Construction method of conditional point mutation animal model of SERPINH1 gene
The SERPINH1 gene in rats was edited through CRISPR/Cas9 technology to construct a conditioned point mutation animal model, which solved the problem of lack of SERPINH1 gene mutation model, and achieved research on high-risk genetic regulation of fractures and potential applications of various diseases.
Patent Information
- Application Number
- CN202410921856.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-10
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2044-07-10
AI Technical Summary
Animal models with conditional mutations in the prior art cannot effectively study the genetic mechanism of high risk of fractures, and there is a lack of effective model for the research on tumors, autoimmune diseases and diabetes.
The CRISPR/Cas9 technology combined with the Cre/Loxp system was used to construct a conditioned point mutation animal model of SERPINH1 gene, and the 62nd alanine mutation in the rat SERPINH1 gene was edited to valine by sgRNA to establish a conditioned point mutation animal model.
It provides a reliable experimental animal model to study the genetic regulation mechanism at high risk of fractures, promote the prevention and treatment strategies of osteogenesis incompleteness and osteoporosis, and has potential application value in tumors, diabetes and autoimmune diseases.
Smart Images

Figure CN118726355B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical technology, and particularly relates to a method for constructing a conditional point mutant animal model of the SERPINH1 gene. Background Art
[0002] Osteoporosis is a systemic skeletal disease characterized by reduced bone mass, damaged bone tissue microstructure, resulting in decreased bone strength and prone to fractures. Osteoporosis is a complex disease regulated by multiple factors such as genetics and environment, and its key pathogenesis is the imbalance of bone turnover. Bone turnover is precisely regulated by multiple signaling pathways. In recent years, the research on rare diseases has provided very useful research clues for the pathogenesis and treatment of common skeletal diseases.
[0003] Osteogenesis imperfecta, as the most common monogenic hereditary bone disease, is a natural disease model for studying osteoporotic fractures. The establishment and application of genetically engineered animal models have greatly promoted the exploration of the mechanisms and treatments of human diseases, and have milestone significance for the development of life sciences and basic medicine. The SERPINH1 biallelic global knockout animal model shows embryonic lethality, while the targeting strategy of conditional gene mutation can not only avoid problems such as embryonic lethality and complex phenotypes caused by global gene knockout, but also accurately evaluate the function and regulatory role of genes in specific tissues and organs. Currently, there is no report on the animal model with conditional mutation of the SERPINH1 gene. The HSP47 protein encoded by the human SERPINH1 gene has a homology of more than 93% with the HSP47 proteins of rats and mice, indicating that mammals such as rats and mice can be used as ideal research objects for SERPINH1 gene mutation. Therefore, it is urgent to construct a disease model of osteogenesis imperfecta in animals with a high degree of genetic homology to humans, so as to deeply study the genetic mechanism of high-risk fractures and establish a new diagnosis and treatment strategy targeting the key signaling pathway of bone turnover regulated by the SERPINH1 gene. On the other hand, in addition to its important value in studying the genetic regulation of bone metabolism, the SERPINH1 gene also plays a key role in the pathogenesis of tumors, autoimmune diseases, diabetes, etc. The animal model provided by the present invention also has important potential application value in the research of the above diseases. Summary of the Invention
[0004] To make up for the deficiencies of the prior art, the present invention provides a method for constructing and applying a conditional point mutant animal model of the SERPINH1 gene.
[0005] To achieve the above object, the present invention adopts the following technical solutions:
[0006] The first aspect of the present invention provides an sgRNA for SERPINH1 gene editing, and the sequence of the sgRNA is shown in SEQ ID NO: 3-6.
[0007] Furthermore, the sgRNA further includes biomaterials related to the sgRNA.
[0008] Furthermore, the biomaterials are selected from any one of the following:
[0009] (1) A nucleic acid molecule encoding the sgRNA;
[0010] (2) An expression cassette containing the nucleic acid molecule described in (1);
[0011] (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2);
[0012] (4) A recombinant microorganism containing the nucleic acid molecule described in (1) or the expression cassette described in (2) or the recombinant vector described in (3);
[0013] (5) A transgenic animal cell line containing the nucleic acid molecule described in (1) or the expression cassette described in (2);
[0014] (6) A transgenic animal tissue containing the nucleic acid molecule described in (1) or the expression cassette described in (2);
[0015] (7) A transgenic animal organ containing the nucleic acid molecule described in (1) or the expression cassette described in (2).
[0016] The second aspect of the present invention provides a system for SERPINH1 gene editing, and the system includes the sgRNA described in the first aspect of the present invention.
