Application of alfalfa MsTC protein and its encoding gene in regulating plant vitamin E content

Abstract

The present invention discloses the application of alfalfa MsTC protein and its encoding gene in regulating the vitamin E content of plants. The present invention constructs the MsTC gene in alfalfa onto a pBI121 vector to form a pBI121-MsTC recombinant vector, and then transforms the pBI121-MsTC recombinant vector into alfalfa "Zhongmu No. 1" by a method of alfalfa leaf disk Agrobacterium transformation to obtain transgenic alfalfa overexpressing MsTC. Through transgenic experiments, it was found that overexpressing the MsTC gene can significantly increase the vitamin E content of alfalfa, which is of great significance for improving the quality of alfalfa and promoting the stable and healthy development of animal husbandry.

Description

Technical Field

[0001] The invention relates to the field of plant genetic engineering, and in particular to the application of alfalfa MsTC protein and its encoding gene in regulating the vitamin E content of plants. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial leguminous plant, known as the "king of forage grass" for its good palatability, high nutritional value, rich in various trace elements, and rich in protein. As people's demand for high-quality livestock products increases, the demand for high-quality forage grass is also increasing.

[0003] Vitamin E is also known as tocopherol. Animals cannot synthesize vitamin E by themselves and must obtain it from feed. Appropriate supplementation of vitamin E can improve animal immunity, meat quality, and breeding performance. The natural vitamin E (tocopherol) content of alfalfa can no longer meet the requirements of livestock and poultry. The activity of artificially synthesized vitamin E is much lower than that of natural plant synthesis. Therefore, it is necessary to increase the vitamin E content of alfalfa itself to solve the problem of insufficient vitamin E content in alfalfa from the source and promote the improvement of alfalfa quality. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to increase the vitamin E content of plants.

[0005] In order to solve the above technical problems, the present invention first provides a new use of MsTC protein.

[0006] The present invention provides the use of MsTC protein in any of the following 1)-3):

[0007] 1) Regulate the content of vitamin E in plants;

[0008] 2) Cultivating transgenic plants with increased vitamin E content;

[0009] 3) Plant breeding;

[0010] The MsTC protein is any one of a1), a2), a3), or a4):

[0011] a1) the amino acid sequence is the protein shown in SEQ ID No. 2;

[0012] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or the C-terminus of the protein shown in SEQ ID No. 2;

[0013] a3) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 2;

[0014] a4) A protein having 90% identity with the amino acid sequence shown in SEQ ID No. 2 and having the same function.

[0015] In the protein described in a2) above, the tag refers to a polypeptide or protein that is fused and expressed together with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a Myc tag, a GST tag and / or a SUMO tag, etc.

[0016] In the protein described in a3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0017] In the protein described in a4) above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default value) respectively and searching 1, the identity of the amino acid sequence is calculated, and then the value of the identity (%) can be obtained. The identity includes an amino acid sequence having 90% or more, or 91% or more, or 92% or more, or 93% or more, or 94% or more, or 95% or more, or 96% or more, or 97% or more, or 98% or more, or 99% or more homology with the amino acid sequence shown in SEQ ID No. 2 of the present invention.

[0018] The protein described in a1) or a2) or a3) or a4) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0019] In order to solve the above technical problems, the present invention provides a new use of biomaterials related to MsTC protein.

[0020] The present invention provides the use of a biomaterial associated with MsTC protein in any of the following 1)-3):

[0021] 1) Regulate the content of vitamin E in plants;

[0022] 2) Cultivating transgenic plants with increased vitamin E content;

[0023] 3) Plant breeding;

[0024] The biological material is a nucleic acid molecule encoding the MsTC protein or an expression box, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule.

[0025] In the above application, the nucleic acid molecule is the gene shown in B1) or B2) below:

[0026] B1) DNA molecule shown in SEQ ID No.1;

[0027] B2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) and encoding the above-mentioned MsTC protein.

[0028] Wherein, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; Acid molecules can also It can be RNA, such as mRNA or hnRNA.

[0029] A person skilled in the art can easily mutate the nucleotide sequence encoding the MsTC protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence encoding the MsTC protein are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the MsTC protein and have the same function.

[0030] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No.2. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0031] The aforementioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0032] In the above application, the expression cassette refers to a DNA capable of expressing MsTC protein in a host cell, and the DNA may include not only a promoter for initiating MsTC transcription, but also a terminator for terminating MsTC transcription. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters; tissue, organ and development-specific promoters and inducible promoters. Suitable transcription terminators include, but are not limited to, Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, pea rbcS E9 terminator, and nopaline and octopine synthase terminators.

