TCR targeting KIT D816Y mutation-derived neoantigens and its application

Abstract

The present invention provides a TCR targeting a KIT D816Y mutation-derived neoantigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or a complementary sequence thereof, a vector containing the nucleic acid molecule, and a cell transduced with the nucleic acid molecule or the vector, as well as a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, and use of the TCR, nucleic acid molecule, vector, cell and pharmaceutical composition in detecting, preventing and / or treating cancers associated with KIT D816Y gene mutation-derived neoantigens.

Description

Technical Field

[0001] The present invention belongs to the field of polypeptide drugs and polypeptide vaccines, and specifically relates to a specific TCR targeting KIT D816Y-derived neoantigen and its application in tumor immunotherapy. Background Art

[0002] The KIT gene encodes the stem cell factor receptor (SCFR), a member of the type III tyrosine kinase receptor family. Upon binding to the dimeric molecule SCF, the c-kit protein becomes activated and autophosphorylated, mediating cell proliferation, migration, and differentiation. It is crucial for normal hematopoiesis, reproduction, digestion, and the nervous system.

[0003] Gain-of-function mutations in the KIT gene can lead to increased tyrosine kinase activity, promoting tumor development and progression. They have been identified in a variety of solid and hematological malignancies, including 90% of mastocytosis, 80%-90% of gastrointestinal stromal tumors, 26% of seminoma, 10%-20% of melanoma, and acute myeloid leukemia (AML). Among them, the most common and clinically significant mutations are located in exon 17, with mutations at position D816 being the most common, detected in over 90% of patients with systemic mastocytosis and more than half of patients with t(8;21) AML. Compared with KIT wild-type and other KIT mutants, patients with the D816 mutation have a shorter median remission duration, a higher cumulative relapse rate, and a lower remission rate to relapse-salvage therapy, resulting in a significantly worse prognosis. Some multi-targeted tyrosine kinase inhibitors are effective against KIT gene mutations; however, a considerable number of patients still fail initial treatment or develop secondary drug resistance. Therefore, there is an urgent need to develop new targeted therapies for KIT D816 mutations to improve efficacy.

[0004] Unlike traditional chemotherapy and targeted drugs that directly target tumor cells, cancer immunotherapy harnesses the body's own immune system to generate a sustained immune response against tumor cells by activating T and B cells. In recent years, therapies targeting neoantigens derived from malignant tumor mutations have become a leading immunotherapy option. These neoantigens are expressed exclusively in tumors but not in normal tissues. They are directly recognized by highly sensitive TCRs specific for their epitopes, do not induce central immune tolerance, and possess the advantages of strong immunogenicity and a good safety profile, making them ideal targets for T cell-based immunotherapy. Previous research has shown that a neoantigen derived from KIT D816Y, a common hotspot mutation in KIT (peptide sequence: YIKNDSNYV), is highly immunogenic. Presented on the surface of tumor cells by human leukocyte antigen (HLA-A*02:01), it forms a pHLA complex, inducing T cell activation and significant tumor cell killing, making it a key target for anti-tumor immunotherapy.

[0005] The initiation of a T cell immune response relies on antigen recognition by the TCR. Engineered TCR-T cells, constructed by artificially transducing antigen-specific TCRs into T cells, can target and kill tumor cells, potentially altering the body's immunosuppressive state, inducing specific immune responses, and promoting a virtuous cycle of immune protection. TCR-T cells targeting neoantigens have achieved impressive anti-tumor efficacy in pioneering clinical studies, and neoantigen-specific TCR-T cells persist in patients for a long time, continuously exercising immune surveillance functions. However, there is currently no TCR-T cell therapy for KIT D816Y.

[0006] Given that KIT D816Y is a promising target for immunotherapy and that T cells recognize the KIT D816Y mutation, alternative approaches to targeting KIT D816Y mutation-derived neoantigens include utilizing TCRs for T cell-mediated immunotherapy. However, artificial transduction of native TCR structures is limited by low expression rates and high mismatch rates. Therefore, the development of TCR mutants with enhanced affinity is needed. Summary of the Invention

[0007] The present invention aims to address the deficiencies of the prior art and provides a specific TCR targeting a new antigen derived from the KIT D816Y mutation and its application in tumor immunotherapy.

