO.5) is SEQ ID NO.3:

[0089] 5’-CATCATCAATGTGGTGGACAA-3’;

[0090] (2) The short hairpin RNA sequence designed with this (SEQ ID NO.3) is SEQ ID NO.4, and the spatial structure is as shown in the sequence below: Figure 1 As shown in the sequence below:

[0091] CCGG CATCATCAATGTGGTGGACAA CTCGAG TTGTCCACCACATTG ATGATGTTTTT G -3’;

[0092] It may also include:

[0093] (3) The tail modification sequence of the small interfering RNA designed with this (SEQ ID NO.3) is SEQ ID NO.12 - 13:

[0094] SEQ ID NO.12: 5’-CAUCAUCAAUGUGGUGGACAAdTdT-3’;

[0095] SEQ ID NO.13: 5’-GUAGUAGUUACACCACCUGUUdTdT-3’;

[0096] (4) The cholesterol modification sequence of the small interfering RNA designed with this (SEQ ID NO.3) is sequence b1 or sequence b2:

[0097] ① Sequence b1:

[0098] SEQ ID NO.14: 5’-mCmAmUCAUCAAUGUGGUGGAmCmAmAdTdT-Chol-3’;

[0099] SEQ ID NO.15: 5’-phos-mGmUmAGUmAfGfUmUfAmCAmCCmACmC mUmGmUmUdTdT-3’;

[0100] ② Sequence b2:

[0101] SEQ ID NO.16: 5’-mCmAmUCAUCAAUGUGGUGGAmCmAmAdTdT-Chol-3’;

[0102] SEQ ID NO.17: 5’-phos-mGmUmAfGmUmAfGfUmUfAmCfAmCfCmAf CmCfUmGmUmUdTdT-3’;

[0103] S403. Design small interfering and short hairpin RNA control sequences simultaneously:

[0104] (1) The basic sequence of the small interfering RNA designed based on this (SEQ ID NO.5) is:

[0105] SEQ ID NO.18: 5’-TTCTCCGAACGTGTCACGT-3’;

[0106] (2) The short hairpin RNA sequence designed based on this (SEQ ID NO.18) is:

[0107] SEQ ID NO.19: 5’- CCGG TTCTCCGAACGTGTCACGT CTCGAG ACGT GACACGTTCGGAGAA G -3’;

[0108] It may also include:

[0109] (3) The terminal modification sequence of the small interfering RNA designed based on this (SEQ ID NO.18) is:

[0110] SEQ ID NO.24: 5’-UUCUCCGAACGUGUCACGUdTdT-3’;

[0111] SEQ ID NO.25: 5’-ACGUGACACGUUCGGAGAAdTdT-3’;

[0112] (4) The small interfering RNA cholesterol-modified sequences designed therefrom (SEQ ID NO.18) are SEQ ID NO.26 - 27 or SEQ ID NO.28 - 29:

[0113] SEQ ID NO.26:

[0114] 5’-mUmUmCUCCGAACGUGUCAmCmGmUdTdT-Chol-3’;

[0115] SEQ ID NO.27:

[0116] 5’-phos-mAmCmGUGmAfCfAmCfGmUUmCGmGmAmGmAmAdTdT-3’;

[0117] SEQ ID NO.28:

[0118] 5’-mUmUmCUCCGAACGUGUCAmCmGmUdTdT-Chol-3’;

[0119] SEQ ID NO.29:

[0120] 5’-phos-mAmCmGfUmGmAfCfAmCfGmUfUmCfGmGfAmGmAmAdTdT-3’.

[0121] Annotation of small interfering and short hairpin RNA sequence combinations a, b and control sequences:

[0122] The underlined GGGG and G: restriction sites;

[0123] The underlined CTCGAG: loop;

[0124] TTTTT: 3’ overhang for poly T termination of transcription;

[0125] A: adenine;

[0126] U: uracil;

[0127] G: guanine;

[0128] C: cytosine;

[0129] dT: deoxy thymine;

[0130] m: 2’-O-methyl;

[0131] f: 2'-Fluoro;

[0132] phos-: 5'-Phosphate;

[0133] -Chol: 3'-Cholesterol.

[0134] S5. Efficiency detection of small interfering and short hairpin RNA sequences by computer-simulated BLAST test:

[0135] This example is for the efficiency of computer-simulated BLAST test of small interfering and short hairpin RNA sequences. The specific method is as follows:

[0136] Use BLAST to test the efficiency of the two designed small interfering and short hairpin RNA sequence schemes. The test results show that in the BLAST computational simulation, only the fructokinase KHK-related sequences can be simulated for the two designed small interfering and short hairpin RNA sequence schemes of the present invention, and no other mRNA sequences are generated. This indicates that the two designed small interfering and short hairpin RNA sequence schemes 1 and 2 of the present invention have extremely high specificity, which can theoretically ensure the specificity of small interfering and short hairpin RNA after entering cells or organisms. Therefore, it proves the possibility that small interfering and short hairpin RNA sequences can treat metabolic bone diseases at the computer level.

