A genetically engineered bacterium and its construction method and application

Abstract

The present invention provides a genetically engineered bacterium and a construction method and application thereof, belonging to the field of genetic engineering technology. The plasmid pUT / mini-Tn5 Km is used as a transposon vector to transform the by-alma The gene was introduced into Calcoacetic Acinetobacter 21# (deposit number CGMCC No.31080), and a petroleum hydrocarbon-degrading genetically engineered bacterium was successfully obtained. The genetically engineered bacterium showed high degradation activity for the long-chain alkane n-octacosane, the aliphatic ketones 2-decanone and 2-dodecanone, and has broad application prospects in the remediation of petroleum-contaminated soil.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, in particular to a gene engineering bacterium and a construction method and application thereof. Background Art

[0002] With the continuous development of industrialization, the world's demand for oil, a strategic resource, is increasing. However, due to the leakage of oil during blowouts, transportation, storage and processing, large-scale oil-contaminated soil has been produced. Most of the crude oil produced in my country's oil fields is paraffin-containing crude oil. According to statistics, about 90% of my country's crude oil has a paraffin content of 20% to 40%. Paraffin is mainly composed of long-chain normal alkanes with a carbon chain length of 18 to 30. After the leakage of crude oil, the content of long-chain alkanes in the soil will be high. Long-chain alkanes are not easy to recover in the soil, which will cause soil pollution. Therefore, improving the degradation efficiency of long-chain alkanes is particularly important in the process of repairing oil-contaminated soil.

[0003] The main long-chain alkane-degrading enzymes discovered so far are AlkB, CYP153, AlmA, and LadA. Since Throne-Holst et al. demonstrated through gene knockout and gene complementation experiments that the gene encoding AlmA alma Participated in C 32 and longer-chain n-alkanes after degradation (Throne-Holst M, Wentzel A, Ellingsen TE, et al. Identification of novel genes involved in long-chain nalkane degradation by Acinetobacter sp.strain DSM 17874 [J]. Applied Microbiology and Biotechnology, 2007, 73: 3327–3332.), alma It has been widely studied as a representative gene in the degradation of long-chain alkanes. It is generally believed that it is a gene encoding an alkane hydroxylase and is involved in the terminal hydroxylation process of long-chain alkanes (Wentzel A, Ellingsen TE, Kotlar HK, et al. Bacterial metabolism of long-chain n-alkanes[J]. AppliedMicrobiology and Biotechnolog, 2007, 76: 1209–1221.). Wang et al. demonstrated through heterologous expression and Q-PCR technology that Alcanivorax hongdengensis A-11-3 almaEncodes an alkane hydroxylase that participates in the terminal hydroxylation of long-chain alkanes (Wang WP, Shao ZZ. Genes involved in alkane degradation in the Alcanivorax hongdengensis strain A-11-3 [J]. Applied Microbiology and Biotechnology, 2012,94:437–448.). Li et al. Pseudomonas aeruginosa The expression of catabolic genes and degradation substrates in DN1 were studied and it was found that alma Only in C 20 The mRNA level of the above alkanes increased significantly, among which the substrate was C 32 The largest increase was observed when almA1 and almA2 Afterwards, the growth of the strain on alkanes with chain lengths longer than 32 was inhibited, proving that almA1 and almA2 Encodes an alkane hydroxylase that participates in the 32 and longer chain normal alkanes (Li YP, Pan JC, Ma YL. Elucidation of multiplealkane hydroxylase systems in biodegradation of crude oil n-alkane pollution by Pseudomonas aeruginosa DN1 [J]. Journal of Applied Microbiology, 2019,128:151-160.).

[0004] Live Acinetobacter ( Acinetobacter vivianii ) KJ-1 is a n-dodecane-degrading bacterium isolated from gasoline and diesel-contaminated soil around a gas station near the Caishi Campus of Qilu University of Technology (Shandong Academy of Sciences). It has strong diesel degradation ability. At present, the whole genome sequencing of Acinetobacter KJ-1 has been completed. Through comparison, it was found that the genome of the bacterium contains by-almA Gene. by-almA Genes and existing alma The genes have sequence similarity, but AlmA between different genera may have unique evolutionary origins and different functions. by-almA The specific functions of genes lay the foundation for their future applications.

[0005] At present, the function of the target gene is often studied by introducing the target gene into the recipient bacteria to construct genetically engineered bacteria. Some recipient bacteria are wild-type bacteria, which are different from model Escherichia coli in molecular biology operations. Conventional heat shock transformation methods may not meet the requirements of constructing engineered bacteria, and a large number of expression vectors developed for model Escherichia coli may not be suitable for wild-type bacteria. Considering that the constructed genetically engineered bacteria need to have good ecological safety and stability, and prevent the expression vector from being lost during bacterial passage and causing environmental pollution, this puts higher requirements on the selection of transformation methods and vectors.

[0006] The triparental conjugation transformation method is to transfer the recombinant transposon vector containing the target gene in the donor bacteria to the recipient bacteria by direct contact between the donor bacteria, the recipient bacteria, and the helper bacteria, using the conjugation transfer function between the vectors. The pUT / mini-Tn5Km transposon vector has the function of integrating the target gene into the recipient genome. The oriR6K replicon of the vector can only be replicated when it contains the π protein produced by the pir gene. When the recombinant transposon vector containing the target gene enters the recipient bacteria, since the recipient bacteria cannot produce π protein, the vector without the target gene will eventually disappear in the recipient bacteria as the recipient bacteria continue to proliferate due to the inability to replicate itself. The triparental conjugation transformation method no longer requires the addition of antibiotics, and eliminates the pollution caused by the expression vector entering the natural environment, ensuring the stability and safety of genetic engineering. Summary of the invention

[0007] The present invention provides a genetically engineered bacterium, using plasmid pUT / mini-Tn5 Km as a transposon vector, and transforming by-almA Gene introduction into Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ) 21# (deposit number CGMCC No.31080), a petroleum hydrocarbon-degrading genetically engineered bacterium was successfully obtained. The genetically engineered bacterium showed high degradation activity against the long-chain alkane n-octacosane, the fatty ketones 2-decanone and 2-dodecanone, and has broad application prospects in the remediation of petroleum-contaminated soil.

[0008] The technical solution of the present invention is as follows:

[0009] A genetically engineered bacterium, a strain expressing the amino acid sequence shown in SEQ ID NO.2 of -AlmA enzyme from recombinant Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus )twenty one#.

[0010] The method for constructing the genetically engineered bacteria is to by-almA Gene was introduced into calcoacetic acid acinetobacter 21# to obtain by-almAThe nucleotide sequence of the gene is shown in SEQ ID NO.1, and the deposit number of the calcoacetic acid Acinetobacter 21# is CGMCC No.31080.