[0008] According to a first aspect of the present invention, a specific TCR targeting a new antigen derived from the KIT D816Y mutation is provided.

[0009] The new antigen (polypeptide sequence: YIKNDSNYV) derived from the KIT D816Y mutation binds to the HLA-A*02:01 molecule and is presented to the surface of the target cell to form a YIKNDSNYV-HLA-A*02:01 complex.

[0010] The YIKNDSNYV-HLA-A*02:01 complex is recognized by the specific TCR on the surface of T cells, inducing and initiating a specific immune response.

[0011] The TCR has the property of binding to the YIKNDSNYV-HLA-A*02:01 complex, and the TCR comprises a TCR α chain variable region and a TCR β chain variable region;

[0012] The amino acid sequence of CDR3 of the TCRα chain variable region is CAASGRVRDTNAGKSTF (SEQ ID NO: 7).

[0013] And / or the CDR3 amino acid sequence of the TCRβ chain variable region is CSARDGLAGSWLHEQYF (SEQ ID NO: 10).

[0014] Preferably, the amino acid sequences of the three complementary determining regions of the TCRα chain variable region are:

[0015] αCDR1: SEQ ID NO: 5.

[0016] αCDR2: SEQ ID NO: 6.

[0017] αCDR3: SEQ ID NO: 7.

[0018] Preferably, the amino acid sequences of the three complementary determining regions of the TCRβ chain variable region are:

[0019] βCDR1: SEQ ID NO: 8.

[0020] βCDR2: SEQ ID NO:9.

[0021] βCDR3: SEQ ID NO: 10.

[0022] Preferably, in the above-mentioned TCR targeting KIT D816Y mutation-derived neoantigen, the amino acid sequence of the TCR α chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1; and / or the TCR β chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 2.

[0023] Preferably, the TCR comprises the α chain amino acid sequence SEQ ID NO:17.

[0024] Preferably, the TCR comprises the β chain amino acid sequence SEQ ID NO:18.

[0025] Preferably, the TCR is an αβ heterodimer.

[0026] Preferably, the TCR contains an artificial interchain disulfide bond between the α chain and the β chain.

[0027] Preferably, the amino acid sequence of the TCR is shown in SEQ ID NO: 21.

[0028] The second aspect of the present invention provides a nucleic acid molecule comprising a nucleic acid sequence encoding the TCR molecule according to the first aspect of the present invention or a complementary sequence thereof.

[0029] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 3 encoding the TCR α chain variable region.

[0030] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 4 encoding the variable region of the TCR β chain.

[0031] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 19 encoding the TCR α chain.

[0032] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 20 encoding the TCRβ chain.

[0033] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:22.

[0034] The third aspect of the present invention provides a vector, wherein the vector contains the nucleic acid molecule described in the second aspect of the present invention.

[0035] Preferably, the vector is a viral vector.

[0036] More preferably, the viral vector is a lentiviral vector or a retroviral vector.

[0037] The fourth aspect of the present invention provides an isolated host cell, wherein the host cell contains the vector described in the third aspect of the present invention or the exogenous nucleic acid molecule described in the third aspect of the present invention integrated into its genome.

[0038] In a fifth aspect, the present invention provides a cell, which expresses the TCR or antigen-binding fragment thereof targeting the KIT D816Y mutation-derived neoantigen described in the first aspect of the present invention, or carries the polynucleotide described in the second aspect of the present invention, or contains the vector described in the third aspect of the present invention.

[0039] Preferably, the cells are T cells, peripheral blood mononuclear cells (PBMC) or stem cells.

[0040] The sixth aspect of the present invention further provides a method for preparing the TCR or its antigen-binding fragment targeting the KIT D816Y mutation-derived neoantigen, the preparation method comprising culturing the cells of the fifth aspect.