[0017] The third aspect of the present invention provides a method for constructing a conditional point mutation animal model of the SERPINH1 gene, and the method includes changing the SERPINH1 gene of a normal animal to mutate the alanine at the 62nd position of the SERPINH1 gene into valine.
[0018] Furthermore, the method includes the following steps:
[0019] S1. In vitro transcription of sgRNA;
[0020] S2. Construction of a Cas9 targeting vector and a Donor vector;
[0021] S3. Introduce the Cas9 targeting vector, sgRNA, and Donor vector into recipient cells to obtain F0 generation animals;
[0022] S4. Mating of positive F0 generation animals verified by sequencing to obtain homozygous F1 generation SERPINH1flox / flox An animal, which is crossed with a Cre animal to obtain a conditional point mutation animal model of the SERPINH1 gene;
[0023] Furthermore, the Cre animal is a Cre mammal.
[0024] Furthermore, the Cre mammal is a Cre rat.
[0025] Furthermore, the Cre rat is a BGLAP-Cre rat.
[0026] Furthermore, the sgRNA sequence used for constructing the BGLAP-Cre rat is shown as SEQ ID NO: 20-23.
[0027] Furthermore, the sgRNA in step (1) is the sgRNA described in the first aspect of the present invention.
[0028] Furthermore, the animal is a mammal.
[0029] Furthermore, the mammals include rats and mice.
[0030] Furthermore, the mammal is selected from rats.
[0031] Furthermore, the rat is an SD rat.
[0032] Furthermore, the recipient cell in step (3) is a fertilized egg.
[0033] Furthermore, the introduction method in step (3) is microinjection.
[0034] The fourth aspect of the present invention provides the application of the system described in the second aspect of the present invention in constructing a conditional point mutation model of the SERPINH1 gene.
[0035] Furthermore, the model includes a cell model and an animal model.
[0036] Furthermore, the animal model is selected from mammalian models.
[0037] Furthermore, the mammalian models include rat models and mouse models.
[0038] Furthermore, the rat model is an SD rat model.
[0039] The fifth aspect of the present invention provides the application of the conditional point mutation animal model of the SERPINH1 gene constructed by the method described in the third aspect of the present invention in screening candidate drugs for preventing and / or treating osteogenesis imperfecta / osteoporosis.
[0040] The sixth aspect of the present invention provides any one of the following applications of the sgRNA described in the first aspect of the present invention:
[0041] (1) Application in constructing a model of SERPINH1 gene mutation;
[0042] (2) Application in studying osteogenesis imperfecta and / or osteoporosis;
[0043] (3) Application in studying tumor diseases;
[0044] (4) Application in studying autoimmune diseases;
[0045] (5) Application in studying diabetes.
[0046] Further, the model described in (1) includes a cell model and an animal model.
[0047] Further, the animal model is selected from mammalian models.
[0048] Further, the mammalian model includes a rat model and a mouse model.
[0049] Further, the rat model is an SD rat model.
[0050] Advantages and beneficial effects of the present invention:
[0051] The present invention provides for the first time a conditional point mutation rat model of the SERPINH1 gene, its construction method and application. The rat model constructed by the method of the present invention makes up for the deficiencies of animal models related to high fracture risk genetics, provides a reliable and effective experimental animal model for studying the new mechanism of genetic regulation of high fracture risk, provides a good animal basis for the prevention, diagnosis and establishment of new treatment strategies for osteogenesis imperfecta and osteoporosis, and has important application value. In addition, the present invention also has potential application value in aspects such as tumors, diabetes and autoimmune diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0052] Figure 1 is a technical roadmap for constructing a conditional point mutation rat model of the SERPINH1 gene;
[0053] Figure 2 is a schematic diagram of the principle of gene editing of the SERPINH1 gene by the Cre / Loxp technology;
[0054] Figure 3 is a diagram of the sgRNA insertion site;
[0055] Figure 4 is an electrophoresis diagram of the initial screening of positive rats by PCR using primers;
[0056] Figure 5 Electrophoretogram of positive F0 rats detected by PCR using primers. Detailed implementation manners
[0057] The following provides definitions of some terms used in this specification. Unless otherwise specified, all technical and scientific terms used herein generally have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains.
[0058] The present invention provides an sgRNA for SERPINH1 gene editing, and the sequence of the sgRNA is as shown in SEQ ID NO: 3-6.
[0059] In one implementation manner of the present invention, sgRNA, guide RNA, single guide RNA, and synthetic guide RNA are interchangeable and generally refer to a polynucleotide sequence containing the guide sequence. The guide sequence is about 20 bp and is located within the guide RNA at the designated target site.