[0011] Preferably, the method of introduction is to use a transposon vector to transform by-almA The gene was introduced into the calcoacetic acid Acinetobacter 21#.

[0012] Preferably, the transposon vector is plasmid pUT / mini-Tn5 Km.

[0013] Preferably, the method for constructing the genetically engineered bacteria comprises the following steps:

[0014] (1) Amplification of target gene by-almA ;

[0015] (2) Construction of a recombinant plasmid containing the target gene;

[0016] (3) Connecting the target gene in the recombinant plasmid to the transposon vector to construct a recombinant transposon vector containing the target gene;

[0017] (4) The recombinant transposon vector was introduced into Acinetobacter calcoaceticus 21# through triparental conjugation transformation.

[0018] The genetically engineered bacteria are used in degrading long-chain alkanes and fatty ketones.

[0019] Preferably, the long-chain alkane is n-octacosane.

[0020] Preferably, the aliphatic ketone is 2-decanone or 2-dodecanone.

[0021] The application of the genetically engineered bacteria in repairing petroleum-contaminated soil.

[0022] Preferably, the petroleum-contaminated soil includes alkanes, aromatic hydrocarbons, colloids and asphaltenes.

[0023] Further preferably, the petroleum concentration in the petroleum contaminated soil is 1-5% (w / w).

[0024] Beneficial effects:

[0025] The present invention uses plasmid pUT / mini-Tn5 Km as a transposon vector and transforms the of- almaThe gene was introduced into Calcoacetic Acinetobacter 21# (deposit number CGMCC No.31080), and a petroleum hydrocarbon-degrading genetically engineered bacterium was successfully obtained. This genetically engineered bacterium showed high degradation activity against the long-chain alkane n-octacosane, aliphatic ketones 2-decanone and 2-dodecanone, and has broad application prospects in the remediation of petroleum-contaminated soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 for av-almA-N Electropherogram of the gene.

[0027] Figure 2 For the recombinant plasmid pLB- av-almA-N Electrophoresis of the digestion products.

[0028] Figure 3 for av-almA-N Gene and by-almA Gene sequence comparison results.

[0029] Figure 4 For the recombinant transposon vector pUT / mini-Tn5- av-almA-N Enzyme digestion verification results.

[0030] Figure 5 These are the results of strain antibiotic resistance selection and triparental conjugation screening.

[0031] Figure 6 This is the PCR verification result of triparental conjugation transformants.

[0032] Figure 7 This study is about the growth characteristics of the original strain 21# and the genetically engineered strain 21#-A3.

[0033] Figure 8 The degradation performance of the original strain 21# and the genetically engineered strain 21#-A3 on n-octacosane.

[0034] Figure 9 For the recombinant expression plasmid pET28a(+)- av-almA-N Electrophoresis diagram of .

[0035] Figure 10 The original strain E.coli BL21(DE3) and genetically engineered bacteria E.coli BL21(DE3)- av-almA-N Degradation performance of n-octacosane.

[0036] Figure 11 This is the GC spectrum of n-octacosane.

[0037] Figure 12 The original strain 21# and the genetically engineered strain 21#-A3 of-AlmA enzyme activity.

[0038] Figure 13 This is an experiment for remediation of oil-contaminated soil.

[0039] Figure 14 This is the degradation rate of petroleum in soil by the original strain 21# and the genetically engineered strain 21#-A3. DETAILED DESCRIPTION

[0040] The technical scheme of the present invention is further described below in conjunction with the examples. The experimental operations involved in the examples, unless otherwise specified, are all conventional technical operations in the art; the drugs and reagents involved in the examples, unless otherwise specified, are all conventional commercially available products.

[0041] Live Acinetobacter ( Acinetobacter vivianii )KJ-1, with the deposit number CGMCC No.20664, disclosed in patent application CN112725240A (application number 202110162231.2, application date February 5, 2021).

[0042] Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ) 21#: Screened from petroleum-contaminated soil of Shengli Oilfield, deposited on June 25, 2024 at the General Microbiology Center of China Culture Collection Administration, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No.31080.

[0043] Example 1: Target gene av-almA-N Amplification

[0044] Reference of - alma The nucleotide sequence of the gene was determined by DNA man software. The forward and reverse primers were designed, and NotⅠ restriction site was added to the 5' end of the forward primer and the 5' end of the reverse primer to facilitate the subsequent restriction and ligation reactions. The primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the target gene was obtained by PCR amplification. av-almA-N The specific steps are as follows:

[0045] (1) Extraction of live Acinetobacter KJ-1 genome

[0046] Live Acinetobacter ( Acinetobacter vivianii ) KJ-1 was streaked and a single colony was picked and cultured overnight in a shaker at 30°C and 150 rpm. 1 mL of overnight culture solution was centrifuged to collect the bacteria, and the genome was extracted using the Biotech Bacterial Genomic DNA Rapid Extraction Kit.

[0047] (2) Amplification of target gene fragments

[0048] Using primers FN- av-almA-N and RN- av-almA-N, The extracted live Acinetobacter KJ-1 genome was used as a template for PCR amplification. After amplification, the PCR amplification product was purified and recovered using the Tiangen ordinary agarose gel DNA recovery kit. The gene with the NotⅠ restriction site amplified using the live Acinetobacter KJ-1 genome as a template was named av-almA-N .

[0049] Wherein, the primer FN- av-almA-N and RN- av-almA-N The sequence is as follows, and the underline indicates the NotⅠ restriction site:

[0050] FN- av-almA-N :ATTT GCGGCCGC ATGGAAAAGCAAGTTGACGTATT;

[0051] RN- av-almA-N :TAAA GCGGCCGC TTACGATACCAGTTTTGGTTTACGA.

[0052] The reaction system of the PCR amplification is shown in Table 1:

[0053] Table 1. PCR amplification reaction system

[0054]

[0055] The reaction procedure of the PCR amplification is shown in Table 2:

[0056] Table 2. PCR amplification reaction program

[0057]

[0058] The DNA fragments after PCR amplification were subjected to agarose gel electrophoresis. The electrophoresis results were as follows: Figure 1 As shown, lane M is a DNA marker, lane 1 is a ddH2O negative control, and lane 2 is DNA after PCR amplification. Figure 1 It can be seen that the DNA band after PCR amplification is single, bright, and clear, with a length of about 1500bp, which is consistent with the actual size of the target gene fragment, indicating that primers FN- av-almA-N and RN- av-almA-N It has good specificity and can amplify the target gene.