[0041] In a seventh aspect, the present invention further provides the use of a TCR or antigen-binding fragment thereof targeting a KIT D816Y mutation-derived neoantigen according to the first aspect of the present invention, or a polynucleotide according to the second aspect of the present invention, or a vector according to the third aspect of the present invention, or a cell according to the fourth aspect of the present invention, or a cell according to the fifth aspect of the present invention, or a preparation method according to the sixth aspect of the present invention in the preparation of a medicament for treating leukemia.

[0042] In an eighth aspect, the present invention further provides a drug for treating tumors, comprising the TCR or antigen-binding fragment thereof targeting the KIT D816Y mutation-derived neoantigen of the first aspect of the present invention, or the polynucleotide of the second aspect, or the vector of the third aspect, or the cell of the fourth aspect, or the cell of the fifth aspect.

[0043] Through extensive and in-depth research, the present invention has obtained a high-affinity TCR or its antigen-binding fragment that targets a new antigen derived from the KIT D816Y mutation, as well as a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, a vector containing the nucleic acid molecule, and a cell transduced with the nucleic acid molecule or the vector, as well as a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, and the use of the TCR, nucleic acid molecule, vector, cell and pharmaceutical composition for preparing drugs for detecting and preventing / treating tumors.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] (1) The TCR of the present invention can directly eliminate tumor cells by precisely targeting the KIT D816Y mutation;

[0046] (2) The TCR protein of the present invention is highly expressed in vivo and has no mismatch with endogenous TCR chains;

[0047] (3) T cells expressing the TCR of the present invention have strong killing ability and specificity and can be effectively used to treat tumors containing the KIT D816Y mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 :Detection and isolation of new antigen-specific T cells derived from KIT D816Y mutation;

[0049] Figure 2 : Schematic diagram of the original sequence of the new antigen-specific TCR derived from the KIT D816Y mutation;

[0050] Figure 3 : Transduction efficiency of T cells modified with KIT D816Y mutation-derived neoantigen-specific TCR genes;

[0051] Figure 4 :Validation of in vitro activation of KIT D816Y mutation-derived neoantigen-specific TCR-T cells;

[0052] Figure 5 :In vitro cytotoxicity of KIT D816Y mutation-derived neoantigen-specific TCR-T cells;

[0053] Figure 6:KIT D816Y mutation-derived neoantigen-specific TCR-T cells recognize tumor cell lines in vitro;

[0054] Figure 7 :KIT D816Y mutation-derived neoantigen-specific TCR-T cells kill tumor cell lines in vitro;

[0055] Figure 8 :KIT D816Y mutation-derived neoantigen-specific TCR-T cells recognize AML blasts in vitro;

[0056] Figure 9 :KIT D816Y mutation-derived neoantigen-specific TCR-T cells kill AML primitive cells in vitro; DETAILED DESCRIPTION

[0057] In order to better understand the technical content of the present invention, specific embodiments are given and described below with reference to the accompanying drawings.

[0058] Various aspects of the present invention are described in this disclosure with reference to the accompanying drawings, in which a number of illustrative embodiments are shown. The embodiments of the present disclosure are not necessarily intended to be comprehensive. It should be understood that the various concepts and embodiments described above, as well as those described in more detail below, can be implemented in any of a number of ways.

[0059] Example 1. In vitro induction of KIT D816Y mutation-derived neoantigen-specific T cells