[0060] The sgRNA further includes biomaterials related to the sgRNA.
[0061] The biomaterials are selected from any one of the following:
[0062] (1) A nucleic acid molecule encoding the sgRNA;
[0063] (2) An expression cassette containing the nucleic acid molecule described in (1);
[0064] (3) A recombinant vector containing the nucleic acid molecule described in (1) or the expression cassette described in (2);
[0065] (4) A recombinant microorganism containing the nucleic acid molecule described in (1) or the expression cassette described in (2) or the recombinant vector described in (3);
[0066] (5) A transgenic animal cell line containing the nucleic acid molecule described in (1) or the expression cassette described in (2);
[0067] (6) A transgenic animal tissue containing the nucleic acid molecule described in (1) or the expression cassette described in (2);
[0068] (7) A transgenic animal organ containing the nucleic acid molecule described in (1) or the expression cassette described in (2).
[0069] In one embodiment of the present invention, nucleic acid molecules and nucleic acids can be used interchangeably. Nucleic acid molecules refer to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). As equivalents, the term also includes DNA or RNA analogs generated from nucleotide analogs and, where applicable, single-stranded (sense or antisense) and double-stranded polynucleotides. An isolated nucleic acid molecule refers to a nucleic acid molecule that has been identified and separated from at least one contaminating nucleic acid molecule with which it is normally associated in its natural source. An isolated nucleic acid molecule is different in form and context from when it is found in nature. Thus, an isolated nucleic acid molecule is distinct from a nucleic acid molecule as it exists in a natural cell. However, an isolated nucleic acid molecule includes a nucleic acid molecule contained in a cell that normally expresses the encoded protein, where, for example, the nucleic acid molecule is at a chromosomal location different from its chromosomal location in the natural cell.
[0070] In one embodiment of the present invention, an expression cassette refers to DNA capable of expressing the sgRNA in a host cell, which DNA may include not only a promoter that initiates transcription of the encoding gene of the sgRNA but also a terminator that terminates transcription of the encoding gene.
[0071] The expression cassette may further include an enhancer sequence.
[0072] In one embodiment of the present invention, a nucleic acid molecule or an expression cassette can be integrated into a recombinant vector, which is a broad term that includes any specific DNA segment designed to move from a carrier to a target DNA. A recombinant vector may be referred to as an expression vector or a vector system, which is a set of components required to cause DNA insertion into a genome or other targeted DNA sequences (such as episomes, plasmids, or even viral / phage DNA segments). Vector systems for gene delivery in animals (such as viral vectors (e.g., retroviruses, adeno-associated viruses, and integrative phage viruses), and non-viral vectors (e.g., transposons)) have two basic components: 1) a vector composed of DNA (or RNA, which is reverse transcribed into cDNA), and 2) a transposase, recombinase, or other integrase that recognizes both the vector and the DNA target sequence and inserts the vector into the target DNA sequence. Vectors most often contain one or more expression cassettes, which contain one or more expression control sequences, where an expression control sequence is a DNA sequence that controls and regulates the transcription and / or translation of another DNA sequence or mRNA, respectively.
[0073] Many different types of recombinant vectors are known. For example, plasmids and viral vectors (such as retroviral vectors) are known. Mammalian expression plasmids typically have an origin of replication, suitable promoters and optional enhancers, as well as any necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, transcription termination sequences, and 5' flanking non-transcribed sequences. Examples of vectors include: plasmids (which can also be carriers of other types of vectors), adenoviruses, adeno-associated viruses (AAV), lentiviruses (such as modified HIV-1, SIV or FIV), retroviruses (such as ASV, ALV or MoMLV), and transposons (such as Sleeping Beauty, P-element, Tol-2, Frog Prince, piggyBac).
[0074] In one embodiment of the present invention, the transgenic animal cell line is a transgenic non-human animal cell line, including but not limited to transgenic non-human oocytes, sperm cells, blastocysts, embryos, fetuses, donor cells or nuclei. In another embodiment, the transgenic animal cell line includes primordial germ cells, kidney cells such as PK-15 cells, pancreatic islet cells, beta cells, liver cells, or fibroblasts.
[0075] In one embodiment of the present invention, the transgenic animal tissue is selected from skin, muscle, liver, lung, tumor and cornea. In one embodiment, the tissue is selected from skin, epidermis, dermis, hypodermis, fat, thymus, intestine, small intestine, large intestine, stomach, muscle, pancreas, myocardium, skeletal muscle, smooth muscle, liver, lung, brain, cornea.