[0033] In the above application, the vector can be a plasmid, a clay, a phage or a viral vector. The recombinant vector can be a vector containing the MsTC gene expression cassette constructed using an existing plant expression vector. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb, etc. The plant expression vector can also contain the 3' non-translated region of the foreign gene, i.e., contain a polyadenylic acid signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylic acid signal can guide the addition of polyadenylic acid to the 3' end of the mRNA precursor, such as the non-translated region transcribed at the 3' end of the Agrobacterium crown gall induction (Ti) plasmid gene (such as the nopaline synthase gene Nos) and the plant gene (such as the soybean storage protein gene) all have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation start region can come from the transcription start region or the structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic marker genes (such as nptII gene that confers resistance to kanamycin and related antibiotics, bar gene that confers resistance to the herbicide phosphinothricin, hph gene that confers resistance to the antibiotic hygromycin, dhfr gene that confers resistance to methotrexate, EPSPS gene that confers resistance to glyphosate) or chemical resistance marker genes (such as herbicide resistance genes), mannose-6-phosphate isomerase gene that provides the ability to metabolize mannose. Considering the safety of transgenic plants, no selective marker gene can be added, and transformed plants can be directly screened by adversity.

[0034] In a specific embodiment of the present invention, the recombinant vector is a pBI121-MsTC recombinant vector; the pBI121-MsTC recombinant vector is a vector obtained by replacing the DNA fragment between the XbaI and BamHI restriction sites of the pBI121 vector with the CDS sequence of the MsTC gene shown in SEQ ID No. 1, while keeping the other sequences of the pBI121 vector unchanged.

[0035] In the above applications, the microorganism may be yeast, bacteria, algae or fungi, such as Agrobacterium. The recombinant microorganism refers to a recombinant microorganism with a changed function obtained by operating and modifying the genes of the target microorganism. For example, a recombinant microorganism obtained by introducing the above recombinant vector into the target microorganism. The recombinant microorganism can be understood to refer not only to a specific recombinant microorganism, but also to the offspring of such a cell, and due to natural, accidental or intentional mutations and / or changes, the offspring may not necessarily be completely identical to the original parent cell, but is still included in the scope of the recombinant microorganism.

[0036] In a specific embodiment of the present invention, the recombinant microorganism is Agrobacterium EHA105 containing the above-mentioned pBI121-MsTC recombinant vector.

[0037] In the above application, the vitamin E includes γ-tocopherol and / or α-tocopherol.

[0038] In the above application, the regulating plant vitamin E content is to increase the plant vitamin E content. Further, the increasing plant vitamin E content is to increase the vitamin E content in plant leaves.

[0039] In a specific embodiment of the present invention, when the expression level of the MsTC gene in a plant is increased, the content of γ-tocopherol, the content of α-tocopherol and the content of total tocopherol in the leaves of the plant are increased.

[0040] In the above application, the purpose of plant breeding is to cultivate plant varieties with high vitamin E content.

[0041] In order to solve the above technical problems, the present invention finally provides a method for cultivating transgenic plants with increased vitamin E content.

[0042] The method for cultivating transgenic plants with increased vitamin E content provided by the present invention comprises the following steps: increasing the content and / or activity of MsTC protein in a receptor plant to obtain a transgenic plant; the vitamin E content of the transgenic plant is higher than that of the receptor plant.

[0043] In the above method, the method for increasing the content and / or activity of the MsTC protein in the recipient plant is to overexpress the MsTC protein in the recipient plant.

[0044] Furthermore, the overexpression method is to introduce the gene encoding the MsTC protein into the recipient plant.

[0045] Furthermore, the coding gene sequence of the protein is shown in SEQ ID No.1.

[0046] In the above method, the vitamin E content of the transgenic plant is higher than that of the recipient plant, which is embodied in any one of the following X1)-X3):

[0047] X1) the content of gamma-tocopherol in the leaves of the transgenic plant is higher than that in the recipient plant;

[0048] X2) the α-tocopherol content in the leaves of the transgenic plant is higher than that in the recipient plant;

[0049] X3) The total tocopherol content in the leaves of the transgenic plant is higher than that of the recipient plant.

[0050] In any of the above-mentioned applications or methods, the transgenic plants are understood to include not only the first generation transgenic plants obtained by transforming the MsTC gene into a recipient plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, or the gene can be transferred into other varieties of the same species, especially commercial varieties, using conventional breeding techniques. The transgenic plants include seeds, callus tissues, complete plants and cells.

