Application of ZlRc and ZlRd gene pyramiding in improving seed polyphenol content in rice

By synthesizing and overexpressing the ZlRc and ZlRd genes of Zizania latifolia in rice, the problem of low polyphenol content in cultivated rice was solved, resulting in a significant increase in polyphenol content and enhanced antioxidant capacity of rice seeds.

CN118703551BActive Publication Date: 2026-04-28TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
TOBACCO RESEARCH INSTITUTE OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES (QINGZHOU TOBACCO RESEARCH INSTITUTE OF CHINA NATIONAL TOBACCO COMPANY)
Filing Date
2024-05-21
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Currently cultivated rice has a low content of polyphenolic compounds and lacks effective gene regulation methods to improve its antioxidant and health functions.

Method used

By isolating and aggregating the ZlRc and ZlRd genes from Zizania latifolia, and using constitutive promoters to drive their overexpression in rice, an overexpression vector was constructed and transformed into rice to increase the expression levels of the ZlRc and ZlRd genes.

Benefits of technology

It significantly increased the polyphenol content of rice seeds, especially the content of total phenols, total flavonoids and total proanthocyanidins, and enhanced the DPPH free radical scavenging ability and ABTS·+ free radical absorption ability, turning the seed color into dark brown.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118703551B_ABST
    Figure CN118703551B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to application of Chinese bulrush ZlRc and ZlRd gene polymerization in improving rice seed polyphenol content, wherein the nucleotide sequence of the ZlRd gene is shown as SEQ ID NO:1, and the nucleotide sequence of the ZlRc gene is shown as SEQ ID NO:2. The application aims to improve the rice seed polyphenol content, and can simultaneously overexpress the ZlRc and ZlRd genes in rice. In the case of consistent growth environment with the control plants, compared with the control group, the rice seeds of the ZlRc and ZlRd gene polymerization rice become dark brown, and the rice seed polyphenol content is significantly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the polymerization of ZlRc and ZlRd genes of Zizania latifolia in increasing the polyphenol content of rice seeds. Background Technology

[0002] Polyphenolic compounds include phenolic acids and flavonoids. Phenolic acids in rice mainly include hydroxybenzoic acid and hydroxycinnamic acid. Flavonoids are a class of compounds composed of two aromatic rings and a heterocyclic C3 structure (C6-C3-C6). Due to differences in heterocyclic structures, flavonoids are classified into six major categories: flavonols, flavones, catechols, flavanones, anthocyanins, and isoflavones. Flavonoids usually exist as glycosides linked to some sugars. In rice, the content and types of flavonoids are directly related to the color of the rice, and there are significant differences between different varieties. Most black rice mainly contains anthocyanins, and some black rice also contains proanthocyanidins; most red rice mainly contains proanthocyanidins and does not contain anthocyanins. Polyphenolic compounds in rice have a wide range of biological activities, including antioxidant, free radical scavenging, antitumor, anti-atherosclerotic, hypoglycemic, and anti-allergic activities. Colored rice rich in polyphenolic compounds has important applications in medicine and food.

[0003] Currently, most cultivated rice is white, while most wild rice is red. Grain color has always been an important goal in the domestication process, and the domestication of Rc and Rd is essentially the selection of rice seed coat color. Existing research shows that red rice is mainly controlled by the expression of two genes—Rc on chromosome 7 and Rd on chromosome 1. Rc encodes the bHLH transcription factor, and Rd encodes dihydroflavonol 4-reductase (DFR). Rc is the determining factor in the biosynthesis of proanthocyanidins in rice seed coat and has a complementary effect with the Rd gene. When only Rc is present, the rice seed coat is brown; when only Rd is present, the rice seed coat is colorless; only when both Rc and Rd are present is the rice seed coat red.

[0004] Chinese wild rice resources are abundant in China. Studies have shown that wild Chinese wild rice from the middle and lower reaches of the Yangtze River is a promising candidate variety for domestication of cereal crops. The caryopsis of Chinese wild rice, known as Chinese wild rice, is a whole grain. Its phenolic acids and flavonoids, among other polyphenols, possess excellent antioxidant properties, making it a promising functional food ingredient. Chinese wild rice is rich in polyphenolic compounds; its total polyphenols, total flavonoids, and total proanthocyanidins are 7 times, 3 times, and 6 times higher than those of ordinary rice, respectively, and its antioxidant activity is 4 times that of ordinary rice. Key genes for flavonoid biosynthesis in Chinese wild rice include both structural and regulatory genes. Specifically, Rc encodes the bHLH transcription factor, a regulatory gene for flavonoid biosynthesis; and Rd encodes DFR, a structural gene for flavonoid biosynthesis. Therefore, the discovery of key regulatory and structural genes for the synthesis of phenolic compounds in Chinese wild rice is of great practical significance and application prospects for creating functional rice varieties rich in polyphenols, improving the dietary structure of residents, and reducing dietary risk factors that cause chronic diseases. Summary of the Invention

[0005] The purpose of this invention is to solve the aforementioned problems in the prior art and to propose an application of the polymerization of ZlRc and ZlRd genes of Zizania latifolia in increasing the polyphenol content of rice seeds. This invention aims to increase the polyphenol content of rice seeds by isolating and applying DNA fragments containing ZlRc and ZlRd genes. When the two DNA fragments are polymerized and overexpressed using a constitutive promoter, the polyphenol content of rice seeds is significantly increased.

[0006] The technical solution of this invention is:

[0007] Application of the polymerization of ZlRc and ZlRd genes of Zizania latifolia in improving the polyphenol content of rice seeds, wherein the nucleotide sequence of the ZlRd gene is shown in SEQ ID NO: 1 and the nucleotide sequence of the ZlRc gene is shown in SEQ ID NO: 2.

[0008] Furthermore, the amino acid sequence of the protein encoded by the ZlRd gene is shown in SEQ ID NO: 5, and the amino acid sequence of the protein encoded by the ZlRc gene is shown in SEQ ID NO: 6.

[0009] Furthermore, the constructed ZlRc and ZlRd gene overexpression vectors were transferred into rice to obtain transgenic rice that can simultaneously overexpress ZlRc and ZlRd.