[0076] In one embodiment of the present invention, the transgenic animal organs include but are not limited to skin, lung, pancreas, liver, stomach, intestine, heart, reproductive organs, bladder, kidney, urethra and other urinary organs.
[0077] In one embodiment of the present invention, the transgenic animal is a non-human mammal. In one embodiment, the mammal can be an ungulate selected from the typical Bovidae, Ovis, Cervidae, Suidae, Equidae and Camelidae, domesticated or wild. In one embodiment, the mammal is a cow or bull, bison, buffalo, sheep, bighorn sheep, horse, pony, donkey, mule, deer, elk, reindeer, goat, buffalo, camel, packhorse, alpaca or pig. In one embodiment, the transgenic animal is a rodent such as a rat or mouse.
[0078] The present invention provides a method for constructing a conditional point mutation animal model of the SERPINH1 gene, the method comprising altering the SERPINH1 gene of a normal animal to mutate the alanine at position 62 of the SERPINH1 gene to valine.
[0079] In one embodiment of the present invention, a mutation refers to a physical or structural mutation of the base sequence generated on a gene or a chromosome. Although there are gene mutations generated on genes and chromosomal mutations generated on chromosomes, in this specification, if it is a mutation that generates the following discontinuous junction points on the transcription product of the target dominant mutant gene, it can be either type. In addition, mutations include not only mutations generated in nature, but also artificially induced mutations using mutagenic agents such as ethyl methanesulfonate (EMS) or 1-methyl-3-nitro-1-nitrosoguanidine, and mutations introduced using molecular genetics methods. Examples of the types of mutations include mutations based on base deletion, insertion or substitution, gene duplication or translocation, or chromosomal inversion in a gene.
[0080] In one embodiment of the present invention, a substitution refers to a mutation in which a base (amino acid) of a wild-type gene is replaced with another base (amino acid).
[0081] In a specific embodiment of the present invention, the mutation is that alanine at position 62 of the SERPINH1 gene is mutated to valine, i.e., c.185C>T(p.A62V).
[0082] The method includes the following steps:
[0083] S1. In vitro transcription of sgRNA;
[0084] S2. Construction of a Cas9 targeting vector and a Donor vector;
[0085] S3. Introduction of the Cas9 targeting vector, sgRNA and Donor vector into recipient cells for homologous recombination to obtain F0 generation animals;
[0086] S4. Sequencing verification: Mating of positive F0 generation animals to obtain homozygous F1 generation SERPINH1 flox / flox animals, and hybridization with Cre animals to obtain a conditional point mutant animal model of the SERPINH1 gene.
[0087] In one embodiment of the present invention, the introduction methods include but are not limited to microinjection, sonoporation, electroporation, sonoporation, optoporation, magnetoporation, heat shock, calcium phosphate method, liposome and polymer method, nanoparticle method, virus transformation method.
[0088] In a specific embodiment of the present invention, the introduction method is microinjection.
[0089] In one embodiment of the present invention, the microinjection method utilizes a glass microinjection needle with an extremely fine tip (0.1 - 0.5 μm) to directly inject an exogenous gene fragment into a pronuclear stage embryo or cultured cells, and then, through possible phenomena such as rearrangement, deletion, duplication, or translocation of the host genomic sequence, the exogenous gene is embedded into the host chromosome.
[0090] In one embodiment of the present invention, the recipient cells include (but are not limited to) prokaryotic cells and eukaryotic cells. The prokaryotic cells include (but are not limited to) Escherichia coli, mycoplasma, chlamydia, archaea, actinomycetes, rickettsia, spirochetes, Lactobacillus, Bacillus thuringiensis; the eukaryotic cells include (but are not limited to) yeast cells, insect cells, plant cells, animal cells (such as mammalian cells and non - mammalian cells). Mammalian cells include mouse cells, rat cells, human cells, monkey cells, etc., and non - mammalian cells include avian animal cells, etc.
[0091] In a preferred embodiment of the present invention, the recipient cell is a mammalian cell.
[0092] In one embodiment of the present invention, mammals refer to all members of the class Mammalia, including humans, higher primates, domestic animals and livestock such as rabbits, pigs, sheep, goats, cows, and zoo, sports, or pet animals, and rodents such as mice and rats.
[0093] In a specific embodiment of the present invention, the recipient cell is a fertilized egg of a mammalian cell.
[0094] In one embodiment of the present invention, a fertilized egg generally refers to a eukaryotic cell formed by a fertilization event between two gametes (such as an egg and sperm of a mammal).