[0137] S6. Detection of knockdown efficiency of small interfering and short hairpin RNA sequences by real-time quantitative PCR:

[0138] Transfect the two small interfering and short hairpin RNA sequence schemes 1 and 2 into target cells respectively, and use real-time quantitative PCR to detect the transfection knockdown efficiency. The results show that compared with the control group, the detected knockdown efficiency of the small interfering and short hairpin RNA sequence scheme 1 is 88%, the GC content is 57.14%, and the length is 21 nt; the detected knockdown efficiency of the small interfering and short hairpin RNA sequence scheme 2 is 87%, the GC content is 42.86%, and the length is 21 nt. The above results indicate that the small interfering and short hairpin RNA sequences described in the present invention have extremely high knockdown efficiency.

[0139] Example 2

[0140] This example is for the in vivo experiment of small interfering and short hairpin RNA sequences on metabolic bone diseases.

[0141] S1. Construction of an in vivo model of osteoporosis induced by diabetes and ovariectomy:

[0142] Aged male and female C57BL / 6J mice, sourced from Beijing Huafukang Biotechnology Co., Ltd., were housed in a standard specific pathogen-free (SPF) laboratory. Four mice were kept in each cage, with free access to food and water. The room temperature was maintained at 20±2°C, humidity at 55±5%, and the light / dark cycle was 12 hours. All experiments were conducted at the same time each day to avoid the influence of circadian rhythm. This study complied with the ethical standards of the Institutional Animal Care and Use Committee (IACUC).

[0143] (1) Diabetes-induced osteoporosis model: Streptozotocin is a commonly used reagent for inducing diabetes models. The animals were intraperitoneally injected with streptozotocin at a dose of 40 mg / kg for 5 consecutive days. Four weeks later, the trabecular bone structure of aged male mice changed, thus completing the establishment of an in vivo diabetes-induced osteoporosis model.

[0144] (2) Ovariectomy-induced osteoporosis model: Ovariectomy mimics osteoporosis caused by estrogen deficiency and bone metabolism disorders after female menopause. An incision was made in the midline of the abdomen, 1-2 cm from the vaginal orifice, to open the abdominal cavity. The fallopian tubes under the ovaries were clamped, and both ovaries were ligated and removed. After the operation, dexamethasone at a dose of 1 mg / kg was administered twice a week for 4-6 weeks to complete the establishment of an in vivo ovariectomy-induced osteoporosis model.

[0145] S2. Detection of urinary fructose in in vivo experiments:

[0146] Twenty-four-hour and instantaneous urine samples from the induced animals were collected and detected using a high-sensitivity fructose detection kit. After pre-experimentally determining the approximate expression level of the samples, the samples were diluted to 20-100 pmol / well to ensure that the detection concentration of the samples was within the standard curve range. To remove the high background of enzymes, proteins, glucose, reduced coenzyme I, and other biological components in the serum, samples without reaction enzymes were used as blank controls, and incubated at 37°C in the dark for 30 min for sufficient reaction. The absorbance at 535 nm and 587 nm was measured, and the final concentration of the samples was calculated.

[0147] The high-sensitivity fructose detection kit mentioned above, model: MAK180, was purchased from Sigma-Aldrich (China) Co., Ltd.

[0148] S3. Real-time quantitative PCR detection:

[0149] Total RNA of tissues was extracted using Trizol RNA isolation reagent. 1 μg of total RNA was reverse transcribed into cDNA using the Premix type reverse transcription reagent PrimeScript TM RT Master Mix (Perfect Real Time). Real-time quantitative PCR was performed using the highly specific qPCR reagent TB Premix Ex TaqTM II (Tli RNaseH Plus) kit. The reaction system was 20 μl, containing 2 μl cDNA. The reaction process was: 95℃ initial denaturation for 3 min, 95℃ denaturation for 12 s for 40 cycles, 62℃ annealing for 30 s, and 72℃ extension for 30 s. At the end of the experiment, the CT value was read, and the melting curve was analyzed using the primer of Actb as the standard internal reference. -ΔΔ The relative expression was calculated by CT method.

[0150] The specific primers for Khk mRNA mutant 2 are: forward sequence: 5'-GCT GAC TTC AGG CAGAGG-3' (SEQ ID NO.20), antisense sequence: 5'-CCT TCT CAA AGT CCT TAG CAG-3' (SEQ ID NO.21).

[0151] The specific primers for the internal reference Actb are: forward sequence: 5'-AGA AGC TGT GCT ATG TTG CTCTA-3' (SEQ ID NO.22), antisense sequence: 5'-ATC GTA CTC CTG CTT GCT GA-3' (SEQ ID NO.23).