[0051] In any of the above uses or methods, the plant is a dicotyledonous plant or a monocotyledonous plant.

[0052] Furthermore, the dicotyledonous plant is a leguminous plant;

[0053] Furthermore, the leguminous plant is a plant of the genus Alfalfa;

[0054] Furthermore, the alfalfa plant is alfalfa;

[0055] In a specific embodiment of the present invention, the alfalfa is alfalfa ("Zhongmu No. 1").

[0056] Compared with the prior art, the outstanding effect of the present invention is that the present invention discovers the MsTC gene that can increase the vitamin E content in alfalfa, and obtains transgenic alfalfa overexpressing MsTC with significantly increased vitamin E content through Agrobacterium transformation.

[0057] The invention constructs the MsTC gene in alfalfa into a pBI121 vector to form a pBI121-MsTC recombinant vector, and then transforms the pBI121-MsTC recombinant vector into alfalfa "Zhongmu No. 1" by a method of alfalfa leaf disk Agrobacterium transformation to obtain transgenic alfalfa overexpressing MsTC. Through transgenic experiments, it is found that overexpressing the MsTC gene can significantly increase the vitamin E content of alfalfa, which is of great significance for improving the quality of alfalfa and promoting the stable and healthy development of animal husbandry. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 The phenotype and expression of pBI121-MsTC transgenic alfalfa. A: Schematic diagram of the structure of the pBI121-MsTC vector. B: Phenotype diagram of 2-month-old wild-type alfalfa and pBI121-MsTC transgenic alfalfa. WT represents wild-type alfalfa. C: RT-qPCR detection of the expression of MsTC in pBI121-MsTC transgenic alfalfa. NbActin is used as the internal reference gene of alfalfa.

[0059] Figure 2 The vitamin E content in pBI121-MsTC transgenic alfalfa. A: γ-tocopherol content in 2-month-old wild-type alfalfa and pBI121-MsTC transgenic alfalfa. B: α-tocopherol content in 2-month-old wild-type alfalfa and pBI121-MsTC transgenic alfalfa. C: Total tocopherol content in 2-month-old wild-type alfalfa and pBI121-MsTC transgenic alfalfa. DETAILED DESCRIPTION

[0060] The present invention is further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, not for limiting the scope of the present invention. The examples provided below can be used as a reference in the art. General Technology The present invention is intended to be a guide for researchers to make further improvements and is not intended to limit the present invention in any way.

[0061] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0062] The alfalfa "Zhongmu No. 1" and pBI121 vector in the following examples are both recorded in the document "Shi K, Liu J, Liang H, Dong H, Zhang J, Wei Y, Zhou L, Wang S, Zhu J, Cao M, Jones CS, Ma D, Wang Z. An alfalfa MYB-like transcriptional factor MsMYBH positively regulates salfalfa seedling drought resistance and undergoes MsWAV3-mediated degradation. J Integr Plant Biol. 2024Apr; 66(4): 683-699.".

[0063] The CDS sequence of the MsTC gene in the following examples is shown as SEQ ID No. 1 in the sequence listing, and the amino acid sequence of the MsTC protein encoded thereby is shown as SEQ ID No. 2 in the sequence listing.

[0064] Example 1. Preparation of pBI121-MsTC transgenic alfalfa

[0065] 1. Construction of pBI121-MsTC vector

[0066] 1. Obtaining alfalfa cDNA

[0067] The leaves of alfalfa "Zhongmu No. 1" were sampled, RNA was extracted using the Trizol method, and the RNA was reverse transcribed into cDNA.

[0068] 2. Using the cDNA obtained in step 1 as a template, perform PCR amplification using the primer pair MsTC-F / MsTC-R with a high-fidelity DNA polymerase to obtain the MsTC fragment. The primer sequences are as follows:

[0069] MsTC-F: gagaacacgggggactctagaATGGAAACCAAGCTATTGAATCCTCCTT;

[0070] MsTC-R: ggactgaccacccggggatccCTACAAGCCAGGTGGTTTAAACAGAG.

[0071] The PCR amplification system was as follows: 2*KOD one 10 μL, MsTC-F (10 μmol / L) 0.5 μL, MsTC-R (10 μmol / L) 0.5 μL, alfalfa cDNA 1 μL, and ddH2O was added to a final volume of 20 μL.

[0072] The PCR reaction program was as follows: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 5 s, extension at 68°C for 20 min, 35 cycles; extension at 68°C for 5 min; and 4°C for 5 min.