[0095] The present invention provides the application of the SERPINH1 gene conditional point mutation model constructed by the above - mentioned method in screening candidate drugs for preventing and / or treating osteogenesis imperfecta / osteoporosis.
[0096] In one embodiment of the present invention, prevention and / or treatment includes prevention and treatment, wherein prevention refers to completely or partially preventing or suppressing the symptoms of a disease or the frequency of occurrence of such symptoms, or reducing the risk of acquiring a given symptom of the disease. In an embodiment of the present invention, the disease is osteogenesis imperfecta or osteoporosis. Prevention includes inhibiting and / or preventing the related symptoms of osteogenesis imperfecta or osteoporosis, reducing the severity of the related symptoms of osteogenesis imperfecta or osteoporosis, or improving the signs and symptoms related to osteogenesis imperfecta or osteoporosis. Prevention includes inhibiting, preventing, or reducing the severity of the related symptoms of osteogenesis imperfecta or osteoporosis. This term includes such effects that occur before a patient begins to suffer from osteogenesis imperfecta or osteoporosis or related diseases, that is, delaying the onset of the symptoms related to osteogenesis imperfecta or osteoporosis, and / or inhibiting or reducing the severity of the related symptoms of osteogenesis imperfecta or osteoporosis. Treatment refers to reducing or eliminating the severity of the symptoms of osteogenesis imperfecta or osteoporosis, the frequency of occurrence of such symptoms, or both. This term includes such effects that occur when a patient suffers from osteogenesis imperfecta or osteoporosis or related diseases, that is, reducing the severity of one or more symptoms or effects of the related symptoms of osteogenesis imperfecta or osteoporosis.
[0097] The present invention provides any one of the following applications of the above sgRNA:
[0098] (1) Application in constructing a model with SERPINH1 gene mutation;
[0099] (2) Application in studying osteogenesis imperfecta and / or osteoporosis;
[0100] (3) Application in studying tumor diseases;
[0101] (4) Application in studying autoimmune diseases;
[0102] (5) Application in studying diabetes.
[0103] In one embodiment of the present invention, tumor diseases include but are not limited to gastric cancer, ovarian cancer, lung cancer, colorectal cancer, breast cancer, liver cancer, pancreatic cancer, kidney cancer, glioblastoma, glioma.
[0104] In one embodiment of the present invention, autoimmune diseases include but are not limited to hyperthyroidism, systemic lupus erythematosus, rheumatoid arthritis.
[0105] The present invention will be further described below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the present invention. Without departing from the scope of the present invention, the main features of the present invention can be used in various embodiments.
[0106] Construction of a conditional point mutation rat model of the SERPINH1 gene and identification of its genotype
[0107] In this application, the CRISPR / Cas9 technology combined with Cre / Loxp was used to construct a conditional point mutation rat model for the c.185C>T (p.A62V) mutation in exon 2 of the SERPINH1 gene [Rattus norvegicus (Norway rat)] Figure 1 and Figure 2 , and the reference sequence is the SERPINH1 gene sequence in the sequence listing, the information is derived from the NCBI database (NCBI Gene ID: 29345, https: / / www.ncbi.nlm.nih.gov / gene / 29345), corresponding to the transcript Serpinh1-201 (ENSRNOT00000086091.2).
[0108] 1. Experimental method
[0109] (1) Selection of CRISPR / Cas9 target sites for the SERPINH1 gene
[0110] a. Two functional target sites (Table 1) were selected according to the SERPINH1 gene sequence of rats. The target site sequences were determined using an online design tool (CRISPR Design Tool, http: / / tools.genome-engineering.org), and two pairs of oligonucleotide chains (DNA Oligos, Table 2) that recognize the target sites were synthesized.
[0111] Table 1 Two functional target sites for SERPINH1 gene EXON4 and PAM sequences
[0112]
[0113] Table 2 Oligonucleotide chains that recognize rat SERPINH1 gene EXON4
[0114]
[0115] b. The DNA Oligos were annealed and renatured into double strands, and then ligated with the pUC57-sgRNA expression vector linearized by BsaⅠ endonuclease to construct the sgRNA expression vector. The sgRNA insertion site is shown in Figure 3 .
[0116] c. The constructed sgRNA vector was transcribed in vitro into injectable sgRNA (the in vitro transcription kit is from Ambion Am1354).