[0059] Example 2: Recombinant plasmid pLB- av-almA-N Construction

[0060] (1) av-almA-N Ligation of gene with vector pLB

[0061] Will av-almA-N The gene and the vector pLB were digested with NotⅠ and then blunt-ended. The ligation reaction system is shown in Table 3:

[0062] Table 3. Ligation reaction system

[0063]

[0064] After the above reaction system is configured, flick the PCR tube, centrifuge briefly for 3-5 seconds, and then place the PCR tube in a 22°C metal bath for reaction for 20 minutes. After the reaction is completed, the ligation product is obtained; place the PCR tube containing the ligation product on ice for subsequent transformation experiments.

[0065] (2) E. coli Transformation of DH5α competent cells

[0066] Select heat shock transformation as the transformation method, take 100 μL E.coli Place the DH5α competent cells on an ice box, wait for them to melt, add 10 μL of the ligation product in step (1), flick to mix, place on ice for 30 min, and then place in a 42°C metal bath for 45 s, place on ice for 2 min, and obtain the transformed bacterial solution. Shaking the centrifuge tube is prohibited during this process. Add 1 mL of LB liquid culture medium to the transformed bacterial solution, and resuscitate in a shaker at 37°C and 200 rpm for 60 min to obtain the culture solution. Then take 200 μL of the culture solution and spread it on LB solid culture medium with an ampicillin antibiotic concentration of 100 μg / mL, place it in a 37°C incubator and invert it for overnight culture until a single colony grows.

[0067] (3) Recombinant plasmid pLB- av-almA-N Verification

[0068] Pick a single colony from step (2) and inoculate it into 5 mL LB liquid medium for culture. When the bacterial solution becomes turbid, use the Tiangen Rapid Plasmid Extraction Kit to extract the plasmid. Perform enzyme digestion verification on the extracted plasmid. Use NotⅠ single enzyme digestion for enzyme digestion verification. The enzyme digestion reaction system is shown in Table 4:

[0069] Table 4. Enzyme digestion reaction system

[0070]

[0071] The above reaction system was reacted in a 37°C metal bath for 30 min. After the reaction, agarose gel electrophoresis was performed to verify the results. Figure 2 As shown, two target bands were obtained by enzyme digestion in lanes 1 to 3, with lengths of about 1500 bp and 2800 bp, respectively, corresponding to av-almA-N gene and pLB vector, which indicates av-almA-N The gene was successfully connected to the pLB vector; no target gene band was obtained in lane 4, which may be due to incomplete enzyme digestion or the selection of false positive clones.

[0072] The above verified recombinant plasmid pLB- av-almA-N The samples were sent to Qingdao Paisonno Gene Technology Co., Ltd. for sequencing, and the sequencing results were compared with those obtained from live Acinetobacter KJ-1. by-almA The gene sequences were compared and the results were as follows Figure 3 shown by Figure 3 Available, amplified av-almA-N Gene (abbreviated as almA-N in the figure) and by-almA The similarity of the gene (abbreviated as almA in the figure) reached 100%, and av-almA-N The two ends of the gene contain NotⅠ restriction sites, which proves that the recombinant plasmid pLB- av-almA-N Build successful.

[0073] Example 3: Recombinant transposon vector pUT / mini-Tn5- av-almA-N Construction

[0074] The recombinant plasmid pLB- av-almA-N The transposon vector pUT / mini-Tn5 Km needs to be dephosphorylated during enzyme digestion to prevent the vector from self-ligating during subsequent ligation. av-almA-N The enzyme digestion method is shown in Example 2. The enzyme digestion reaction system of pUT / mini-Tn5 Km is shown in Table 5:

[0075] Table 5. Enzyme digestion reaction system

[0076]

[0077] The above reaction system was reacted in a metal bath at 37°C for 30 min, and agarose gel electrophoresis was performed to verify the reaction. av-almA-N After digestion with pUT / mini-Tn5 Km, the product was purified and recovered. av-almA-N (1500 bp) and pUT / mini-Tn5 Km (7500 bp), followed by a ligation reaction. The ligation reaction system is shown in Table 6, wherein the vector pUT / mini-Tn5 Km and av-almA-N The mass ratio between genes was 1:7.

[0078] Table 6. Ligation reaction system

[0079]

[0080] The above reaction system was connected at 16°C overnight, and then the connection product was converted to E.coli S17-1(λpir) competent cells, take 800μL of transformed bacterial solution and spread it on LB solid medium with an ampicillin concentration of 100μg / mL, and invert and culture it in a 37℃ incubator until a single colony grows. Pick a single colony and continue to culture it. After the culture is completed, extract the plasmid and perform NotⅠ single enzyme digestion verification. The enzyme digestion verification result is as follows Figure 4 shown by Figure 4 It can be seen that there are two clear bands near 7500 bp and 1500 bp in lanes 2, 4, 8, and 10, corresponding to pUT / mini-Tn5 Km and av-almA-N gene, proving that the recombinant transposon vector pUT / mini-Tn5- av-almA-N Build successful.

[0081] The strain with the correct enzyme digestion verification result was named E.coli S17-1- av-almA-N, And store in a -20℃ refrigerator.

[0082] Example 4: Recombinant transposon vector pUT / mini-Tn5- av-almA-N Triparental transformation

[0083] (1) The recipient bacteria (Acinetobacter calcoaceticus 21#) were inoculated into LB liquid culture medium containing chloramphenicol (30 μg / mL) resistance, and cultured overnight at 30°C and 150 rpm. After the culture was completed, the recipient bacteria were cultured at 40°C for 20 min to limit the inactivation of the system in a short period of time and prevent the degradation of exogenous DNA after entering the recipient bacteria, thereby obtaining a recipient bacterial solution;

[0084] The donor bacteria ( E.coli S17-1 -of-almA-N ) was inoculated into LB liquid medium containing kanamycin (50 μg / mL) and cultured overnight at 30°C and 150 rpm to obtain donor bacterial liquid;

[0085] The auxiliary bacteria ( E.coli HB101, pRK2013, purchased from Miaolingbio) was inoculated into LB liquid medium containing kanamycin (50 μg / mL) resistance and cultured overnight at 30°C and 150 rpm to obtain auxiliary bacterial liquid.

[0086] (2) Take 1 mL of the recipient bacterial suspension, donor bacterial suspension and auxiliary bacterial suspension respectively and place them in 3 centrifuge tubes. Centrifuge at 10,000 rpm for 3 min. Discard the supernatant and add physiological saline to wash the bacteria three times. Then resuspend the bacteria with 1 mL of physiological saline to obtain the recipient bacterial suspension, donor bacterial suspension and auxiliary bacterial suspension respectively.