[0060] Take HLA-A * PBMCs were isolated and purified by Ficoll density gradient centrifugation from venous blood of healthy volunteers with positive results at 02:01. Dynabeads magnetic beads were used to separate CD8 + cells and CD14 + Resuspend CD14 cells in RPMI-1640 medium containing 10% FBS, 1000 U / mL IL-4, and 1000 U / mL GM-CSF. +Cells were incubated for 3 days to induce dendritic cells (DCs). DCs were reselected in fresh culture medium containing 800 IU / mL GM-CSF, 1000 IU / mL IL-4, 10 ng / mL TNF-α, 10 ng / mL IL-1β, 1000 IU / mL IL-6, and 1 μg / mL PGE2 to induce DC maturation. Mature DCs were recovered and resuspended in serum-free RPMI-1640 medium. A KIT D816Y mutation-derived neoantigen peptide (YIKNDSNYV; 10 μg / mL) was added and incubated at 37°C for 2-4 hours. DCs pulsed with neoantigen peptides were collected, inactivated with 30 μg / mL mitomycin C at 37°C for 30 min, resuspended in RPMI-1640 medium containing 10% FBS (containing IL-2 50 U / mL, IL-7 5 ng / mL, IL-15 5 ng / mL), and incubated with CD8 + Cells were co-incubated, and half of the medium was changed every 2-3 days for 10-20 days. Cells were collected and labeled with PE-labeled neoantigen peptide-HLA-A * 02:01-Tetramer and APC-labeled CD8 antibody staining, followed by flow cytometry analysis.

[0061] Results: After stimulation with KIT D816Y mutation-derived neoantigens, healthy donor CD8 + / Tetramer + The proportion of T cells increased from 0.11% to 0.97% ( Figure 1 ), indicating that KIT D816Y mutation-derived neoantigens induced T cell-specific expansion in vitro.

[0062] Example 2. TCR Sequencing to Obtain HLA-A*02:01-Restricted KIT D816Y Mutation-Derived Neoantigen-Specific TCR

[0063] Flow cytometry sorting of Tetramers + CD8 + Total RNA was extracted from cells using RNeasy Plus Mini Kit (Qiagen). The TCR analysis system synthesizes cDNA with a 5' Race adapter from total RNA and introduces a unique molecular identifier (UMI) to control bottleneck effects and eliminate PCR and sequencing errors. Sequencing is performed on Illumina The system was operated in PE150 mode. Tetramer was obtained separately. + CD8 +The TCRα and TCRβ chain sequences of cells. The sequencing results were analyzed using our independently established method (National Invention Patent Application No.: CN202210939709.2). The TCRα and TCRβ sequences with the highest frequency were considered to be the main clone sequences of T cells.

[0064] The amino acid sequence of the TCRα chain variable region is SEQ ID NO: 1.

[0065] The amino acid sequences of the three complementarity determining regions of the TCRα chain variable region are:

[0066] αCDR1:DSASNY(SEQ ID NO:5),

[0067] αCDR2: IRSNVGE (SEQ ID NO:6),

[0068] αCDR3: CAASGRVRDTNAGKSTF (SEQ ID NO:7).

[0069] The nucleotide sequence of the TCR α chain variable region is SEQ ID NO: 3.

[0070] The nucleotide sequences of the three complementary determining regions of the TCRα chain variable region are:

[0071] αCDR1: GACAGTGCCTCAAACTAC (SEQ ID NO: 11),

[0072] αCDR2: ATTCGTTCAAATGTGGGCGAA (SEQ ID NO: 12),

[0073] αCDR3TGTGCAGCAAGTGGAAGGGTGAGGGACACCAATGCAGGCAAATCAACCTT T (SEQ ID NO: 13).

[0074] The amino acid sequence of the TCRβ chain variable region is SEQ ID NO: 2.

[0075] The amino acid sequences of the three complementarity-determining regions of the TCRβ chain variable region are:

[0076] βCDR1:DFQATT(SEQ ID NO:8),

[0077] βCDR2: SNEGSKA (SEQ ID NO:9),

[0078] βCDR3: CSARDGLAGSWLHEQYF (SEQ ID NO: 10).

[0079] The nucleotide sequence of the TCRβ chain variable region is SEQ ID NO:4.

[0080] The nucleotide sequences of the three complementary determining regions of the TCRβ chain variable region are:

[0081] βCDR1: GACTTTCAGGCCACAACT (SEQ ID NO:14),

[0082] βCDR2: TCCAATGAGGGCTCCAAGGCC (SEQ ID NO: 15),

[0083] βCDR3TGCAGTGCTAGGGACGGACTAGCGGGGCTCCTGGTTACACGAGCAGTACTTC (SEQ ID NO: 16).