[0073] 3. The MsTC fragment obtained in step 2 was subjected to agarose gel electrophoresis, the correct target band was cut and purified and recovered, and the fragment was connected to the pBI121 vector cut with XbaI and BamHI by seamless cloning using Vazyme ClonExpress ll OneStepCloning Kit (Cat. No.: C112) to obtain a ligation product.

[0074] The ligation system was as follows: 1 μL of MsTC fragment, 2 μL of digested pBI121, 4 μL of 5x CE II Buffer, 2 μL of ExnaseII, and ddH2O to a final volume of 20 μL.

[0075] The connection conditions were as follows: 37°C for 30 min.

[0076] 4. The ligation product obtained in step 3 was transformed into DH5α Escherichia coli, and the bacterial solution was spread on a culture plate selected with kanamycin, and inverted and cultured at 37°C overnight. Single colonies were selected for colony PCR identification of positive clones, and single colonies of positive clones were selected and placed in LB medium containing kanamycin resistance, and cultured at 37°C for 12-16 hours. The plasmid was extracted and sequenced, and the plasmid with correct sequencing was recorded as pBI121-MsTC recombinant plasmid.

[0077] The pBI121-MsTC recombinant plasmid is a plasmid obtained by replacing the DNA fragment between the XbaI and BamHI restriction sites of the pBI121 vector with the CDS sequence of the MsTC gene shown in SEQ ID No. 1, while keeping the other sequences of the pBI121 vector unchanged. The schematic diagram of the structure of the pBI121-MsTC recombinant plasmid is shown in FIG. Figure 1 As shown in A.

[0078] 2. Cultivation of pBI121-MsTC transgenic alfalfa

[0079] 1. Mix 50 ng of pBI121-MsTC recombinant plasmid with 100 μL of Agrobacterium tumefaciens EHA105 competent cells, freeze them quickly in liquid nitrogen using the freeze-thaw method, and spread them on a solid culture medium containing kanamycin and rifampicin resistance after recovery to screen and obtain Agrobacterium tumefaciens EHA105 carrying the pBI121-MsTC recombinant plasmid.

[0080] 2. Infect sterile alfalfa ("Zhongmu No. 1") leaf discs with Agrobacterium EHA105 carrying the pBI121-MsTC recombinant plasmid, obtain callus tissue through differentiation culture, and then obtain seedlings through rooting culture and transfer to soil. After the seedlings continue to grow stably, take leaf samples, extract genomic DNA using the CTAB method, and use primers 35S-F and MsTC-R (35S-F: ACTGACGTAAGGGATGACGCAC and MsTC-R: ggactgaccacccggggatccCTACAAGCCAGGTGGTTTAAACAGAG) to detect whether the pBI121-MsTC vector is inserted into the plant. The transgenic seedlings with a band of about 1500 bp obtained by PCR amplification are positive seedlings.

[0081] 3. Take the leaves of positive seedlings and wild-type alfalfa, extract RNA using the Trizol method, and reverse transcribe to obtain cDNA. Use the primer pairs q-MsTC-F and q-MsTC-R and MsActin-F and MsActin-R to perform real-time fluorescence quantitative PCR amplification with the extracted cDNA as a template to detect the expression level of MsTC. The primer sequences are as follows:

[0082] q-MsTC-F:ACTACATTGCGTGCTCCAACATC;

[0083] q-MsTC-R: TTGCTGCCGTCATATCTTCTTTCC;

[0084] q-MsActin-F: CAAAAGATGGCAGATGCTGAGGAT;

[0085] q-MsActin-R:CATGACACCAGTATGACGAGGTCG.

[0086] The results are as follows Figure 1 As shown in C, the results showed that the expression levels of MsTC in pBI121-MsTC transgenic alfalfa OE-MsTC-7, OE-MsTC-27, and OE-MsTC-28 were significantly higher than those in wild-type alfalfa. pBI121-MsTC transgenic alfalfa OE-MsTC-7, OE-MsTC-27, and OE-MsTC-28 were selected for the following biological function analysis.

[0087] Example 2: Detection of Vitamin E Content in pBI121-MsTC Transgenic Alfalfa

[0088] 1. Cuttings of wild-type alfalfa "Zhongmu No. 1" and pBI121-MsTC transgenic alfalfa lines OE-MsTC-7, OE-MsTC-27, and OE-MsTC-28.

[0089] 2. After 2 months of growth, take 50 mg of fresh leaves and grind them in liquid nitrogen until they are as uniform as possible. Add 1 mL of a mixture of methanol and chloroform (2:1) containing 0.01% butylated hydroxytoluene and leave at room temperature for 20 min.