[0152] The Premix reverse transcription reagent PrimeScript TM RT Master Mix (Perfect Real Time) and High Specificity qPCR Reagent TB Premix Ex Taq TM II (Tli RNaseH Plus) kit was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd., catalog number: RR036A and RR820A.

[0153] S4. Hematoxylin and eosin (HE) staining of trabecular bone in animal tissues:

[0154] Bone tissue was immersed in 4% paraformaldehyde and decalcified. All fixed samples were dehydrated with increasing alcohol concentrations, eluted with xylene, and embedded in paraffin. Paraffin-embedded tissue blocks were sliced ​​with a rotary slicer with a thickness of 5 microns. The prepared slides were observed under a 400× microscope using a hematoxylin and eosin (HE) staining kit.

[0155] The hematoxylin and eosin (HE) staining kit was purchased from Shanghai Bio-Tech Biotechnology Co., Ltd., item number: C0105S.

[0156] S5. Effect of endogenous fructose on regulating osteoporosis model in vivo:

[0157] Figure 2 This is the in vivo experimental figure in Example 2 of the present invention. In the figure, the diabetes group represents the osteoporosis model induced by diabetes, the ovariectomy group represents the in vivo osteoporosis model induced by ovariectomy, and the experimental group represents the osteoporosis model induced by high fructose. In this example, the osteoporosis models induced by diabetes and ovariectomy were simulated, and the urinary fructose levels and KHK mRNA expression levels of the two models were detected respectively. It was found that the urinary fructose levels and KHK mRNA expression levels of the two model animals were significantly increased compared with the control group ( Figure 2 A-D). In this example, elderly mice induced by high fructose were also designed to simulate the osteoporosis model induced by high fructose. It was found that the trabecular bone staining of the elderly mice induced by high fructose was significantly lighter than that of the control group elderly mice, showing obvious destruction of the trabecular bone structure ( Figure 2 E). The above results indicate that fructose uptake plays a role in destroying the bone mass of osteoporosis mice by increasing the levels of endogenous fructose (i.e., KHK and circulating fructose) in the body. Therefore, this example proves the possibility of endogenous fructose inhibitors in drugs for treating metabolic bone diseases from the level of in vivo experiments.

[0158] Example 3

[0159] This example is an in vitro experiment on small interfering and short hairpin RNA sequences for metabolic bone diseases.

[0160] S1. Culturing of tool cell lines and induction of osteogenic differentiation:

[0161] Since organoids are developed from tissue stem cells, embryonic stem cells or induced pluripotent stem cells, they have the ability of self-renewal and differentiation, and can reproduce the real microscopic anatomical morphology. They are ideal in vitro research materials for translational medicine. Among them, adipose-derived mesenchymal stem cells (ADSCs) isolated from vascular stromal components have received great attention due to their sufficient quantity and wide source, and are important carriers involved in regulating bone metabolism balance. The cultured ADSC cells were proved to be successfully cultured by detecting positive for CD29, CD73, CD105 and CD166 and negative for CD31, CD34, CD45 and HLA-DR.

[0162] On this basis, the small interfering and short hairpin RNAs designed by the present invention were used, and osteogenic differentiation induction was carried out. Adipose-derived mesenchymal stem cells ADSCs were cultured and induced, and a complete medium for mouse adipose mesenchymal stem cells was used for culturing. The process of the small interfering and short hairpin RNAs to exert their functions is relatively complex. First, the small interfering and short hairpin RNAs are constructed into an expression vector and enter the cells with the help of plasmid or viral vectors. Inside the cells, through steps such as transcription, cleavage, and enzymatic digestion, the basic sequence of small interfering RNA is formed, thereby leading to gene silencing. 10% fetal bovine serum, 1 μmol / L dexamethasone, 200 μmol / L vitamin C, and 10 μmol / L β-glycerophosphate were added to the osteogenic induction differentiation kit for mouse adipose mesenchymal stem cells, and induction was carried out for 4 weeks, with the culture medium changed every 3 days. Osteogenic differentiation requires maintaining induction for 4 weeks.

[0163] The adipose-derived mesenchymal stem cells ADSCs described above were purchased from Cyagen Biosciences (Guangzhou) Inc., product number: MUBMD-01001; the complete medium for mouse adipose mesenchymal stem cells was from Cyagen Biosciences (Guangzhou) Inc., product number: MUXMD-90011.

[0164] S2. Detection of bone metabolism indexes in vitro:

[0165] The cell-prepared slides were stained with an osteoblast mineralized nodule staining kit (alizarin red S method) and observed under a 400-fold microscope. The bone formation markers selected in the present invention include alkaline phosphatase (ALP), bone-specific alkaline phosphatase (BASP), osteocalcin (OC), and osteopontin (OPN). The bone resorption markers include C-terminal telopeptide of type I collagen (CTX), N-terminal telopeptide of type I collagen (NTX), pyridinoline (PYD), and deoxypyridinoline (DPD).