[0084] The TCR sequences obtained through sequencing were optimized for the most frequently occurring TCRα and TCRβ sequences, and their constant regions were modified and replaced with optimized mouse constant regions to avoid mismatch between the exogenous TCR and the endogenous TCR of T cells; the expression sequence was codon optimized to increase protein expression; P2A and Furin-cleavage were used to enable TCRα and TCRβ to be expressed simultaneously in a single expression vector.

[0085] Construct a lentiviral expression vector and insert the above TCRα and TCRβ sequences into the same lentiviral expression vector. Figure 2 As shown. 293T cells were used for viral packaging to produce lentiviral particles specific for the KIT D816Y mutation-derived neoantigen-specific TCR.

[0086] Example 3. Construction of specific TCR-T cells targeting KIT D816Y mutation

[0087] Peripheral blood was collected from healthy volunteers, and PBMCs were isolated and purified by Ficoll density gradient centrifugation. The cells were resuspended in AIM-V medium supplemented with 5% FBS and activated at 37°C for 48 hours with the addition of anti-CD3 antibody (OTK3, 50 ng / mL), IL-2 (300 IU / mL), IL-7 (30 ng / mL), IL-12 (15 ng / mL), and TGF-β (5 ng / mL). Activated T cells were then infected with TCR lentiviral particles, supplemented with IL-2 (300 IU / mL) and protamine sulfate (8 μg / mL), and centrifuged at 800 × g for 90 minutes. TCR-transfected T cells were then cultured for an additional 72 hours in AIM-V medium supplemented with 10% FBS, IL-7 (5 ng / mL), IL-15 (5 ng / mL), and IL-2 (1000 IU / mL).

[0088] TCR-T cells were collected, washed twice with FACS buffer, and then PE-mTCRβ flow cytometry antibody and PE neoantigen peptide-HLA-A were added. * 02:01-Tetramer and APC-CD3 flow antibody staining, flow cytometry detection.

[0089] The results are as follows Figure 3 Shown: TCR transduction efficiency (CD3 + / mTCRβ + ) was 68.5%, of which the efficiency of expressing heterodimeric TCR (CD3 + / Tetramer + ) was 29.9%, indicating that TCR-T cells were successfully constructed.

[0090] Example 4. Verification of the in vitro activation function of KIT D816Y mutation-derived neoantigen-specific TCR-T cells

[0091] To test the ability of TCR-T cells to target the KIT D816Y mutation, the activation level of TCR-T cells was measured by enzyme-linked immunosorbent assay (ELISA) using IFN-γ and Granzyme B. The specific steps are as follows:

[0092] TCR-T cells transfected with lentivirus were counted at 1×10 6 / mL density was seeded in 24-well plates, and IL-7 (10 ng / mL) and IL-15 (10 ng / mL) were added on Day 1; on Day 2, T2 cells loaded with neoantigen peptides were co-incubated with TCR-T cells at a ratio of 1:10 to achieve secondary antigen stimulation, and IL-21 (30 ng / mL) was added; on Day 3, IL-7 was added

[0093] The cells were cultured with 10 ng / mL of IL-15 (10 ng / mL) and TCR-T cells were collected as effector cells.

[0094] The loading of different concentrations (10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 T2 cells loaded with KIT D816Y mutation-derived neoantigen peptides at 1×10 5 / 100 μl / well were inoculated into 96-well plates, and TCR-T cells (2×10 5 / 100μl / well) and incubate at 37°C for 18-24 hours. Centrifuge the plate and add 100μl of supernatant from each well to an ELISA strip pre-coated with IFN-γ or Granzyme B antibody. Develop the color according to the manufacturer's instructions and read the plate with a microplate reader. Calculate a standard curve based on the absorbance of the standard, and calculate the IFN-γ or Granzyme B secretion level in each well accordingly. Set up at least three replicates for each concentration in each group, and repeat each experiment three times.