[0010] Furthermore, the ZlRc and ZlRd gene sequences were sequentially constructed into an overexpression vector, and the overexpression vector was transferred into rice. By increasing the expression levels of ZlRc and ZlRd gene mRNA, transgenic rice plants with significantly increased seed polyphenol content were obtained.

[0011] Furthermore, the overexpression vector is transformed into Agrobacterium through chemical transformation, and independent transformants are obtained by infecting callus tissue with Agrobacterium. The transgenic rice is then obtained through plant regeneration.

[0012] The beneficial effects of this invention are:

[0013] (1) In this invention, PCR technology was used to amplify genomic DNA fragments containing the coding sequences of ZlRc and ZlRd genes from the Chinese wild rice cDNA library. These two sequences were then constructed into the PC2300S overexpression vector. The vector was used to transform rice, and transgenic rice plants with significantly increased seed polyphenol content were obtained by increasing the expression levels of ZlRc and ZlRd genes.

[0014] (2) This invention provides the application of ZlRc and ZlRd gene polymerization in increasing the polyphenol content of rice seeds. This invention can effectively polymerize and overexpress ZlRc and ZlRd genes in rice. Seeds harvested from rice plants with ZlRc and ZlRd gene polymerization, grown under the same conditions as control plants, exhibit higher total phenol, total flavonoid, and total proanthocyanidin content, as well as higher DPPH free radical scavenging capacity and ABTS levels compared to the control group. ·+ Free radical uptake capacity. This indicates that the overexpression of ZlRc and ZlRd genes effectively regulates the synthesis pathway of polyphenolic compounds in rice, increases the polyphenol content in transgenic rice seeds, and causes the rice seeds to change from colorless to dark brown.

[0015] (3) Based on the genome sequencing results of Zizania latifolia, this invention cloned the structural gene ZlRd, which controls the biosynthesis of phenolic compounds, from Zizania latifolia through collinearity analysis with the rice genome. Biological function verification showed that overexpression of the ZlRc and ZlRd genes significantly increased the polyphenol content in transgenic rice seeds. This invention confirms the application pathway and method of ZlRc and ZlRd gene aggregation in increasing the polyphenol content of rice seeds. Attached Figure Description

[0016] Figure 1 This is the result of comparing the nucleotide sequence of the ZlRd gene with the nucleotide sequences of homologous genes in rice using ClustalΩ software (publicly available software) in Example 1. Figure 1It can be seen that the nucleotide sequences of ZlRd and Rd have a certain degree of similarity, and several sites are conserved; (Figure labeling explanation: In...) Figure 1 Rd is a gene in rice that is homologous to the present invention, and ZlRd is a gene cloned in the present invention.

[0017] Figure 2 This is the physical map of the ZlRd overexpression vector in Example 2.

[0018] Figure 3 This is a physical map of the ZlRc and ZlRd gene overexpression vectors in Example 2.

[0019] Figure 4 This is an agarose gel electrophoresis image of the positive transgenic rice plants identified in Example 2; M represents DL2000 marker, B represents blank control, N represents negative control, and P represents positive control.

[0020] Figure 5 The figures show the electrophoretic detection results of the PCR products of ZlRc and ZlRd in Example 2. Figure labeling: (A) shows the electrophoretic detection results of the PCR products of the target gene ZlRc; (B) shows the electrophoretic detection results of the PCR products of the target gene ZlRd. M represents the DL2000 marker, B represents the blank control, N represents the negative control, and P1, P2, and P all represent positive controls.

[0021] Figure 6 This is a phenotypic observation of transgenic rice seeds from the control, ZlRd single gene, and ZlRc and ZlRd double gene aggregation in Example 3. Figure labels: (A) control rice seeds; (B) rice seeds obtained by culturing control rice seeds after transfection with the ZlRd gene; (C) rice seeds obtained by culturing control rice seeds after transfection with both ZlRc and ZlRd genes.

[0022] Figure 7 The results show the comparison of total phenol content in transgenic rice seeds of one control (CK), one ZlRd single gene (ZlRd), and three ZlRc and ZlRd double gene aggregation (ZlRcRd-1, ZlRcRd-2, ZlRcRd-3) in Example 4. The test results are the mean of three replicates, and the error bar represents the standard deviation (SD).

[0023] Figure 8 This example includes one control (CK), one ZlRd single gene (ZlRd), and three ZlRd genes from Example 4. c The results of the comparison of total flavonoid content in transgenic rice seeds of ZlRd dual-gene aggregation (ZlRcRd-1, ZlRcRd-2, ZlRcRd-3) were presented. The test results are the mean of three replicates, and the error bars represent the standard deviation (SD).

[0024] Figure 9 The results show the comparison of total proanthocyanidin content in transgenic rice seeds of one control (CK), one ZlRd single gene (ZlRd), and three ZlRc and ZlRd double gene aggregation (ZlRcRd-1, ZlRcRd-2, ZlRcRd-3) in Example 4. The test results are the mean of three replicates, and the error bar represents the standard deviation (SD).

[0025] Figure 10 The results show the comparison of DPPH free radical scavenging capacity of transgenic rice seeds from one control (CK), one ZlRd single gene (ZlRd), and three ZlRc and ZlRd double gene aggregations (ZlRcRd-1, ZlRcRd-2, and ZlRcRd-3) in Example 5; the test results are the mean of three replicates, and the error bars represent the standard deviation (SD).

[0026] Figure 11 ABTS for one control (CK), one ZlRd single gene (ZlRd), and three ZlRc and ZlRd double gene conglomerates (ZlRcRd-1, ZlRcRd-2, ZlRcRd-3) transgenic rice seeds of Example 5. ·+ Free radical absorption capacity; the test results are the mean of three replicates, and the error bars represent the standard deviation (SD). Detailed Implementation

[0027] The present invention will be further described below with reference to the accompanying drawings and embodiments. The technical solutions in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0029] The biological material used in the following examples, *Zizania latifolia*, was collected from Huai'an City, Jiangsu Province, China; the control rice was *Nipponbare* rice, with seeds sourced from Wuhan City, Hubei Province, China.