[0087] (3) Take 100 μL of the recipient bacterial suspension, 150 μL of the donor bacterial suspension, and 150 μL of the helper bacterial suspension, respectively, mix them into a centrifuge tube, centrifuge at 10,000 rpm for 3 min, discard the supernatant, add 200 μL of LB liquid culture medium to resuspend the bacteria, then aspirate 20 μL and spread it on LB solid culture medium without antibiotics, and culture at 30°C overnight until the bacteria grow.

[0088] When the above three bacteria are mixed, the auxiliary bacteria ( E.coli The auxiliary plasmid pRK2013 contained in HB101) swims into the donor bacteria ( E.coli S17-1 -of-almA-N ), the mobile gene on the auxiliary plasmid ( mole ) and transfer genes ( walk ) Activate the recombinant transposon vector pUT / mini-Tn5- av-almA-N The specific transfer origin (ori) and activation site (bom) on the vector pUT / mini-Tn5- av-almA-N It is driven to transfer into the recipient bacteria (Acinetobacter calcoaceticus 21#) and integrated into the chromosome of the recipient bacteria under the action of transposase.

[0089] (4) Use an inoculation loop to scrape off as much of the bacterial cells as possible from step (3), resuspend them in 1 mL of LB liquid medium, apply 200 μL of the culture medium to LB solid medium containing kanamycin (50 μg / mL) and chloramphenicol (30 μg / mL), and incubate at 30°C upside down until a single colony grows. The results are as follows: Figure 5 As shown in Figure (b).

[0090] Antibiotic resistance of recipient, donor and helper bacteria Figure 5 As shown in Figure (a), the auxiliary bacteria ( E． coli HB101) and donor bacteria ( E.coli S17-1 -of-almA-N ) do not have chloramphenicol resistance (Cam), both have kanamycin resistance (Kan), and the recipient bacteria (Acinetobacter calcoaceticus 21#) have chloramphenicol resistance but not kanamycin resistance. av-almA-NAfter entering the recipient bacteria (Acinetobacter calcoaceticus 21#), it can be made resistant to kanamycin. Therefore, the strain that can grow in the medium containing kanamycin and chloramphenicol is the transformant.

[0091] (5) Pick a single colony from step (4) and culture it in LB liquid medium, then extract the genomic DNA from the bacterial solution; use the genomic DNA as a template and perform PCR amplification with two pairs of primers KJ-1-F, KJ-1-R and 21-AF, 21-AR. Primers KJ-1-F, KJ-1-R and 21-AF, 21-AR are based on the calcoacetic acid Acinetobacter 21# ac-almA Gene and Live Acinetobacter KJ-1 by-almA The difference in gene sequence was designed, and the primers 21-AF and 21-AR were used to detect the genes carried by strain 21#. ac-almA Whether the gene still exists, primers KJ-1-F and KJ-1-R can be used to detect whether the genome of the transformant contains the inserted by-almA Gene.

[0092] Wherein, the sequences of the primers KJ-1-F, KJ-1-R, 21-AF, and 21-AR are as follows:

[0093] KJ-1-F: CGGGTTGGCTGTACATCTCTCTAAGC;

[0094] KJ-1-R: GCGATGGATCTGCATGCGCAATG;

[0095] 21-AF: TGGAATTGCTGCCCATTTATCA;

[0096] 21-AR: CAGTCTTATCACCCGACGGAACT.

[0097] The PCR amplification product was verified by DNA electrophoresis using agarose gel. Figure 6 As shown, lane 1 is the PCR amplification result using primers 21-AF and 21-AR with the genome of strain 21# as template, lane 2 is the PCR amplification result using primers KJ-1-F and KJ-1-R with the genome of strain 21# as template, and lanes 3 to 24 are the PCR amplification results using primers 21-AF, 21-AR and KJ-1-F, KJ-1-R with the genome of transformants as templates. Figure 6 It can be seen that lane 1 amplified the strain 21# itself ac-almA Gene, lane 2 did not amplify the expected introduced by-almA Gene, indicating that strain 21# ac-almA The gene sequence was similar to that of strain KJ-1 by-almAThe gene sequences have certain differences and the primers have good specificity; Lanes 2-3, 9-10, 19-20 are PCR amplifications using the selected A3, A6, and A11 transformant genomes as templates, and all detected ac- alma and by-almA The target band indicates that the recombinant A3, A6, and A11 transformants retain the original ac-almA The gene was successfully inserted into the genome by-almA Gene.

[0098] The PCR amplification products with the correct verification results were sent to Qingdao Paisonno Gene Technology Co., Ltd. for sequencing. The sequencing results showed that the DNA sequences amplified by primers KJ-1-F, KJ-1-R and 21-AF, 21-AR using the A3 transformant genome as a template were by-almA Genes and ac-almA The gene sequences are consistent, proving by-almA The gene has been successfully inserted into the recipient strain 21#, and the genetically engineered bacteria have been successfully constructed. This genetically engineered bacteria was named Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus )21#-A3.

[0099] Example 5: Study on the growth characteristics of genetically engineered bacteria 21#-A3

[0100] The original strain 21# and the genetically engineered strain 21#-A3 were streaked and cultured separately. When colonies grew out, single colonies were picked and placed in LB liquid culture medium and cultured overnight at 30°C and 150rpm. The culture solution was centrifuged at 4°C and 7000rpm for 5min, and the bacterial precipitate was washed 3 times with PBS buffer and resuspended to obtain OD values. 600 It is 0.6 for 21# bacterial suspension and 21#-A3 bacterial suspension.

[0101] The 21# bacterial suspension and the 21#-A3 bacterial suspension were inoculated into LB liquid culture medium at a 2% (v / v) inoculation rate, and cultured at 30°C and 150rpm; the 21# bacterial suspension and the 21#-A3 bacterial suspension were inoculated into inorganic salt culture medium containing 1g / L n-octacosane at a 5% (v / v) inoculation rate, and cultured at 30°C and 150rpm. The culture fluid samples were collected regularly to monitor the growth of the two strains in LB liquid culture medium and inorganic salt culture medium containing 1g / L n-octacosane.

[0102] The components of the inorganic salt medium containing 1 g / L n-octacosane are as follows: 1 g / L n-octacosane, 0.5 g / L K2HPO4, 2.0 g / L NaSO4, 1.0 g / L NH4Cl, 0.02 g / L MgSO4∙7H2O, 0.07 g / L CaCl2, 1.0 mL / L trace salt solution, pH 7.0-7.2;

[0103] The components of the trace salt solution are as follows: 0.03 g / L FeCl3, 0.0005 g / L CuSO4, 0.0005 g / L MnSO4·H2O and 0.01 g / L ZnSO4·7H2O.