[0166] The osteoblast mineralized nodule staining kit (Alizarin Red S method) was purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number: C0148S; the alkaline phosphatase (ALP) was purchased from Shanghai Beyotime Biotechnology Co., Ltd., product number: P0321M; the bone-specific alkaline phosphatase (BASP) was purchased from Nanjing Jiancheng Bioengineering Institute, product number: H234; the osteocalcin (OC) was purchased from Nanjing Jiancheng Bioengineering Institute, product number: H152-1-2; the enzyme-linked immunosorbent assay kit for osteopontin (OPN) was purchased from Wuhan Yunkelong Technology Co., Ltd., product number: SEA899Mu; the carboxyl-terminal telopeptide of type I collagen (CTX) was purchased from Nanjing Jiancheng Bioengineering Institute, product number: H287; the amino-terminal telopeptide of type I collagen (NTX) was purchased from Nanjing Jiancheng Bioengineering Institute, product number: H368-1; the pyridinoline (PYD) was purchased from Nanjing Jiancheng Bioengineering Institute, product number: H335-1; the deoxypyridinoline (DPD) was purchased from Nanjing Jiancheng Bioengineering Institute, product number: H291.

[0167] S3. Osteogenic differentiation of mesenchymal stem cells induced by small interfering and short hairpin RNA sequences:

[0168] Figure 2 This is the in vitro experiment figure in Example 3 of the present invention. In this example, the osteogenic differentiation of mesenchymal stem cells induced by small interfering and short hairpin RNA sequences was simulated. In the figure, the induction group represents mesenchymal stem cells induced by small interfering and short hairpin RNA sequences. It was found that after the osteogenic differentiation of mesenchymal stem cells induced by small interfering and short hairpin RNA sequences, the expression of the osteogenic differentiation marker Alizarin Red S staining and osteopontin (OPN), one of the bone metabolism indicators, was significantly increased compared with the control group, indicating that the small interfering and short hairpin RNA sequences designed in the present invention can participate in regulating the osteogenic differentiation process of mesenchymal stem cells. Therefore, this example proves the possibility that small interfering and short hairpin RNA sequences can treat metabolic bone diseases at the level of in vitro experiments.

[0169] The above two examples show that the small interfering and short hairpin RNA sequence design scheme designed in the present invention has good stability and low off-target effects, has high specificity and transfection efficiency after entering the body, can participate in mediating the osteoporosis process in diabetes and ovariectomy-induced osteoporosis models, and can significantly regulate the osteogenic differentiation process in mesenchymal stem cells, and has good prospects for the treatment and application of metabolic bone diseases.

[0170] The above is only a preferred embodiment of the present invention, and does not impose any limitations on the present invention. Any simple modifications, changes, and equivalent changes made to the above embodiments according to the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. Use of a composition comprising a small interfering RNA sequence and a short hairpin RNA sequence of fructokinase KHK in the preparation of a drug for treating metabolic bone disease, characterized in that: The composition includes a small interfering RNA sequence and a short hairpin RNA sequence composition a; The small interfering RNA sequence and short hairpin RNA sequence composition a comprises a small interfering RNA basic sequence a and a short hairpin RNA sequence a; The nucleotide sequence of the small interfering RNA basic sequence a is shown in SEQ ID NO.1; the nucleotide sequence of the short hairpin RNA sequence a is shown in SEQ ID NO.2; The small interfering RNA sequence and short hairpin RNA sequence composition a also includes one or more of a small interfering RNA tail modification sequence a, a small interfering RNA cholesterol modification sequence a1, and a small interfering RNA cholesterol modification sequence a2; The sequences of the positive and negative strands of the small interfering RNA tail modification sequence a are: 5'-GCAGCGGAUAGAGGAGCACAAdTdT-3'; 5'-CGUCGCCUAUCUCCUCGUGUUdTdT-3'; The sequences of the positive and negative strands of the small interfering RNA cholesterol modified sequence a1 are: 5'-mGmCmAGCGGAUAGAGGAGCAmCmAmAdTdT-Chol-3'; 5'-phos-mCmGmUCGmCfCfUmAfUmCUmCCmUCmGmUmGmUmUdTdT-3'; The sequences of the positive and negative strands of the small interfering RNA cholesterol modified sequence a2 are: 5'-mGmCmAGCGGAUAGAGGAGCAmCmAmAdTdT-Chol-3'; 5'-phos-mCmGmUfCmGmCfCfUmAfUmCfUmCfCmUfCmGfUmGmUmUdTdT-3'.

Images