[0030] Example 1: Obtaining the ZlRd and ZlRc genes

[0031] I. Obtaining the ZlRd gene

[0032] 1. Extraction of total RNA and preparation of cDNA from Zizania latifolia

[0033] 1.1 Extraction of total RNA from Chinese wild rice

[0034] Using a polysaccharide and polyphenol plant RNA extraction kit ( RNA was extracted from *Zizania latifolia* leaves using the Universal Plant Total RNA Isolation Kit (Vazyme) and then reverse transcribed into cDNA. RNA extraction from *Zizania latifolia* leaves was performed according to the instructions for the plant RNA extraction kit; the specific experimental steps are as follows:

[0035] (1) The leaf samples of Chinese wild rice were rapidly ground into powder in liquid nitrogen. 50 mg of the ground sample was weighed and 500 μL of preheated Bufer PRL at 65 °C was added. The mixture was then immediately subjected to violent vortexing for 60 s.

[0036] (2) Incubate the lysate in a 65°C water bath for 5 min, inverting it twice during the process. Centrifuge at 12,000 rpm for 10 min. Transfer the supernatant to a new 1.5 mL RNase-free centrifuge tube, add 0.5 times the volume of the supernatant in anhydrous ethanol, and immediately mix by pipetting.

[0037] (3) Transfer the above mixture to FastPure gDNA-Filter Column II, centrifuge at 12000 rpm for 2 min, and discard the filtrate.

[0038] (4) Add 500 μL of Buffer PRLPlus to FastPure gDNA-Filter Column II, centrifuge at 12000 rpm for 30 s, and collect the filtrate.

[0039] (5) Add 0.5 times the volume of anhydrous ethanol to the filtrate and immediately mix by pipetting; transfer the above mixture to FastPure RNA Column IV, centrifuge at 12000 rpm for 2 min, and discard the filtrate.

[0040] (6) Add 700 μL of Buffer PRW1 to FastPure RNA ColumnIV, incubate at room temperature for 1 min, centrifuge at 12000 rpm for 30 s, and discard the filtrate.

[0041] (7) Add 500 μL of Buffer PRW2 to FastPure RNA Column IV, centrifuge at 12000 rpm for 30 s, discard the filtrate, and repeat this step once.

[0042] (8) Centrifuge the FastPure RNA Column IV adsorption column at 12000 rpm for 2 min to remove the residual Buffer PRW2 in FastPure RNA Column IV.

[0043] (9) Transfer FastPure RNA ColumnIV to a new RNase-free 1.5mL centrifuge tube, add 40μL of RNase-free ddH2O to the center of the adsorption column membrane, incubate at room temperature for 2min, and centrifuge at 12000rpm for 1min.

[0044] 1.2 Preparation of cDNA

[0045] After RNA extraction, the RNA concentration was measured, and 2.0 μg of each sample was used as the substrate for reverse transcription. Reverse transcription was performed using a reverse transcription kit to obtain cDNA products, which were then stored at -20°C for later use.

[0046] Table 1. Reverse Transcription PCR System and Procedure

[0047]

[0048] 2. Amplification of the ZlRd gene

[0049] Primers designed based on the ZlRd gene sequence are as follows:

[0050] ZlRd-F: 5'-ATGGAGGAGACGGCGGC-3' (SEQ ID NO: 3);

[0051] ZlRd-R: 5'-TTATGTTTCAGCAACAATTGGTGGCT-3' (SEQ ID NO: 4).

[0052] Using the prepared ZlRd cDNA as a template, PCR amplification was performed using primers to obtain the target fragment ZlRd. The PCR amplification system and reaction procedure are as follows:

[0053] Table 2 PCR System and Procedure

[0054]

[0055]

[0056] The PCR product was sequenced, and the full-length sequence was 1071 bp. The nucleotide sequence is shown in SED ID NO.1, and the amino acid sequence is shown in SED ID NO.5.

[0057] II. Obtaining the ZlRc gene

[0058] The method for obtaining the ZlRd gene is the same. The full-length sequence of the ZlRc gene is 1971 bp, and the nucleotide sequence is shown in SEDID NO.2, while the amino acid sequence is shown in SED ID NO.6.

[0059] Example 2: Construction and genetic transformation of ZlRc and ZlRd gene aggregation overexpression vectors

[0060] 2.1 Construction of ZlRd gene overexpression vector

[0061] The PC2300S vector was digested with restriction endonucleases KpnI and BamHI. The digestion products were separated by agarose gel electrophoresis, and the linearized PC2300S fragment was recovered using a gel extraction kit. The fragment was then recombined with the PCR amplification product ZlRd, and the target gene was ligated into the vector. This vector was then transformed into competent *E. coli* DH5α cells to obtain the ZlRd overexpression vector. Its physical map is shown below. Figure 2 .

[0062] 2.2 Construction of ZlRc and ZlRd gene aggregation overexpression vectors

[0063] The CDS fragment of ZlRc was amplified and constructed into the linearized 322d1-actP-E9T vector using the restriction endonuclease SpeI via homologous recombination. Then, using the obtained intermediate vector 322d1-actP-ZlRc-E9T as a template, the entire expression cascade fragment of actP::ZlRc::E9T was amplified and constructed into the HindIII cloning site of the ZlRd overexpression vector, resulting in a ZlRc and ZlRd dual-gene aggregation vector. Its physical map is shown below. Figure 3 .

[0064] The ligation product was transformed into E. coli DH5α. The specific transformation steps were as follows: DH5α stored at -80℃ was placed on ice for about 10 minutes for a freeze-thaw cycle. 10 μL of the ligation product was added to 100 μL of DH5α, and the mixture was mixed by pipetting and then placed on ice for 30 minutes. Subsequently, the mixture was heat-shocked in a 42℃ water bath for 90 seconds and then quickly transferred to ice for 2 minutes. 1 mL of antibiotic-free LB liquid medium was added to a clean bench and the mixture was incubated at 37℃ and 220 rpm for 45-60 minutes. The incubated bacterial culture was centrifuged at 6000 rpm for 5 minutes. 500 μL of the supernatant was taken out with a pipette, and the precipitated bacterial cells were resuspended in 500 μL of medium. The resuspended cells were plated and incubated overnight upside down in a 37℃ incubator. Positive clones were picked and incubated overnight at 37℃ and 220 rpm.