[0117] (2) Construction of CRISPR / Cas9 Expression Vector
[0118] Artificially synthesized target sequence oligonucleotide primers with different restriction enzyme recognition sequences at the 5′ end were directly annealed by PCR for two pairs of primers to synthesize short target sequence DNA fragments with different sticky ends, which were inserted downstream of the promoter of the CRISPR / Cas9 expression vector pST1374-NLS-flag-linker-Cas9 (Addgene ID: 44758) to construct the rat SERPINH1 gene targeting vectors pST1374-T7-SERPINH1-T1-NLS-flag-linker-Cas9 and pST1374-T7-SERPINH1-T2-NLS-flag-linker-Cas9.
[0119] The specific steps are as follows:
[0120] First step, primer annealing. The sequences of primers SERPINH1 F and SERPINH1 R are shown in SEQ ID NO:7 and SEQ ID NO:8 respectively. The annealing reaction program is 90℃ for 10 min, 70℃ for 10 min, and cooled to room temperature. The system of the annealing reaction is shown in Table 3.
[0121] SEQ ID NO:7 5’-ctctgtccccttggtgactt-3’
[0122] SEQ ID NO:8 5’-tattctccaccgcctgatct-3’
[0123] Table 3 Annealing Reaction System
[0124]
[0125] Second step, vector digestion. The targeting vector pST1374-NLS-flag-linker-Cas9 was digested with XbaⅠ endonuclease. The program was digestion at 37℃ for 1 h and inactivation of the enzyme at 65℃ for 20 min. The digestion system is shown in Table 4.
[0126] Table 4 Digestion System
[0127]
[0128] Third step, agarose gel electrophoresis detection. Prepare a 1.5% agarose gel, add 5 μl of PCR amplification product and 1 μl of 6x Loading buffer to each well for electrophoresis, and set the voltage to 120 V. When the bands migrate to the middle of the gel, the electrophoresis ends. After the electrophoresis ends, take pictures and observe with a gel imaging system.
[0129] Step 4, ligation reaction. Use T4 ligase to ligate the linearized pST1374-NLS-flag-linker-Cas9 vector and the annealed and synthesized SERPINH1-T1 / T2 short fragment, and perform ligation at 16 °C for 12 - 16 h. The ligation reaction system is shown in Table 5.
[0130] Table 5 Ligation reaction system
[0131]
[0132] Step 4, sequencing and identification. Sequence the obtained PCR products, and finally determine that the SERPINH1 targeting vectors pST1374-T7-SERPINH1-T1-NLS-flag-linker-Cas9 and pST1374-T7-SERPINH1-T2-NLS-flag-linker-Cas9 are successfully obtained.
[0133] Step 5, the vector is transcribed in vitro into injectable Cas9-RNA (in vitro transcription kit: Ambion Am1345).
[0134] (3) Construction of the Donor vector
[0135] Design homologous arms and insert loxP sequences upstream and downstream respectively:
[0136] ataacttcgtatagcatacattatacgaagttat (SEQ ID NO:9); The upstream homologous arm sequence is 88 bp: ggatccgagctcgggcccgatatcataacttcgtatagcatacattatacgaagttatcgtgctagatcgactgctagagtga cagat (SEQ ID NO:10); The downstream homologous arm sequence is 107 bp:
[0137] cttgcccaccgtcgacagctgagagtagcacaatctaggcgtcataacttcgtatagcatacattatacgaagttatgatatca cgcgtagtacacaaggcaaggct (SEQ ID NO:11). Synthesize the sequence including the c.185C>T mutation in exon 2 of the SERPINH1 gene, loxP sequence and upstream and downstream homologous arms by PCR amplification, and insert it into the vector linearized by BsaⅠ endonuclease.
[0138] The final targeting vector is: Cas9-sgRNA-donor-Serpinh1-Flox-c.185C>T.
[0139] (4) Microinjection of rat fertilized eggs
[0140] Ten 4-week-old SD female mice (purchased from Vital River) were selected, and horse serum gonadotropin and human chorionic gonadotropin were injected intraperitoneally 48 hours later to promote ovulation. The female mice were caged with male mice, and about 150 fertilized eggs were taken and cultured overnight for microinjection. At the same time, 20 8-week-old vasectomized male mice were prepared and caged with adult SD female mice one day before ovulation to make pseudo-pregnant recipient female mice. The transcribed sgRNA, Cas9 vector and Donor were mixed and injected into the fertilized eggs, which were then transplanted into the ampulla of the oviduct of the recipient mice.