[0095] The results are as follows Figure 4 As shown: When stimulated by T2 cells loaded with KIT D816Y mutation-derived neoantigens, TCR-T cells significantly secreted IFN-γ and Granzyme B, while T2 cells loaded with wild-type antigen peptides had no effect, indicating that TCR-T cell activation is KIT D816Y-specific.

[0096] Example 5. Verification of the in vitro killing function of KIT D816Y mutation-derived neoantigen-specific TCR-T cells

[0097] To verify the ability of TCR-T cells to target the KIT D816Y mutation, the killing ability of TCR-T cells was assessed by quantitatively detecting lactate dehydrogenase (LDH) released during cell lysis. The specific steps are as follows:

[0098] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; T2 cells loaded with KIT D816Y mutation-derived neoantigen peptide (10 μg / mL) were used as target cells in the experimental group, and T2 cells loaded with the corresponding concentration of KIT wild-type antigen peptide (10 μg / mL) were used as target cells in the control group. TCR-T cells and target cells were seeded in 96-well plates at effector-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively. Promega CytoTox The Non-Radioactive Cytotoxicity Assay Kit instructions also include wells for target cell spontaneous release, maximum target cell release, culture medium base control wells, and volume correction control wells. The 96-well plate was incubated at 37°C for 4 hours. The plate was centrifuged, and 50 μl of supernatant from each well was aspirated and added to a fresh 96-well plate. Color development was performed according to the instructions, and the plate was read on a microplate reader. The cytotoxicity percentage was calculated at different effector-target ratios to assess the ability of TCR-T cells to specifically kill T2 cells loaded with the KIT D816Y mutation-derived neoantigen. Each well was set up in triplicate, and the experiment was repeated three times.

[0099] The results are as follows Figure 5 As shown: TCR-T cells significantly killed T2 cells loaded with KIT D816Y mutation-derived neoantigens, but had no effect on T2 cells loaded with KIT wild-type antigen peptides, indicating that TCR-T cells have targeted killing function.

[0100] Example 6. KIT D816Y mutation-derived neoantigen-specific TCR-T cells recognize tumor cell lines in vitro

[0101] To verify the ability of TCR-T cells to recognize tumor cell lines that endogenously present KIT D816Y mutation-derived neoantigens, the activation capacity of TCR-T cells was measured by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0102] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; * 02:01 positive and transfected with OCI-AML3 with KIT D816Y mutation D816Y cells were used as target cells, and original OCI-AML3 cells were used as control target cells. Target cells were 2×10 4 100 μl / well was seeded into a 96-well plate and TCR-T cells were added at effector-target ratios of 20:1, 10:1, 5:1, and 2.5:1. Incubate at 37°C for 18-24 hours. IFN-γ and Granzyme B secretion levels were measured as in Example 4 to assess the specific recognition of AML cell lines by TCR-T cells. At least three replicates were set up for each concentration in each group, and each experiment was repeated three times.

[0103] The results are as follows Figure 6 Shown: In OCI-AML3 D816Y Under the stimulation of cells, TCR-T cells significantly secreted IFN-γ and Granzyme B, but had no effect on OCI-AML3 cells. This shows that TCR-T specifically recognizes HLA-A endogenously presented KIT D816Y mutation-derived neoantigens. * 02:01 + Tumor cell lines.

[0104] Example 7: KIT D816Y mutation-derived neoantigen-specific TCR-T cells kill tumor cell lines in vitro

[0105] To verify the ability of TCR-T cells to target tumor cell lines that endogenously present KIT D816Y mutation-derived neoantigens, the killing capacity of TCR-T cells was measured by LDH release assay. The specific steps are as follows:

[0106] The TCR-T cells transfected and expanded in Example 4 were collected as effector cells; OCI-AML3 cells transfected and expanded in Example 6 were collected D816Yand OCI-AML3 cells served as target cells in the experimental and control groups, respectively. TCR-T cells were added to target cells at effector-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively, and incubated at 37°C for 4 hours. Supernatant was collected, color development was performed, and plate readings were performed as directed in the manufacturer's instructions. Cell lysis rates were calculated using the formula to assess the TCR-T cell-specific killing ability of AML cell lines. At least three replicate wells were set for each concentration in each group, and each experiment was repeated three times.