[0065] The bacterial colony PCR primers PCB-seqE: 5'-GCACCCCAGGCTTTACACTT-3' (SEQ ID NO: 7) were designed. Colony PCR using primers PCB-seqE (SEQ ID NO: 7) and ZlRd-F: 5'-ATGGAGGAGACGGCGGC-3' (SEQ ID NO: 3) detected positive ZlRd monoclonal antibodies. Colony PCR using primers E9T-340F: 5'-CGTGGCCTCTAATGACCGAA-3' (SEQ ID NO: 8) and 35S-608R: 5'-GTGCGTCATCCCTTACGTCA-3' (SEQ ID NO: 9) detected positive ZlRc monoclonal antibodies. After electrophoresis, positive single colonies with the target band were screened from the colony PCR products and sequenced for verification.

[0066] The steps for extracting plasmids and transforming Agrobacterium EHA105 competent cells are as follows:

[0067] (1) Take Agrobacterium EHA105 competent cells stored at -80℃ and let them partially melt at room temperature or in the palm of your hand. When they are in an ice-water mixture, insert them into ice.

[0068] (2) Add 5 μL of extracted plasmid to every 100 μL of Agrobacterium-infected EHA105 cells, mix well by hand, and incubate on ice for 5 min, liquid nitrogen for 5 min, water bath at 37℃ for 5 min, and ice bath for 5 min.

[0069] (3) Add 700 μL of antibiotic-free LB liquid medium and incubate at 28°C with shaking for 2-3 hours.

[0070] (4) Centrifuge at 6000 rpm for one minute to collect the bacteria. Take about 100 μL of supernatant, gently pipette and resuspend the bacterial block, spread it on an LB agar plate containing kanamycin, and incubate upside down in a 28℃ incubator for 2-3 days.

[0071] 2.3 Obtaining transgenic rice with ZlRc and ZlRd gene aggregation

[0072] (1) Callus preparation

[0073] Step 1: Sterilize mature rice seeds. Use suitable tools to remove the husks from the mature seeds, discarding seeds with mold spots or underdeveloped embryos (shriveled, brown), ensuring the integrity and cleanliness of the seeds. After hulling, wash the rice seeds with 75% ethanol for 1 minute, then sterilize with 0.15% HgCl2 for 15-20 minutes, and finally wash 4-5 times with sterile ddH2O. Soak overnight for the final step.

[0074] Step 2: Induction of rice callus. Wash the seeds with sterile water overnight, peel the embryo along the aleurone layer with a scalpel, and inoculate it onto the induction medium. Inoculate 8-12 sterilized rice seeds into each bottle of induction medium, set the temperature to 30℃, and incubate in the dark for 40-45 days to induce callus formation.

[0075] Step 3: Subculture of callus tissue. Select pale yellow, granular, dry, and highly viable callus tissue from the induced callus and transfer it to a subculture medium for dark culture for 20 days. During the first subculture, be sure to remove any other tissues (such as endosperm, buds, etc.) attached to the callus tissue. Callus tissue that has been subcultured once can be infected with Agrobacterium tumefaciens. Callus tissue used for transformation should be subcultured a maximum of two times. Multiple subcultures can easily lead to somatic cell mutations in the callus tissue and reduce transformation efficiency.

[0076] Step 4: Callus pre-culture. From the subcultured callus, select pale yellow, granular, dry, and highly viable callus tissue and transfer it to pre-culture medium. Inoculate each dish with 60-80 callus granules the size of mung beans. Larger callus granules can be crushed with forceps. Pre-culture at 28℃ in the dark for 3-4 days. After pre-culture, collect the healthy, actively dividing small granules with a small spoon into 250mL sterile Erlenmeyer flasks for Agrobacterium infection.

[0077] (2) Preparation of Agrobacterium

[0078] Step 1: Agrobacterium activation. Two days before the experiment, streak Agrobacterium tumefaciens strain containing the target gene onto LA plates containing the corresponding antibiotics, and then incubate at 28°C for 2 days.

[0079] Step 2: Agrobacterium resuspension. Take an Agrobacterium tumefaciens streaking plate and inoculate approximately one loopful of Agrobacterium into 100 mL of suspension medium. Add 100 μL of acetylsuccinone stock solution and 2 mL of 50% glucose. Incubate at 28°C with shaking at 200 rpm for 30 min. The Agrobacterium suspension concentration should be approximately OD0.05. 600 =0.3 is sufficient.

[0080] (3) Agrobacterium infection and liquid co-culture

[0081] Step 1: Agrobacterium infection. Pour the prepared Agrobacterium suspension into an Erlenmeyer flask containing callus tissue until all callus tissue is submerged, and let it stand for 10 minutes. Discard the bacterial suspension. Take a sterile petri dish containing absorbent paper and filter paper, open the petri dish, and invert the Erlenmeyer flask containing callus onto the filter paper in the petri dish to drain as much bacterial suspension as possible. Then spread the callus on the filter paper in a sterile large dish, cover it with a sterile filter paper, and gently press the filter paper with tweezers to absorb the bacterial suspension on the surface of the callus. Remove the absorbent filter paper, and repeat this process four times on each side. Finally, cover the callus with another filter paper, cover the large petri dish, and let it air dry for 1-2 hours.

[0082] Step 2, Co-culturing. Use tweezers to transfer the dried callus particles onto the co-culture medium and seal with sealing adhesive. Co-culture at 19°C in the dark for 3 days.

[0083] Step 3: Washing. Transfer the co-cultured callus tissue to a washing cup, pour in sterile distilled water until the callus tissue is completely submerged, cover and shake for 20-30 seconds, then discard the sterile distilled water. Repeat this washing process 3-4 times. Observe the process; if the distilled water in the washing cup is clear, it indicates that the Agrobacterium has been basically cleaned; otherwise, continue washing. Finally, discard the sterile distilled water, add sterile distilled water containing 500 mg / L carbenicillin, and let stand for 30 minutes. Discard the sterile distilled water containing 500 mg / L carbenicillin.

[0084] Step 4: Callus screening. After the callus dries, use tweezers to transfer the callus particles to screening medium, seal with sealing adhesive, and place in a dark incubator for 20 days of screening culture (first screening, S1). Select dried callus free from Agrobacterium contamination from the S1 medium and transfer it to S2 medium. Incubate in the dark for 20 days and observe whether fresh, tender yellow resistant callus grows. If no resistant callus has yet appeared, continue transferring to plates for S3 screening culture. Generally, resistant callus can grow in japonica rice varieties after two screenings, i.e., the S2 stage.