[0104] The growth of the strain inoculated into LB liquid medium was determined by absorbance method, and the absorbance was measured at a wavelength of 600 nm using a UV-1200 spectrophotometer; the OD of the strain inoculated into the medium containing 1 g / L n-octacosane inorganic salt was 600 The value is low and OD 600 The change is not obvious, so the change of protein concentration in the culture medium is used to monitor the growth of bacteria, and the BCA method is selected as the method for detecting protein concentration.

[0105] The growth curves of the original strain 21# and the genetically engineered strain 21#-A3 in LB liquid medium are shown in Figure 2. Figure 7 As shown in Figure (a), under the same culture conditions, the growth ability of the genetically engineered bacteria 21#-A3 is almost the same as that of the original strain 21#, which indicates that by-almA The introduction of genes did not significantly affect the growth ability of genetically engineered bacteria 21#-A3. In addition, the growth rates of the original strain 21# and the genetically engineered bacteria 21#-A3 in the logarithmic phase were similar, and they entered the decay phase almost at the same time, but the decay rate of the genetically engineered bacteria was slower than that of the original strain 21#. This may be because the slightly larger amount of bacteria in the original strain 21# consumed the nutrients and dissolved oxygen in the culture medium more quickly. Overall, by-almA The introduction of genes did not significantly affect the growth rate and biomass of genetically engineered bacteria 21#-A3 in LB liquid culture medium.

[0106] The growth curves of the original strain 21# and the genetically engineered strain 21#-A3 in the medium containing 1g / L n-octacosane inorganic salt are shown in Figure 7 As shown in Figure (b), both the original strain 21# and the genetically engineered strain 21#-A3 showed the ability to proliferate by using n-octacosane as the degradation substrate. Comparing the two growth curves in Figure (b), it can be seen that the genetically engineered strain 21#-A3 always has more biomass than the original strain 21#, which indicates that by-almAThe introduction of genes improved the growth ability of genetically engineered bacteria 21#-A3 in inorganic salt culture medium containing n-octacosane.

[0107] Example 6: Long-chain alkane degradation performance of genetically engineered bacteria 21#-A3

[0108] In this experiment, n-octacosane, a representative pollutant in long-chain alkanes, was selected as the degradation substrate. The degradation performance of n-octacosane by the original strain 21# and the genetically engineered strain 21#-A3 was determined. The operation steps are as follows:

[0109] The original strain 21# and the genetically engineered strain 21#-A3 were streaked and cultured separately. When colonies grew out, single colonies were picked and placed in LB liquid culture medium and cultured overnight at 30°C and 150rpm. The culture solution was centrifuged at 4°C and 7000rpm for 5min, and the bacterial precipitate was washed 3 times with PBS buffer and resuspended to obtain OD values. 600 It is 0.6 for 21# bacterial suspension and 21#-A3 bacterial suspension.

[0110] The bacterial suspension 21# and the bacterial suspension 21#-A3 were inoculated at an inoculation rate of 5% (v / v) into an inorganic salt culture medium containing 1 g / L of n-octacosane. The culture fluid was sampled regularly to determine the degradation rate of n-octacosane by the original strain 21# and the genetically engineered bacteria 21#-A3. The inorganic salt culture medium containing the same amount of n-octacosane without inoculation was used as a blank control. Three parallel experiments were set up for each group of experiments.

[0111] Extraction method of n-octacosane: add 10 mL of n-hexane to every 20 mL of reaction solution, shake and pour the whole system into a separatory funnel, shake and mix thoroughly for 5 minutes, wait for obvious stratification to collect the upper organic phase, repeat the extraction three times and combine the organic phases. Add anhydrous Na2SO4 to the obtained extract, remove all water and perform rotary evaporation, add 10 mL of n-hexane after rotary evaporation, ultrasonically re-dissolve, aspirate with a syringe and inject into a gas phase vial through a 0.45 μm filter membrane for later testing.

[0112] Detection method for n-octacosane: The concentration of n-octacosane was determined using a gas chromatography-flame ionization detector (Agilent, USA) equipped with an HP-5 capillary column (30m×0.32mm×0.25μm). The detection procedure was as follows: nitrogen was supplied at a rate of 1.5mL / min, nitrogen was used as the carrier gas, the hydrogen flow rate was 50mL / min, the air flow rate was 300mL / min, the splitless injection mode was adopted, and 1μL was injected each time; the front injection port and front detector temperatures were set at 300℃ and 325℃, respectively; the column oven temperature started at 50℃ for 2min, increased to 230℃ at a rate of 40℃ / min, and then increased to 320℃ at a rate of 20℃ / min and maintained for 3min.

[0113] The results of the degradation rate test of n-octacosane by the original strain 21# and the genetically engineered bacteria 21#-A3 on the 7th and 14th days are shown in Figure 8. The degradation rates of n-octacosane by the original strain 21# on the 7th and 14th days were 12.29% and 23.65%, respectively, while the degradation rates of n-octacosane by the genetically engineered bacteria 21#-A3 on the 7th and 14th days were 19.01% and 30.54%, respectively, which were 54.68% and 29.13% higher than those of the original strain 21#, respectively. This shows that compared with the original strain 21#, by-almA The introduction of genes significantly improved the degradation performance of genetically engineered bacteria 21#-A3 on n-octacosane ( P <0.05).

[0114] Comparative Example 1: Verification by-almA Degradation performance of n-octacosane in Escherichia coli

[0115] 1. Genetically engineered bacteria E.coli BL21(DE3)- av-almA-N Construction

[0116] by E.coli BL21(DE3) was used as the recipient bacterium and the vector pET28a(+) was used to av-almA-N Transformed into recipient bacteria E.coli In BL21(DE3), the transformation method used was the conventional heat shock transformation method, and the specific steps were as follows:

[0117] (1) The vector pET28a(+) and the recombinant plasmid pLB- av-almA-N The target fragments were digested with NotⅠ, and the two ends were marked with NotⅠ restriction sites. Then, NEB T4 DNA ligase was used to carry out ligation reaction at a mass ratio of 1:7 (vector DNA / insert fragment DNA). The reaction conditions were 16℃ overnight ligation, and the ligation product pET28a(+)- av-almA-N .