[0107] The results are as follows Figure 7 As shown: TCR-T cells significantly kill OCI-AML3 D816Y cells, but had no effect on OCI-AML3 cells expressing wild-type KIT. This indicates that TCR-T cells specifically kill HLA-A endogenously presenting new antigens derived from the KIT D816Y mutation. * 02:01 + Tumor cell lines.

[0108] Example 8: KIT D816Y mutation-derived neoantigen-specific TCR-T cells recognize tumor blasts in vitro

[0109] To verify the ability of TCR-T cells to recognize tumor progenitor cells that endogenously present KIT D816Y mutation-derived neoantigens, the activation capacity of TCR-T cells was measured by IFN-γ- and Granzyme B-ELISA. Taking acute myeloid leukemia (AML) as an example, the specific steps are as follows:

[0110] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; HLA-A * 02:01 + / KIT D816Y+

[0111] Bone marrow blasts of AML patients were used as target cells in the experimental group, and HLA-A * 02:01 – / KIT D816Y+ , HLA-A * 02:01 + / KIT D816Y– and HLA-A * 02:01 – / KIT D816Y– AML patients’ bone marrow blasts were used as target cells in the control group. 4100 μl / well was seeded into a 96-well plate. TCR-T cells were added at effector-target ratios of 20:1, 10:1, 5:1, and 2.5:1. Incubate at 37°C for 18-24 hours. IFN-γ and Granzyme B secretion levels were measured as in Example 4 to assess TCR-T cell specific recognition of AML blasts. At least three replicates were set for each concentration in each group, and each experiment was repeated three times.

[0112] The results are as follows Figure 8 Shown: In HLA-A * 02:01 + / KIT D816Y+ Under the stimulation of AML primitive cells, TCR-T cells significantly secreted IFN-γ and Granzyme B. This indicates that TCR-T cells specifically recognize AML primitive cells that endogenously present KIT D816Y.

[0113] Example 9: KIT D816Y mutation-derived neoantigen-specific TCR-T cells kill tumor blasts in vitro

[0114] To verify the ability of TCR-T cells to target tumor progenitor cells that endogenously present KIT D816Y mutation-derived neoantigens, the LDH release assay was used to measure the killing capacity of TCR-T cells. Using AML as an example, the specific steps are as follows:

[0115] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; HLA-A * 02:01 + / KIT D816Y+ Bone marrow blasts of AML patients were used as target cells in the experimental group, and HLA-A * 02:01 – / KIT D816Y+ , HLA-A * 02:01 + / KIT D816Y– and HLA-A * 02:01 – / KIT D816Y– AML patient bone marrow blasts served as target cells in the control group. TCR-T cells were added to each target cell group at effector-target ratios of 20:1, 10:1, and 5:1, respectively, and incubated at 37°C for 4 hours. Supernatant was collected, color development was performed, and plate readings were performed as directed in the manufacturer's instructions. Cell lysis rates were calculated using the formula to assess the TCR-T cell-specific killing of AML blasts. At least three replicate wells were set for each concentration in each group, and each experiment was repeated three times.

[0116] The results are as follows Figure 9 As shown: TCR-T cells significantly kill HLA-A *02:01 + / KIT D816Y+ AML blasts, demonstrating the targeting effect of TCR-T cells on KIT D816Y mutation-positive AML blasts.

[0117] In this embodiment, based on the TCR targeting the KIT D816Y-derived neoantigen, a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, a vector containing the nucleic acid molecule, a cell transducing the nucleic acid molecule or the vector, and a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient are provided, as well as the use of the TCR, nucleic acid molecule, vector, cell and pharmaceutical composition in the detection, prevention and / or treatment of cancers associated with NPM1c gene mutation-derived neoantigens.