[0085] Step 5: Differentiation Culture. Select small, pale yellow, dense, dry, and vigorously growing resistant callus fragments, choosing only one resistant callus fragment per cluster. Avoid selecting callus fragments contaminated with Agrobacterium. Evenly distribute 3-4 small resistant callus fragments in each bottle of differentiation medium. Since callus cells will continue to grow on the differentiation medium, placing them too densely can cause different callus fragments to grow together and become indistinguishable. Culture at 28℃ for 30-40 days, with a light cycle of 16 hours of light / 8 hours of darkness. Once the differentiated seedlings are 3-5 cm tall, they can be used for rooting culture. During the light culture period, promptly remove any contaminated material showing signs of bacterial growth.

[0086] Step 6: Plant Rooting. Using forceps, remove the differentiated seedlings from the differentiation medium and place them in sterilized empty petri dishes. Take only one healthy seedling from each callus fragment. Clean the seedling with scissors, removing dead or yellowed leaves and roots growing from the differentiation medium. Inoculate one seedling into each rooting tube. Culture in a light-filled culture room for 15-20 days until the new roots are fully developed, then transplant.

[0087] Step 7: Plant Transplanting. Remove the sealing film from the rooting tube, add some tap water, and continue hardening off the seedlings in the light culture chamber for 3-4 days. During hardening off, leaf samples can be taken for transgenic positivity testing. Remove the transformed seedlings from the rooting tube, wash off the attached culture medium from the roots, and transplant them into pots or buckets with prepared soil.

[0088] (4) Preparation of reagents and culture media used in the transformation:

[0089] 1) Abbreviations for reagents and solutions:

[0090] The abbreviations for the plant hormones used in the culture medium in this invention are as follows: 6-Benzylaminopurine (6-BA), 6-benzyladenine; Indole-3-acetic acid (IAA), indole-3-acetic acid; Napthalene acetic acid (NAA), naphthaleneacetic acid; 2,4-Dichlorophenoxyacetic acid (2,4-D), 2,4-dichlorophenoxyacetic acid; Kinetin (KT), 6-glycosylaminopurine.

[0091] 2) Main solution formulation:

[0092] MSmax stock solution (10x): Dissolve 16.5g NH4NO3, 1.7g KH2PO4, 19.0g KNO3, 3.7g MgSO4·7H2O, and 3.32g CaCl2 or 4.4g CaCl2·2H2O one by one, and then bring the volume to 1000mL at room temperature.

[0093] MSmin stock solution (100x): Dissolve 2.23g MnSO4·4H2O, 0.86g ZnSO4·7H2O, 0.083g KI, 0.62g H3BO3, 0.025g Na2MoO4·2H2O, 0.0025g CoCl2·6H2O, and 0.0025g CuSO4·5H2O one by one, and then bring the volume to 1000mL at room temperature.

[0094] N6max stock solution (10x): Dissolve 28.3g KNO3, 4.63g (NH4)SO4, 4.0g KH2PO4, 1.85g MgSO4·7H2O, and 1.25g CaCl2 or 1.66g CaCl2·2H2O one by one, and then bring the volume to 1000mL at room temperature.

[0095] N6min stock solution (100x): Dissolve 0.08g KI, 0.16g H3BO3, 0.15g ZnSO4·7H2O, 0.44g MnSO4·4H2O or 0.3335g MnSO4·H2O one by one, and then bring the volume to 1000mL at room temperature.

[0096] Fe 2+-EDTA stock solution (100x): Add approximately 300 mL of dH2O and 2.78 g of FeSO4·7H2O to one reagent bottle; add approximately 300 mL of dH2O to another reagent bottle and heat to 70°C, then add 3.73 g of Na2·EDTA·2H2O; after both are dissolved, allow the solution to cool to room temperature, mix the solutions in the two bottles, then add dH2O to bring the volume to 1000 mL and store at 4°C protected from light.

[0097] Vitamin stock solution (100x): 0.1g nicotinic acid, 0.1g nicotinic thiamine, 1g pyridoxine hydrochloride, 10g inositol, 0.2g glycine, add dH2O to a final volume of 1000mL, store at 4℃.

[0098] AAmax stock solution (10x): 29.50g KCl, 2.50g MgSO4·7H2O, 1.50g NaH2PO4, 1.50g CaCl2·2H2O, add dH2O to make up to 1000mL, store at room temperature away from light.

[0099] AAmin stock solution (100x): 1.0g MnSO4·H2O, 0.2g ZnSO4·7H2O, 0.0025g CuSO4·5H2O, 0.3g H3BO3, 0.075g KI, 0.0025g CoCl2·6H2O, 0.025g NaMoO4·2H2O, add dH2O to bring the volume to 1000mL, store at room temperature protected from light.

[0100] 6-BA stock solution (1 mg / mL): Add 100 mg 6-BA to 1.0 mL of 1N KOH and shake until 6-BA dissolves. Then add dH2O to bring the volume to 100 mL and store at room temperature.

[0101] KT stock solution (1 mg / mL): Add 1.0 mL of 1N KOH to 100 mg KT and shake until KT dissolves. Then add dH2O to bring the volume to 100 mL and store at room temperature.

[0102] 2,4-D stock solution (1 mg / mL): Add 100 mg 2,4-D to 1.0 mL of 1N KOH and shake for 5 min. Then add 10 mL of dH2O and shake until 2,4-D dissolves. Make up to 100 mL with dH2O and store at room temperature.

[0103] 100mM acetylsyl syringone stock solution: 0.196g acetylsyl syringone, 10mL dimethyl sulfoxide, dispensed into 1.5mL centrifuge tubes and stored at 4℃.

[0104] IAA stock solution (1 mg / mL): Add 100 mg IAA to 1.0 mL of 1N KOH and shake until the IAA dissolves. Then, bring the volume up to 100 mL with dH2O and store at room temperature away from light.

[0105] NAA stock solution (1 mg / mL): Add 100 mg NAA to 1.0 mL of 1N KOH and shake until NAA dissolves. Then, bring the volume up to 100 mL with dH2O and store at room temperature away from light.

[0106] 1N KOH stock solution: 5.6g KOH, dissolved in 100mL dH2O, stored at room temperature.