[0118] (2) E.coli Transformation of BL21(DE3) competent cells

[0119] The ligation product pET28a(+)- av-almA-N Transformed by heat shock E.coli In BL21(DE3) competent cells, the operation method is as follows: E.coliPlace DH5α competent cells on an ice box. After the bacterial solution melts, add 10μL of the ligation product to 100μL of competent cells, flick to mix, and place on ice for 30 minutes. Then place in a 42℃ metal bath for 45s, and place on ice for 2 minutes. Do not shake the centrifuge tube during this process. Add 1mL of LB liquid culture medium to the transformed bacterial solution and resuscitate in a shaker at 37℃ and 200rpm for 60 minutes. Then take 200μL of the culture solution and apply it to LB solid culture medium containing 50μg / mL kanamycin resistance, and culture until a single colony grows.

[0120] A single colony was picked and cultured overnight in LB liquid medium containing 50 μg / mL kanamycin. After culture, the recombinant expression plasmid pET28a(+)- av-almA-N The results of plasmid gel electrophoresis are as follows Figure 9 As shown in Figure (a), M is a DNA marker, and lanes 1 to 5 are plasmids extracted from different single colonies. Lanes 1 to 5 have clear plasmid bands between 5000bp and 7500bp. The size of the recombinant plasmid is basically in line with expectations, and subsequent enzyme digestion verification can be performed. The results of enzyme digestion verification are shown in Figure 1. Figure 9 As shown in Figure (b), lane 1 is the recombinant expression plasmid pET28a(+)- av-almA-N Before restriction digestion, lane 2 is the recombinant expression plasmid pET28a(+)- by-almA- N After enzyme digestion; Lane 2 has two clear bands near 1500 bp and 5400 bp, corresponding to av-almA-N Gene and pET28a(+) plasmid, description av-almA-N The gene fragment was successfully inserted into the specified position of pET28a(+), and the genetically engineered bacteria E.coli BL21(DE3)- av-almA-N Build successful.

[0121] 2. Original strain E.coli BL21(DE3) and genetically engineered bacteria E.coli BL21(DE3)- av-almA-N Degradation performance of long-chain alkanes

[0122] Using n-octacosane as the degradation substrate, the original strain was tested E.coli BL21(DE3) and genetically engineered bacteria E.coli BL21(DE3)- av-almA-N The degradation performance of n-octacosane was determined by crude enzyme solution method. The specific operation steps are as follows:

[0123] (1) Preparation of crude enzyme solution: The activated original strain E.coli BL21(DE3) and genetically engineered bacteria E.coli BL21(DE3)- av-almA-N The bacterial suspension was inoculated into 800 mL of LB liquid medium containing 50 μg / mL kanamycin resistance and cultured until OD 600 is 0.6; add 0.1mM IPTG, induce fermentation at 37℃ for 4h to obtain fermentation broth; centrifuge the fermentation broth, add non-denaturing lysis buffer to resuspend the bacteria, then add lysozyme, mix well and place on ice for 30min, then ultrasonically lyse on ice for 6min, centrifuge and collect the supernatant, i.e. crude enzyme solution;

[0124] (2) Construction of the degradation reaction system: The degradation reaction system consisted of 5 mL of crude enzyme solution, 0.5 mM NADPH, 0.2 mM FAD, 1 g / L n-octacosane, and 15 mL of 50 mM Tris-HCl buffer; three parallel experiments were set up for each group of experiments.

[0125] (3) After the degradation reaction was carried out in a horizontal shaker at 37°C and 150 rpm for 12 h, the C 28 degradation rate.

[0126] The results of the test are as follows Figure 10 As shown by Figure 10 Available, containing of -AlmA crude enzyme solution and no of -AlmA crude enzyme solution had similar removal rates for n-octacosane, which were 20.79% and 21.16%, respectively, with no significant difference between the two. of- alma The introduction of genes did not significantly affect the genetically engineered bacteria E.coli BL21(DE3)- av-almA-N Degradation performance of n-octacosane.

[0127] 3. Genetically Engineered Bacteria E.coli BL21(DE3)- av-almA-N Recombinant protein expressed in of -Degradation activity of AlmA towards n-octadecane

[0128] (1) Activate the genetically engineered bacteria E.coli BL21(DE3)- av-almA-N The bacterial suspension was inoculated into 800 mL of LB liquid medium containing 50 μg / mL kanamycin resistance and cultured until OD 600 0.6; add 0.1mM IPTG, induce fermentation at 37℃ for 4h to obtain fermentation broth; centrifuge the fermentation broth, add non-denaturing lysis buffer to resuspend the bacteria, then add lysozyme, mix well and place on ice for 30min, then ultrasonically lyse on ice for 6min, centrifuge, collect the supernatant, i.e. crude enzyme solution; purify the crude enzyme solution through a nickel column to obtain of -almA pure enzyme solution.

[0129] (2) Extract the metabolites after the enzymatic reaction and perform qualitative analysis using GC-MS:

[0130] Enzymatic reaction system (5 mL): 50 mM Tris-HCl buffer (pH 7.4), 1 mM n-octacosane, 1 mM NADPH, 0.2 mM FAD, 1 mg of -AlmA pure enzyme solution, the above system was reacted at 30℃ for 1h.

[0131] Extraction method: After the reaction is completed, add an equal volume of n-hexane to the reaction solution and shake it upside down for 5 minutes. After the shaking, centrifuge it at 3000 rpm and 4°C for 5 minutes. Then use a pipette to absorb all the supernatant as much as possible into a new centrifuge tube. Finally, take 1 mL of the supernatant into a brown gas phase vial for detection.

[0132] GC-MS determination method: TRACE1300-ISQ7000 gas chromatography-mass spectrometer (Thermo Fisher Scientific) was used to analyze the composition of compounds. Chromatographic conditions: chromatographic column HP-5MS (30.0m×0.25mm, 0.25μm); chromatographic column starting temperature 70℃, maintained for 2min, increased to 130℃ at a rate of 5℃ / min, increased to 180℃ at a rate of 10℃ / min, increased to 285℃ at a rate of 5℃ / min, and maintained for 1min. Vaporization chamber temperature 280℃; transfer line temperature 290℃; carrier gas He; carrier gas flow rate 1.0 mL / min; no split; injection volume 1μL. Mass spectrometry conditions: EI source; electron energy 70eV; ion source temperature set to 290℃; scan mode Scan; ion scan range: m / z 35~550, solvent subtraction 3.5min.

[0133] The GC-MS qualitative results of n-octacosane are as follows: Figure 11 As shown by Figure 11 The chromatogram showed that only n-octacosane was detected, and no metabolites (alcohols) were generated. This indicates that the genetically engineered bacteria E.coli BL21(DE3)- av-almA-N Recombinant protein expressed in of -AlmA has no activity in degrading n-octacosane.