[0141] (5) Genotype identification of F0 generation rats
[0142] The toes of 7-day-old F0 rats were taken and the genomic DNA of rats was extracted using the genomic DNA extraction kit (EE101-12) of Transgen. Primers for wild-type rats (WT) and loxP rats (KI) were designed based on the sequence information (Table 6), and the target gene was amplified by PCR. The amplified products were separated by 1.0% agarose gel electrophoresis, and the specific information of the gene knock-in fragment was determined by gene sequencing (Table 6).
[0143] Table 6 Primer sequences of wild-type rats (WT) and loxP rats (KI)
[0144]
[0145] S4. F0 mice with positive sequencing results were mated to obtain homozygous F1 Serpinh1 flox / flox Rats were crossed with BGLAP-Cre rats to obtain conditional point mutation rats.
[0146] The specific steps for constructing BGLAP-Cre rats are as follows:
[0147] The first step is to construct BGLAP-Cre rats. Design a protocol to clone the BGLAP gene (GeneID:
[0148] 25295, corresponding transcript: ENSRNOT00000026530.4) was inserted into the 1921 bp Ires-Cre sequence at the end, and the endogenous promoter of BGLAP was used to drive the expression of Ires-cre without disrupting the expression of the intrinsic gene.
[0149] Step 2: Select two action targets (Table 7) according to the sequence of the last exon (EXON4) of the rat BGLAP gene. Use the online design tool (CRISPR Design Tool, http: / / tools.genome-engineering.org) to determine the target sequences, and synthesize two pairs of oligonucleotide chains (DNA Oligos, Table 8) that recognize the target sites. Anneal and renature the DNA Oligos into double strands, and ligate them with the pUC57-sgRNA (Addgene ID: 51132) expression vector linearized by BsaⅠ endonuclease to construct the sgRNA expression vector. The constructed sgRNA vector is transcribed in vitro into injectable sgRNA (in vitro transcription kit: Ambion Am1354).
[0150] Table 7 Two action targets for BGLAP gene EXON4 and PAM sequences
[0151]
[0152] Table 8 Oligonucleotide chains that recognize rat BGLAP gene EXON4
[0153]
[0154]
[0155] Step 3: Construct the CRISPR / Cas9 expression vector. The vector name is pST1374-NLS-flag-linker-Cas9 (Addgene ID: 44758). Use the T7 promoter vector plasmid as a template and transcribe it in vitro into injectable Cas9-RNA (in vitro transcription kit: Ambion Am1345).
[0156] Step 4: Construct the donor vector. Design homologous arms. The upstream homologous arm sequence is 65 bp: cctacaagcgcatctatggcaccgcttacattaggggctcaggcagtggatataaaaggtattgc (SEQ ID NO:24), and the downstream homologous arm sequence is 706 bp: tgggctcgagtctgtccattgtggtggtggtaggggttggagaaggcttcatgttcaatcccagacagccccagtccggttcatttgcgtctttattatactgctctgtgatggatcgcaccagaggtcccacagcccgcctccccacagtgattcccaccacatccattatctcaccgccaacacagacacacccagacatgcagatcagaaaaggcctggtcacagtggtaagcaggtcaggcagctcacgtgtagacagagttgctgacacgtggcagtctggtcctggggcagggtgggtatgtggccctcatggaacaagctttcagggtgacctgaggtgaacaggttccagggcaacagggtagaagcccggtgagaggccttacacctcccactccgctcccgcctggtacctgtgtccactcgcaggcctccaccactggcctcttggggcctccatcctgccacccgtccccagagagcctcttctctgcagccaccctttcagaatcagaatagcctccaccttctcaggcccatgtcagggctcctccacagtaatgaagtctggcctcagcctccctccatgccaatgggcctcactgttgtttggcttcgagttcctcttcgagggggccaccctgcagcagggggcaggccccagggctccgcagcaacctacaagcgcatctatggcacc (SEQ ID NO:25). Synthesize the sequence including BGLAP EXON1-4, Ires-Cre and upstream and downstream homologous arms by PCR amplification, and insert it into the vector linearized by BsaⅠ endonuclease.
[0157] Step 5: Microinject rat fertilized eggs. Select 10 3- to 4-week-old female SD rats and inject them with equine serum gonadotropin and human chorionic gonadotropin for superovulation. After 12 hours, cage the female rats with male rats and collect approximately 150 fertilized eggs for microinjection. Meanwhile, prepare 20 8-week-old male rats with vasectomy and cage them with adult female SD rats 1 day before ovulation to produce pseudopregnant recipient female rats. Mix the above-transcribed sgRNA, Cas9 vector, and Donor, inject them into the fertilized eggs, and then transplant them into the ampulla of the oviduct of the recipient rats.