[0107] 0.15% HgCl2: Dissolve 1.5g HgCl2 partially or completely in 1mL of anhydrous ethanol, then bring the volume to 1000mL with dH2O. Stir for 4-8 hours and store properly at room temperature.

[0108] 3) Culture medium formulation for rice genetic transformation:

[0109] Induction medium: 100 mL N6max stock solution (10x), 10 mL N6min stock solution (100x), 10 mL Vitamin stock solution (100x), Fe 2+ Prepare 10 mL of EDTA stock solution (100x), 2.5 mL of 2,4-D stock solution (1 mg / mL), 0.6 g of hydrolyzed casein, 0.3 g of proline, 30 g of sucrose, and 3 g of Phytagel. Adjust the pH to 5.9 and add dH2O to 1000 mL.

[0110] Subculture medium: 100 mL N6max stock solution (10x), 10 mL N6min stock solution (100x), 10 mL Vitamin stock solution (100x), Fe 2+ Prepare 10 mL of EDTA stock solution (100x), 2.0 mL of 2,4-D stock solution (1 mg / mL), 0.6 g of hydrolyzed casein, 0.5 g of proline, 30 g of sucrose, and 3 g of Phytagel. Adjust the pH to 5.9 and add dH2O to 1000 mL.

[0111] Pre-culture medium: N6max stock solution (10x) 12.5 mL, N6min stock solution (100x) 1.25 mL, Vitamin stock solution (100x) 2.5 mL, Fe 2+Prepare 25 mL of EDTA stock solution (100x), 0.75 mL of 2,4-D stock solution (1 mg / mL), 300 μL of acetylsuccinone stock solution, 5 mL of 50% glucose solution, 0.15 g of hydrolyzed casein, 5 g of sucrose, and 1.75 g of agarose. Adjust the pH to 5.4 and add dH2O to 250 mL.

[0112] Co-culture medium: N6max stock solution (10x) 12.5 mL, N6min stock solution (100x) 1.25 mL, Vitamin stock solution (100x) 2.5 mL, Fe 2+ Prepare 25 mL of EDTA stock solution (100x), 0.75 mL of 2,4-D stock solution (1 mg / mL), 300 μL of acetylsuccinone stock solution, 5 mL of 50% glucose solution, 0.2 g of hydrolyzed casein, 5 g of sucrose, and 1.75 g of agarose. Adjust the pH to 5.4 and add dH2O to 250 mL.

[0113] Suspension culture medium: 5 mL N6max stock solution (10x), 0.5 mL N6min stock solution (100x), 1 mL Vitamin stock solution (100x), Fe... 2+ Prepare 0.5 mL of EDTA stock solution (100x), 0.2 mL of 2,4-D stock solution (1 mg / mL), 100 μL of acetylsuccinone stock solution, 2 mL of 50% glucose solution, 0.08 g of hydrolyzed casein, and 2 g of sucrose. Adjust the pH to 5.4 and add dH2O to 100 mL.

[0114] Screening medium: N6max stock solution (10x) 25 mL, N6min stock solution (100x) 2.5 mL, Vitamin stock solution (100x) 2.5 mL, Fe 2+ 2.5 mL of EDTA stock solution (100x), 0.625 mL of 2,4-D stock solution (1 mg / mL), 400 μL of carbenicillin (400 mg / mL), 250 μL of hygromycin B (50 mg / mL), 5 mL of 50% glucose solution, 0.15 g of hydrolyzed casein, 7.5 g of sucrose, and 1.75 g of agarose. Adjust the pH to 6.0 and add dH2O to 250 mL.

[0115] Differentiation medium: 100 mL MSmax stock solution (10x), 10 mL MSmin stock solution (100x), 10 mL Vitamin stock solution (100x), Fe 2+- 10 mL of EDTA stock solution (100x), 2.0 mL of 6-BA, 2.0 mL of KT, 0.2 mL of IAA, 0.2 mL of NAA, 30 g of sucrose, 1 g of hydrolyzed casein, and 3 g of Phytagel. Adjust the pH to 6.0 and add dH2O to 1000 mL.

[0116] Rooting medium: 50 mL MSmax stock solution (10x), 5 mL MSmin stock solution (100x), 10 mL Vitamin stock solution (100x), Fe 2+ - Prepare 10 mL of EDTA stock solution (100x), 20 g of sucrose, and 3 g of Phytagel. Adjust the pH to 5.8 and add dH2O to 1000 mL.

[0117] 2.4 Identification of overexpressing plants

[0118] Leaves were cut from transformed plants, and DNA was extracted using the CTAB method. PCR detection was then performed using primers specific to the selection marker gene. The procedure is as follows:

[0119] (1) Take 1-2g of fresh transformed rice leaves, put them in a mortar pre-cooled with liquid nitrogen, add liquid nitrogen and grind them into powder, then transfer them to a 2mL centrifuge tube; (2) Add 600μL of CTAB separation buffer, invert the centrifuge tube to mix well, and place it in a 65℃ water bath for 30min, gently shaking to mix every 3-4min; (3) Add an equal volume of chloroform:isoamyl alcohol solution with a volume ratio of 24:1, invert the centrifuge tube to mix well, centrifuge at 12000rpm for 15min, and transfer the supernatant to a new 1.5mL centrifuge tube; (4) Add 0.6 times the volume of isopropanol, gently mix, place it at -20℃ to precipitate DNA for 1h, centrifuge at 12000rpm for 15min, and discard the supernatant; (5) Add 700μL of CTAB separation buffer to the DNA precipitate. Wash with 70% ethanol, invert the centrifuge tube, mix well, centrifuge at 12000 rpm for 5 min, discard the supernatant, and place the DNA precipitate in a clean bench to dry naturally; (6) Dissolve the DNA in ddH2O and store at -20℃ for later use.

[0120] Cross-promoter design of overexpression vector transformation positive identification primers: NPTII-F68: 5'-ACTGGGCACAACAGACAATCG-3' (SEQ ID NO: 10), NPTII-R356: 5'-GCATCAGCCATGATGGATACTTT-3' (SEQ ID NO: 11). Agarose gel electrophoresis images are shown below. Figure 4 .