[0118] While the present invention has been disclosed above with reference to preferred embodiments, this is not intended to limit the present invention. Persons skilled in the art will readily appreciate that various modifications and variations can be made without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention shall be determined by the claims.

Claims

1. A TCR targeting a new antigen derived from the KIT D816Y mutation, characterized in that: The TCR is capable of recognizing the YIKNDSNYV-HLA-A*02:01 complex, and the TCR comprises a TCR α chain variable region and a TCR β chain variable region: The amino acid sequence of the CDR3 of the TCRα chain variable region is: CAASGRVRDTNAGKSTF(SEQ ID NO:7) The amino acid sequence of the CDR3 of the TCRβ chain variable region is: CSARDGLAGSWLHEQYF(SEQ ID NO:10); The TCRα chain variable region also includes αCDR1 and αCDR2 complementarity determining regions, the amino acid sequences of which are: αCDR1:DSASNY(SEQ ID NO:5), αCDR2: IRSNVGE (SEQ ID NO: 6); The TCRβ chain variable region also includes βCDR1 and βCDR2 complementarity determining regions, the amino acid sequences of which are: βCDR1:DFQATT(SEQ ID NO:8), βCDR2: SNEGSKA (SEQ ID NO:9).

2. The TCR targeting a KIT D816Y mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCRα chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1; the amino acid sequence of the TCRβ chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

2.

3. The TCR targeting a KIT D816Y mutation-derived neoantigen according to claim 1, characterized in that: The TCR comprises an α chain amino acid sequence of SEQ ID NO:

17.

4. The TCR targeting a KIT D816Y mutation-derived neoantigen according to claim 1, wherein: The TCR comprises a β chain amino acid sequence of SEQ ID NO:

18.

5. The TCR targeting a KIT D816Y mutation-derived neoantigen according to claim 1, characterized in that: TCR is an αβ heterodimer with an artificial interchain disulfide bond between the α and β chains.

6. The TCR targeting a KIT D816Y mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR is shown in SEQ ID NO:

21.

7. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the TCR molecule according to any one of claims 1 to 6.

8. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCR α chain variable region is SEQ ID NO:

3.

9. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCR α chain is SEQ ID NO:

19.

10. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCRβ chain variable region is SEQ ID NO:

4.

11. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCRβ chain is SEQ ID NO:

20.

12. The nucleic acid molecule according to claim 7, characterized in that: The nucleotide sequence encoding the TCR molecule is SEQ ID NO:

22.

13. A carrier, characterized in that: The vector contains the nucleic acid molecule according to any one of claims 7 to 12.

14. The carrier according to claim 13, characterized in that: The vector is a lentiviral vector or a retroviral vector.

15. An isolated host cell, characterized in that: The host cell contains the vector according to any one of claims 13 or 14 or the exogenous nucleic acid molecule according to any one of claims 7 to 12 is integrated into its genome.

16. A cell, characterized in that: The cell expresses the TCR targeting the KITD816Y mutation-derived neoantigen according to any one of claims 1 to 6, or carries the nucleic acid molecule according to any one of claims 7 to 12, or contains the vector according to any one of claims 13 or 14.

17. The cell according to claim 16, characterized in that: The cells are T cells, peripheral blood mononuclear cells (PBMC) or stem cells.

18. A drug for treating tumors, comprising the TCR targeting the KITD816V mutation-derived neoantigen according to any one of claims 1 to 6, or the nucleic acid molecule according to any one of claims 7 to 12, or the vector according to any one of claims 13 or 14, or the isolated host cell according to claim 15, or the cell according to any one of claims 16 or 17.

19. Use of the TCR of any one of claims 1 to 6, or the nucleic acid molecule of any one of claims 7 to 12, or the vector of any one of claims 13 or 14, or the isolated host cell of claim 15, or the cell of any one of claims 16 or 17, characterized in that: The application is for preparing medicine for treating acute myeloid leukemia (AML).

Images