[0158] Step 6: Genotype identification. Take the toes of 7-day-old F0 generation suckling rats, extract rat genomic DNA using the genomic DNA extraction kit (EE101–12) from Transgen Company, perform PCR identification, and confirm the successful construction of BGLAP-Cre rats.
[0159] 2. Experimental results
[0160] A total of 30 pups were born after microinjection and transplantation. At 7 days after birth, the genotypes of the rat tails were identified by PCR using primers SEQ ID NO:12 and SEQ ID NO:13. The results are as Figure 4 follows: The red ones are the initially screened positive rats (numbered 2#, 3#, 4#, 5#, 6#, 9#, 10#, 11#, 14#, 15#, 19#, 20#, 22#, 25#, 26#, 27#, 29#). The initially screened positive rats were subjected to PCR detection using primers SEQ ID NO:14 and SEQ ID NO:15 and primers SEQ ID NO:16 and SEQ ID NO:17. The results are as Figure 5 . Rats 4#, 5#, 9#, 11#, 22#, 25#, 26#, and 27# that co-amplified the target bands were sequenced, and finally 4 F0 generations that met the requirements were obtained, numbered 4#, 9#, 11#, and 26# respectively.
[0161] Example 2: Phenotypic identification of osteogenesis imperfecta rat model
[0162] Furthermore, the bone phenotypes of the rats with skeletal-specific mutations in the SERPINH1 gene were evaluated.
[0163] Detect bone mineral density: Anesthetize the rats by intraperitoneal injection with 1.25% avertin solution (at a dose of 10 mL / kg body weight), and measure the areal bone mineral density (g / cm 2 ) of the whole body, spine, upper limbs, lower limbs, and other regions of interest using a small animal dual-energy X-ray bone densitometer (INSiGHT VET DXA, OsteoSys Company, South Korea).
[0164] Detection of bone microstructure: After anesthetizing rats by intraperitoneal injection with 1.25% avertin solution (at a dose of 10 mL / kg body weight), the proximal and middle segments of the left femur and lumbar vertebrae were taken. After fixation in formalin solution, scanning and reconstruction of the rats were performed using Micro-CT (Inveon, Siemens, USA) to detect the following bone microstructure parameters.
[0165] Table 9. Bone microstructure indexes detected by Micro-CT
[0166]
[0167]
[0168] The bone microstructure indexes detected by Micro-CT are shown in Table 9. After verification, the lumbar vertebrae, bilateral femurs and whole-body bone density of the model rats constructed in this application were all decreased, and the femoral cortical bone was significantly thinned, which was an osteogenesis imperfecta rat model.
[0169] The description of the above embodiments is only for understanding the method and its core idea of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. A method for constructing a rat osteogenesis imperfecta / osteoporosis model, characterized in that, The method includes altering the SERPINH1 gene of normal rats to mutate the alanine at the 62nd position of the SERPINH1 gene into valine, and the SERPINH1 gene is the transcript ENSRNOT00000086091.2 of the SERPINH1 gene.
2. The method according to claim 1, wherein The method includes the following steps: S1. In vitro transcription of sgRNA; S2. Construction of a Cas9 targeting vector and a Donor vector; S3. Introducing the Cas9 targeting vector, sgRNA and Donor vector into recipient cells to obtain F0 generation rats; S4. Homozygous F1 generation SERPINH1 rats were obtained by mating F0 rats with positive sequencing results, and crossed with Cre rats to obtain a rat model of osteogenesis imperfecta / osteoporosis. flox / flox 3. The method according to claim 2, wherein The Cre rat is a BGLAP-Cre rat.
4. The method according to claim 3, wherein The sgRNA sequences used for constructing the BGLAP-Cre rat are as shown in SEQ ID NO: 20-23.
5. The method according to claim 1, wherein The sequence of the sgRNA in step (1) is as shown in SEQ ID NO: 3-6.
6. The method according to claim 2, wherein The recipient cells in step (3) are fertilized eggs.
7. The method according to claim 2, wherein The introduction method in step (3) is microinjection.
8. Use of the SERPINH1 gene conditional point mutation animal model constructed by the method according to any one of claims 1-7 in screening candidate drugs for preventing and / or treating osteogenesis imperfecta / osteoporosis.
Citation Information
Patent Citations
Pathogenic mutation of osteogenesis imperfecta disease and detection reagent of pathogenic mutation
CN109897894A
Pathogenic gene col1a2 mutation of bone dysplasia disease and detection reagent thereof
WO2022134165A1