[0121] 2.5 ZlRc and ZlRd gene detection

[0122] Primers for detection of the target gene ZlRc were designed (ZlRc-584bpF: GAAACAGAGAACGACGACGA (SEQ ID NO: 12); ZlRc-584bpR: GGTGTTTGGGCTTCCTTGTA (SEQ ID NO: 13)). A 10 μL reaction mixture was amplified using the following formula: 2×PCR Mix 5 μL, Primer F 0.2 μL, Primer R 0.2 μL, ddH2O 4.1 μL, and DNA template 0.5 μL. The reaction program was: 95℃ for 3 min, 32 cycles (95℃ 10 s, 56℃ 10 s, 72℃ 10 s), 72℃ for 2 min, and 25℃ for 1 min. The PCR amplification products were detected by 1% agarose gel electrophoresis. The results of agarose gel electrophoresis of the PCR amplification products of the target gene ZlRc are shown below. Figure 5 As shown in Figure A, the samples that tested positive for the target gene ZlRc were numbered 1, 4, 9, 12, 15, 20, and 21.

[0123] Primers designed based on the target gene ZlRd (pCB-35SF: ATCCCACTATCCTTCGCAAGA (SEQ ID NO: 14); ZlRd-676R: GGATCGAGTAGTGGGCTTCG (SEQ ID NO: 15)) were used to amplify 23OSGO9 in a 10 μL reaction system: 2×PCR Mix 5 μL, Primer F 0.2 μL, Primer R 0.2 μL, ddH2O 4.1 μL, DNA template 0.5 μL. The reaction program was: 95℃ for 3 min, 32 cycles (95℃ 10 s, 56℃ 10 s, 72℃ 10 s), 72℃ for 2 min, 25℃ for 1 min. The PCR amplification products were detected by 1% agarose gel electrophoresis. The results of agarose gel electrophoresis detection of the PCR amplification products of the target gene ZlRd are as follows: Figure 5 As shown in B, the samples that tested positive for the target gene ZlRd were numbered 1, 4, 9, 12, 15, 16, 17, 18, 19, 20, 21, and 22.

[0124] Example 3 Phenotypic observation of transgenic and control rice seeds containing the ZlRd single gene (ZlRd) and the ZlRc and ZlRd double gene conglomeration (ZlRcRd).

[0125] ZlRd single-gene (ZlRd) and ZlRc and ZlRd double-gene hybrid (ZlRcRd) transgenic rice were cultured under the same greenhouse conditions as the control rice (CK), with the same culture medium and temperature. The materials were grown under normal water and fertilizer conditions until normal grain filling and yellow ripening. After separating the grains from the panicles and drying them, the husks were manually removed. After removing the husks, the seed coat color of ZlRd transgenic rice seeds was similar to that of the control rice seeds, and both seeds were colorless. However, ZlRcRd transgenic rice seeds showed a significant difference in seed coat color compared to the control rice seeds, such as... Figure 6 As shown, the seeds of the ZlRcRd transgenic rice plant are dark brown.

[0126] Example 4: Determination of total phenolic, total flavonoid, and total proanthocyanidin content in ZlRd and ZlRcRd transgenic and control rice seeds

[0127] ZlRd and ZlRcRd transgenic rice seeds obtained after hulling, along with control group seeds, were freeze-dried to constant weight, then ground into powder and passed through a 100-mesh sieve.

[0128] The extraction method for total phenolic compounds in seeds and the detection method for total phenols, total flavonoids and total proanthocyanidins in seeds are derived from the article "Comparison of the contents of phenolic compounds including flavonoids and antioxidant activity of rice (Oryza sativa) and Chinese wild rice (Zizanialatifolia)".

[0129] (1) Extraction of total phenolic compounds from seeds

[0130] Weigh 0.2 g each of ZlRd and ZlRcRd transgenic rice seed powder and control group seed powder (accuracy 0.0001). Add 5 mL of methanol and extract ultrasonically at 50 °C for 80 min. Centrifuge the mixture at 4 °C and 3000 rpm for 10 min. Collect the supernatant and filter through a 0.22 μm polar filter membrane to obtain free phenolic extract. Add 5 mL of 4 mol / L NaOH solution to the remaining filter residue and hydrolyze at 30 °C and 220 rpm for 4 h. Centrifuge the mixture at 4 °C and 3000 rpm for 10 min and collect the supernatant in a 40 mL glass centrifuge tube. Adjust the pH of the supernatant to 1.5-2.0 with 6 mol / L HCl and extract the bound phenols three times with 30 mL of ethyl acetate. The ethyl acetate mixture obtained from the three extractions was evaporated to dryness at 35°C using a rotary evaporator. Then, 5 mL of methanol was added for ultrasonic redissolution. The solution was filtered through a 0.22 μm polar filter to obtain the bound phenol extract, which was stored at 4°C. For measurement, equal volumes (1 mL) of free phenol and the bound phenol extract were mixed to obtain a total phenol compound solution.

[0131] (2) Determination of total phenolic content in seeds

[0132] Total phenol content was determined using the Folin-Ciocalteu colorimetric method. 250 μL of sample solution was added to 250 μL of a 3-fold diluted Folin-Ciocalteu solution and mixed thoroughly. After reacting at room temperature for 5 min, 1 mL of ultrapure water and 250 μL of 20% Na₂CO₃ were added, mixed thoroughly, and reacted in the dark for 30 min. The mixture was then centrifuged at 3000 rpm for 10 min at 4℃. 200 mL of the supernatant was transferred to a 96-well plate, and the absorbance at 725 nm was measured using a microplate reader. Each sample was measured three times. Anhydrous methanol was used as a blank control, and a standard curve was established using gallic acid (GA) as the standard. The total phenol content of each sample is expressed as milligrams of gallic acid equivalent per 100 g of rice seed powder (mg GAE / 100 g).

[0133] (3) Determination of total flavonoid content in seeds

[0134] The reaction was carried out in a 96-well plate. 50 μL of sample extract was added to 10 μL of 5% NaNO₂ aqueous solution, mixed, and reacted at room temperature for 5 min. 10 μL of 10% AlCl₃ aqueous solution was added, mixed, and reacted at room temperature for 1 min. 100 μL of 0.5 M NaOH solution was added, and the reaction was carried out for 10 min. The absorbance at 510 nm was then measured. Each sample was measured three times. Anhydrous methanol was used as a blank control, and a standard curve was established using catechin (C) as a standard. The total flavonoid content in each sample was expressed as milligrams of catechin equivalent per 100 g of rice seed powder (mg CE / 100 g).