[0090] 3. Then add 300 μL of chloroform and 600 μL of water, mix well and centrifuge at 14000 g for 10 min.

[0091] 4. Discard the upper aqueous phase and transfer the lower organic phase into a new centrifuge tube.

[0092] 5. Dry the organic phase under vacuum and add 400 μL of a mixture of dichloromethane:methanol (1:5) for vitamin E determination.

[0093] 6. The content of vitamin E was determined by HPLC. Tocopherol was measured using a silica gel column (4.6*250 mm length, 5 μm particle size) with n-heptane:isopropanol (99:1) as the mobile phase at a flow rate of 1 mL / min. Vitamin E components were distinguished by the difference in peak time, and the content of each component was calculated relative to the standard. Three biological replicates were set for each experiment.

[0094] The results are as follows Figure 2 As shown, the results showed that: compared with the wild type, the contents of γ-tocopherol, α-tocopherol and total tocopherol in pBI121-MsTC transgenic alfalfa were significantly increased. Among them, the average γ-tocopherol content in the leaves of the wild type and pbi121-MsTC transgenic alfalfa lines OE-MsTC-7, OE-MsTC-27, OE-MsTC-28 was 0.14mg / 100g, 0.34mg / 100g, 0.34mg / 100g and 0.36mg / 100g respectively; the average γ-tocopherol content in the leaves of the wild type and pbi121-MsTC transgenic alfalfa lines OE-MsTC-7, OE-MsTC-27, OE-MsTC-28 was 0.14mg / 100g, 0.34mg / 100g, 0.36mg / 100g respectively. The average α-tocopherol content in the leaves of the wild type and pbi121-MsTC transgenic alfalfa lines OE-MsTC-7, OE-MsTC-27 and OE-MsTC-28 were 4.92 mg / 100g, 8.74 mg / 100g, 6.25 mg / 100g and 7.84 mg / 100g, respectively; the average total tocopherol content in the leaves of the wild type and pbi121-MsTC transgenic alfalfa lines OE-MsTC-7, OE-MsTC-27 and OE-MsTC-28 were 5.06 mg / 100g, 9.08 mg / 100g, 6.59 mg / 100g and 8.20 mg / 100g, respectively.

[0095] The above experimental results show that overexpressing MsTC in wild-type alfalfa can significantly increase the content of vitamin E components in alfalfa.

[0096] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of MsTC protein in any of the following 1) or 2): 1) Increase the content of plant vitamin E; 2) Cultivate transgenic plants with increased vitamin E content; The MsTC protein is any one of a1) or a2): a1) the amino acid sequence is the protein shown in SEQ ID No. 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID No. 2; The plant is alfalfa; The vitamin E is α-tocopherol.

2. Use of biological materials related to MsTC protein in any of the following 1) or 2): 1) Increase the content of plant vitamin E; 2) Cultivate transgenic plants with increased vitamin E content; The MsTC protein is any one of a1) or a2): a1) the amino acid sequence is the protein shown in SEQ ID No. 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID No. 2; The biological material is a nucleic acid molecule encoding the MsTC protein or an expression cassette, a recombinant vector or a recombinant microorganism containing the nucleic acid molecule; The plant is alfalfa; The vitamin E is α-tocopherol.

3. The use according to claim 2, characterized in that: The nucleic acid molecule is the gene shown in B1) or B2) below: B1) DNA molecule shown in SEQ ID No.1; B2) A DNA molecule having 75% or more identity with the nucleotide sequence defined in B1) and encoding the MsTC protein.

4. A method for cultivating a transgenic plant with increased vitamin E content, comprising the following steps: increasing the content and / or activity of MsTC protein in a recipient plant to obtain a transgenic plant; the vitamin E content of the transgenic plant is higher than that of the recipient plant; The MsTC protein is any one of a1) or a2): a1) the amino acid sequence is the protein shown in SEQ ID No. 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and the C-terminus of the protein shown in SEQ ID No. 2; The plant is alfalfa; The vitamin E is α-tocopherol.

5. The method according to claim 4, characterized in that: The method for increasing the content and / or activity of MsTC protein in the recipient plant is to overexpress the MsTC protein in the recipient plant.

6. The method according to claim 5, characterized in that: The overexpression method is to introduce the gene encoding the MsTC protein into the recipient plant.

7. The method according to any one of claims 4 to 6, characterized in that: The coding gene sequence of the MsTC protein is shown in SEQ ID No. 1 in the sequence listing.

Images