[0134] Example 7: Study on the enzyme production ability of genetically engineered bacteria 21#-A3

[0135] 1. Preparation of crude enzyme solution

[0136] The original strain 21# and the genetically engineered strain 21#-A3 were inoculated into a triangular flask containing 400mL LB liquid culture medium, and cultured at 30℃ and 150rpm for 24h. After the culture, centrifuge at 4℃ and 7000rpm for 5min, collect all the cells, wash the cells three times with 50mM Tris-HCl buffer, and then resuspend the cells with 50mM Tris-HCl buffer. The ratio between the buffer and the cells was 12.5:1 (mL / g) to obtain resuspended cells. The resuspended cells were ultrasonicated for 2s and rested for 2s at 320W, and the bacterial intracellular enzymes were extracted repeatedly by ultrasonication. The total extraction time was 17min. After the ultrasonication, centrifuge at 4℃ and 8000rpm for 20min, collect the supernatant, which is the crude enzyme solution.

[0137] 2. Determination of protein concentration

[0138] The protein concentration in the crude enzyme solution was measured using the Bradford method. The results are shown in Table 7:

[0139] Table 7. Protein concentration in crude enzyme solution

[0140]

[0141] It can be seen from Table 7 that the protein concentrations of the crude enzyme solution prepared using the original strain 21# and the genetically engineered strain 21#-A3 reached 1.60 (±0.042) mg / mL and 1.90 (±0.66) mg / mL, respectively, which indicates that the intracellular protein content of the genetically engineered strain 21#-A3 has been improved.

[0142] Subsequently, the enzyme activity in the crude enzyme solution prepared by the original strain 21# and the genetically engineered strain 21#-A3 was detected, and the enzyme activity in the crude enzyme solution of strain 21# was set as 100%.

[0143] Reaction system (1mL): 50mM Tris-HCl buffer (pH=7.4), 1mM fatty ketone, a certain amount of crude enzyme solution, 0.5mM NADPH, 0.2mM FAD; 3 parallels were set for each group of experiments, and the absorbance of the reaction system at the characteristic absorption peak of 340nm was measured at 25℃ to calculate the enzyme activity. The specific calculation formula is:

[0144] ; In the formula, Δ340 represents the difference in absorbance change of the reaction system at 340 nm per minute, V represents the reaction volume, 6220 is the molar absorption coefficient (L / mol*cm), and L is the optical path distance.

[0145] Enzyme activity unit (U): Under the above reaction conditions, one unit of enzyme activity is defined as the amount of enzyme required to consume 1 μmol NADPH per minute.

[0146] Test results such as Figure 12 As shown by Figure 12 It can be seen that compared with the original strain 21#, the enzyme activity of the enzyme protein in the crude enzyme solution prepared by the genetically engineered bacteria 21#-A3 for 2-decanone and 2-dodecanone was increased by 18.81% and 18.56%, respectively, and the enzyme activity was significantly improved ( P <0.05). The above results further illustrate that due to by-AlmA After the introduction of genes, the genetically engineered bacteria 21#-A3 has a stronger ability to degrade fatty ketones such as 2-decanone and 2-dodecanone than the original strain 21#.

[0147] Example 8: Study on the ability of genetically engineered bacteria 21#-A3 to repair petroleum-contaminated soil

[0148] 1. Preparation of immobilized enzyme preparations

[0149] Take commercial diatomaceous earth, pass it through a 200-mesh sieve, then wash it with pure water for 3 times, dry it at 80°C, and then cool it naturally to room temperature. Then mix it with the crude enzyme solution prepared by the original strain 21# and the genetically engineered strain 21#-A3, respectively, and control the ratio of diatomaceous earth to enzyme protein in the crude enzyme solution to be 1:5 (g / mg); then shake it at 4°C and 100rpm for 6h to allow the diatomaceous earth to fully combine with the enzyme protein; after the shaking, centrifuge it at 4°C and 7000rpm for 5min, take the precipitate, and use a freeze dryer to completely remove the water in the precipitate to obtain 21# immobilized enzyme preparation and 21#-A3 immobilized enzyme preparation respectively. Store the immobilized enzyme preparation at -20°C for standby use.

[0150] 2. Determination of Petroleum Components

[0151] Petroleum is a complex component, containing hundreds of compounds, including alkanes, aromatic hydrocarbons, colloids, and asphaltene. This experiment determines the content of the above four components in petroleum. The determination steps are as follows:

[0152] (1) Weigh 50 mg of petroleum into a round-bottom flask as the sample for component analysis, add 30 mL of n-hexane, and dissolve it by ultrasonication. When the sample and n-hexane are completely mixed, leave it to stand overnight in the dark to fully precipitate the asphaltene in the sample.

[0153] (2) Determination of asphaltene: Use a funnel filled with absorbent cotton to filter the petroleum in the round-bottom flask (the absorbent cotton has been treated with chloroform to eliminate fluorescence before use and placed in a brown bottle for later use). Collect the filtrate in a heart-shaped bottle. Wash the round-bottom flask and the absorbent cotton with n-hexane until the filtrate is colorless. The n-hexane filtrate obtained is the petroleum from which the asphaltene has been removed.

[0154] Subsequently, dichloromethane is used to dissolve and wash the asphaltene on the funnel and the absorbent cotton until the filtrate is colorless, and a new chicken heart bottle is used to collect the filtrate, i.e., the asphaltene solution.

[0155] (3) Determination of saturated hydrocarbons and aromatic hydrocarbons: Use a rotary evaporator to concentrate the n-hexane filtrate obtained in step (2) to 2-3 mL for separation by chromatography column: Place the chromatography column in a fume hood, put an appropriate amount of absorbent cotton at the bottom of the column, and add 4 g of chromatography silica gel and 3 g of neutral alumina as the stationary phase in sequence. Shake the column during filling to make the stationary phase evenly distributed, and add an appropriate amount of n-hexane to wet the stationary phase. When the n-hexane liquid level is close to the top of the stationary phase, transfer all the n-hexane concentrate into the chromatography column. Use n-hexane to elute the chromatography column, 5 mL each time, for a total of 6 times. The filtrate flowing out under the action of gravity is the separated saturated hydrocarbon solution, which is collected in a new chicken heart bottle. When the level of n-hexane added for the last time is close to the top interface of the stationary phase, the aromatic hydrocarbons are eluted with 5 mL of a mixed solvent of dichloromethane and n-hexane (v / v=2:1) ​​each time, and eluted 4 times in total. When about 3 mL of the mixed solvent has flowed into the stationary phase, rinse the outlet of the chromatography column with a small amount of n-hexane, remove the heart-shaped bottle containing the saturated hydrocarbon solution, and then use a new heart-shaped bottle to receive the aromatic hydrocarbons.