[0135] (4) Determination of total proanthocyanidin content in seeds

[0136] The reaction was carried out in 96-well plates. 20 μL of sample was added to 100 μL of vanillin methanol solution (30 g / mL, w / v), followed by 100 μL of sulfuric acid methanol solution (30% concentrated sulfuric acid, v / v). The reaction was carried out at room temperature in the dark for 5 min, and the absorbance at 500 nm was measured using a microplate reader. Each sample was measured three times. Anhydrous methanol was used as a blank control, and a standard curve was established using catechin (C) as a standard. The total phenolic content of each sample was expressed as milligrams of catechin equivalent per 100 g of rice seed powder (mg CE / 100g).

[0137] Test results as follows Figures 7-9 As shown, the total phenolic, total flavonoid, and total proanthocyanidin contents of ZlRd transgenic rice seeds were not significantly different from those of control rice seeds, while the total phenolic, total flavonoid, and total proanthocyanidin contents of ZlRcRd transgenic rice seeds were significantly higher than those of control rice seeds. Specifically, the ZlRd transgenic rice corresponds to positive plant number 16 in Example 2, and the ZlRcRd transgenic rice plants ZlRcRd-1, ZlRcRd-2, and ZlRcRd-3 correspond to positive plants numbered 1, 4, and 9 in Example 2, respectively. The total phenolic, total flavonoid, and total proanthocyanidin contents of ZlRcRd transgenic rice seeds were 1.40 times, 1.19 times, and 1.46 times that of control rice seeds, respectively.

[0138] Example 5: DPPH free radical scavenging ability and ABTS of ZlRd and ZlRcRd transgenic and control rice seeds ·+ Free radical absorption capacity determination

[0139] Seed DPPH free radical scavenging ability, ABTS ·+ The method for detecting free radical absorption capacity is derived from the article "Comparison of the contents of phenolic compounds, including flavonoids and antioxidant activity of rice (Oryza sativa) and Chinese wild rice (Zizanialatifolia)".

[0140] (1) Determination of seed DPPH free radical scavenging ability

[0141] The reaction was carried out in 96-well plates. 50 μL of sample was added to 150 μL of 0.5 mM DPPH methanol solution. After mixing, the mixture was reacted in the dark at 30°C for 30 minutes, and the absorbance at 517 nm was measured using a microplate reader. Methanol was used as a blank control, and vitamin E methanol solution was used as a standard. Each sample was measured three times. The DPPH radical scavenging capacity was expressed as the equivalent vitamin micromoles (μmol TE / 100g) in 100g of rice seed powder.

[0142] (2) Seed ABTS ·+ Free radical absorption capacity determination

[0143] ABTS was obtained by mixing equal volumes of 1.1 mg / mL ABTS methanol solution and 0.68 mg / mL potassium persulfate aqueous solution and incubating overnight in a dark room. ·+ Reagents were diluted with methanol to adjust the absorbance to 0.700 ± 0.020. The reaction was carried out in a 96-well plate, with 50 μL of sample added to 150 μL of ABTS. ·+ In solution, the mixture was reacted in the dark at 30°C for 30 minutes, and the absorbance at 734 nm was measured using an ELISA reader. Methanol was used as a blank control, and vitamin E methanol solution was used as a standard. Each sample was measured three times. ABTS ·+ Free radical absorption capacity is expressed as the equivalent vitamin micromoles (μmol TE / 100g) in 100g of rice seed powder.

[0144] Test results as follows Figure 10 and Figure 11 As shown, this demonstrates the DPPH free radical scavenging ability and ABTS of ZlRd transgenic rice seeds. ·+ The free radical scavenging capacity was not significantly different from that of the control rice seeds, but the DPPH free radical scavenging capacity and ABTS of the ZlRcRd transgenic rice seeds were significantly different. ·+ ZlRcRd transgenic rice seeds showed significantly higher free radical scavenging capacity than control rice seeds. The DPPH free radical scavenging capacity and ABTS of the transgenic rice seeds were also significantly higher. ·+ The free radical absorption capacity was 1.47 times and 1.23 times that of the control rice seeds.

[0145] The transgenic rice seeds synthesized from the ZlRc and ZlRd genes in this invention exhibit significantly higher total phenolic, total flavonoid, and total proanthocyanidin contents than the control rice seeds. Furthermore, their DPPH free radical scavenging ability and ABTS content are significantly higher. ·+ The free radical absorption capacity was significantly higher than that of the control rice seeds. The polymerization of ZlRc and ZlRd genes significantly increased the total phenolic content of the control rice seeds, indicating that the overexpression of ZlRc and ZlRd genes in rice effectively regulates the synthesis pathway of polyphenolic compounds and effectively increases the polyphenol content in rice seeds.

[0146] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, alterations, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Application of Chinese rush ZlRc and ZlRd gene polymerization in improving the polyphenol content of rice seeds, characterized in that, The nucleotide sequence of the ZlRd gene is shown as SEQ ID NO: 1, and the nucleotide sequence of the ZlRc gene is shown as SEQ ID NO:

2.

2. Use according to claim 1, characterized in that, The amino acid sequence of the protein encoded by the ZlRd gene is shown as SEQ ID NO: 5, and the amino acid sequence of the protein encoded by the ZlRc gene is shown as SEQ ID NO:

6.

3. Use according to claim 1, characterized in that, The constructed ZlRc and ZlRd gene polymer overexpression vector is transformed into rice to obtain transgenic rice capable of overexpressing ZlRc and ZlRd.

4. Use according to claim 3, characterized in that, The ZlRc and ZlRd gene sequences are sequentially constructed into an overexpression vector, the overexpression vector is transformed into rice, and the transgenic rice plants with significantly improved seed polyphenol content are obtained by improving the expression amount of ZlRc and ZlRd gene mRNA.

5. Use according to claim 4, characterized in that, The overexpression vector is transformed into Agrobacterium by a chemical transformation method, independent transformants are obtained by the method of Agrobacterium immersion of callus, and the transgenic rice is obtained by plant regeneration.