[0156] (4) Determination of colloid: When the liquid level of the last added mixed solvent approaches the top interface of the stationary phase, use 10 mL of anhydrous ethanol and 10 mL of dichloromethane to wash the colloid. After 10 mL of anhydrous ethanol enters the stationary phase, wash the outlet of the chromatography column with a small amount of mixed solvent, remove the heart-shaped bottle containing aromatic hydrocarbons, and then use a new heart-shaped bottle to collect the colloid.

[0157] (5) The asphaltene, saturated hydrocarbons, aromatic hydrocarbons and gum separated above are subjected to rotary evaporation to remove the organic solvent and weighed to obtain the weight of each component.

[0158] The results of the determination of the four components of petroleum are shown in Table 8:

[0159] Table 8. Results of determination of four components of petroleum

[0160]

[0161] It can be seen from Table 8 that in the petroleum sample described in this experiment, the mass fractions of alkanes, aromatic hydrocarbons, colloids and asphaltenes reached 52.29%, 16.63%, 13.06% and 12.16%, respectively, and the main component was alkanes with a mass fraction greater than 50%.

[0162] 3. Remediation of Petroleum Contaminated Soil

[0163] Accurately weigh 100 g of soil that has passed a 40-mesh sieve, add 25 mL and 125 mL of 0.2 g / mL petroleum-dichloromethane stock solution respectively, stir evenly, place under a fume hood to wait for dichloromethane to evaporate, and then mix with 400 g of soil that has passed a 40-mesh sieve to prepare petroleum-contaminated soil with concentrations of 1% and 5%.

[0164] like Figure 13 As shown, the above contaminated soils were respectively packed into 250mL beakers for petroleum contaminated soil remediation experiments. 50g of petroleum contaminated soil was weighed in each beaker and 4g of 21# immobilized enzyme preparation and 21#-A3 immobilized enzyme preparation were added respectively. The control group (CK) was added with 4g of untreated diatomaceous earth. Three replicates were set for each group of experiments. During the experiment, the temperature was kept at 20℃, the soil moisture content was 20%, the soil was turned over every 6h, and 2g of the remediated soil samples were taken on the 1st, 4th and 7th days to determine the petroleum degradation rate.

[0165] Determination of petroleum concentration in soil samples: weigh 2 g of soil sample, air-dry it, place it in a brown bottle, and add 10 mL of dichloromethane; then place the brown bottle in an ultrasonic cleaner and ultrasonicate it at 500 w for 15 min. After the ultrasonication, centrifuge it at 4 ° C and 3000 rpm for 5 min, and transfer the supernatant to a weighed chicken heart bottle; evaporate the dichloromethane in the supernatant by rotary evaporation, record the weight of the petroleum in the chicken heart bottle, and then calculate the petroleum concentration.

[0166] The experimental results are as follows Figure 14 As shown by Figure 14It can be seen that the immobilized enzyme preparations prepared by the original strain 21# and the genetically engineered bacteria 21#-A3 had oil degradation rates of 6.512% and 7.266% in 1% oil soil on the first day, and 15.36% and 16.15% in 5% oil soil; on the fourth day, the oil degradation rates in 1% oil soil were 15.98% and 15.57%, and the oil degradation rates in 5% oil soil were 30.59% and 31.87%, respectively; on the first and fourth days, there was no significant difference in the oil degradation rate of the two immobilized enzyme preparations, the possible reasons are as follows: immobilized enzymes are different from free enzymes, the spatial freedom of enzymes fixed in solid materials will be affected to a certain extent, so that their diffusion inside the material is hindered, limiting the contact between the enzyme active site and the substrate, so in a short period of time, there is no significant difference in the oil degradation rate of the two immobilized enzyme preparations. As time went on, on the 7th day, the immobilized enzyme preparations prepared by the original strain 21# and the genetically engineered strain 21#-A3 had oil degradation rates of 20.32% and 23.1% respectively for oil in soil with a concentration of 1%, and 31.64% and 35.92% respectively for oil in soil with a concentration of 5%. The difference in oil degradation rates between the two immobilized enzyme preparations began to become obvious ( P <0.05), which may be due to the slightly higher oil degradation enzyme activity in the enzyme prepared by genetically engineered bacteria 21#-A3 over time, which enables it to degrade more oil in the same time, thus achieving a higher degradation rate. At the same time, the degradation rate of oil by the immobilized enzyme preparation in the 5% oil-contaminated soil is higher than that in the 1% oil-contaminated soil, which may be due to the fact that when the immobilized enzyme preparation contacts the same area of ​​soil, it adsorbs more oil in the 5% oil-contaminated soil.

Claims

1. A genetically engineered bacterium, characterized in that: It is a recombinant Acinetobacter calcoaceticus 21# expressing the av-AlmA enzyme with an amino acid sequence as shown in SEQ ID NO.2; Among them, the preservation number of the calcoacetic acid Acinetobacter 21# is CGMCC No.31080.

2. The method for constructing the genetically engineered bacteria according to claim 1, characterized in that: The av-almA gene is introduced into the calcoacetic acid Acinetobacter 21# to obtain the av-almA gene, and the nucleotide sequence of the av-almA gene is shown in SEQ ID NO.

1.

3. The construction method according to claim 2, characterized in that: The introduction method is to use a transposon vector to introduce the av-almA gene into the calcoacetic acid Acinetobacter 21# through a triparental conjugation transformation method.

4. The construction method according to claim 3, characterized in that: The transposon vector is plasmid pUT / mini-Tn5Km.

5. The construction method according to claim 2, characterized in that: The steps include: (1) Amplify the target gene av-almA; (2) constructing a recombinant plasmid containing the target gene; (3) connecting the target gene in the recombinant plasmid to the transposon vector to construct a recombinant transposon vector containing the target gene; (4) The recombinant transposon vector was introduced into the calcoacetic acid Acinetobacter 21# by triparental conjugation transformation method.

6. Use of the genetically engineered bacteria according to claim 1 in the degradation of long-chain alkanes and fatty ketones.

7. The use according to claim 6, characterized in that The long-chain alkane is n-octacosane.

8. The use according to claim 6, characterized in that The aliphatic ketones are 2-decanone and 2-dodecanone.

9. Use of the genetically engineered bacteria according to claim 1 in remediation of petroleum-contaminated soil.

10. The use according to claim 9, characterized in that The petroleum-contaminated soil includes alkanes, aromatic hydrocarbons, colloids and asphaltenes.

11. The use according to claim 9, characterized in that The petroleum concentration in the petroleum-contaminated soil is 1-5% (w / w).

Images