SNP Locus Combinations, Primer Combinations and Methods for Identifying the Weining Chicken Breed
By using 6 SNP site combinations and primer combinations in Weining chicken breed identification, combined with PCR amplification and sequencing technology, the scientific and accurate problems of Weining chicken breed identification were solved, and the efficient identification of fake Weining chickens was achieved.
Patent Information
- Application Number
- CN202411079666.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-07
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2044-08-07
AI Technical Summary
The identification of Weining chicken breeds in the prior art lacks scientific identification standards, especially when identifying the offspring of Weining chickens and other breeds of chickens, the appearance observation is highly subjective and the error rate is high, making it difficult to accurately distinguish between authenticity.
Six specific SNP sites combinations (WN1 to WN6) were used to identify the Weining chicken breeds. By detecting the genotype, the 55K Jingxin No. 1 chip of Beijing Compson Biotechnology Co., Ltd. was used to screen out the SNP sites with high differences, and primers were designed for PCR amplification and sequencing to determine whether the genotype meets the characteristics of Weining chicken.
The 100% accurate identification of Weining chicken varieties has been achieved, which simplifies the operation process and can effectively identify counterfeit Weining chicken products on the market.
Smart Images

Figure BDA0004983339330000021 
Figure BDA0004983339330000061 
Figure BDA0004983339330000062
Abstract
Description
Technical Field
[0001] The present invention relates to a method for identifying poultry breeds, and specifically, to a SNP locus combination, primer combination, and method for identifying the breed of Weining chickens. Background Art
[0002] Weining chickens are excellent local chicken breeds in China, belonging to the dual-purpose type of egg and meat. They are mainly distributed in counties such as Weining, Hezhang, and Nayong in Bijie City. They are relatively large in size, have a strong physique, a symmetrical structure, excellent meat quality, and strong disease resistance. The muscle composition of Weining chickens is characterized by low fat and high protein, with excellent fatty acid and amino acid compositions. The contents of unsaturated fatty acids, essential fatty acids, flavor amino acids, and essential amino acids are high, and they have both good meat flavor and nutritional value, and are deeply loved by consumers. Due to the economic value of Weining chickens, there are many counterfeit breeds on the market that are a random mix of Weining chickens and other domestic and foreign breeds. These breeds are very similar in body appearance to Weining chickens, and it is difficult for consumers to distinguish them, which has damaged the interests of farmers and also affected the conservation and breeding of the original Weining chicken breed.
[0003] Currently, the methods for identifying the authenticity of Weining chickens on the market mainly rely on visual observation. This kind of observation is highly subjective and there is no scientific identification standard. Especially when identifying the hybrid offspring of Weining chickens and other breeds of chickens, due to their similar appearance, the error rate of identification is relatively high.
[0004] Single nucleotide polymorphism (SNP) has the characteristics of a large number, wide distribution, rich polymorphism, high genetic stability, representativeness, and convenient and rapid detection. By using SNP loci with large differences in specific breeds in genomic DNA and performing breed identification through the genotypes of different locus combinations, the identification results are more objective and accurate. In view of this, it is of great significance to develop a method that can effectively and accurately identify the breed of Weining chickens using SNP locus combinations and apply it to the work of identifying the breed of Weining chickens. Summary of the Invention
[0005] Aiming at the problem of difficult identification of the breed of Weining chickens, the present invention provides a SNP locus combination, primer combination, and method for identifying the breed of Weining chickens. By detecting the genotypes of 6 SNP loci of Weining chickens provided, it is jointly determined whether the individual to be tested belongs to Weining chickens. This method is simple to operate and has high accuracy, can accurately identify the breed of Weining chickens, and effectively combat counterfeit and shoddy products of the local Weining chicken breed on the market.
[0006] In order to achieve the above object, on the one hand, the present invention provides a SNP locus combination for identifying the breed of Weining chickens, and this SNP locus combination includes locus WN1 to locus WN6:
[0007] SNP locus serial number Chromosome Position on the chromosome SNP locus ID Reference genome Mutation site WN1 NC_006090.5 chr3:33118105 rs14337250 T C WN2 NC_006104.5 chr17:4874520 rs314777594 C T WN3 NC_006088.5 chr1:5250487 rs739582758 T C WN4 NC_006088.5 chr1:5058164 rs13827247 T C WN5 NC_006090.5 chr3:80005962 rs316530195 G C WN6 NC_006101.5 chr13:14460350 rs730977797 C T
[0008] The sequences of the primers for each SNP locus are as follows:
[0009]
[0010] The screening method for the SNP loci is as follows: Using the optimized 55K Jingxin-1 chip in 2023 (redesigned with reference to the Gallus_gallus 6 genome, Beijing Compson Biotechnology Co., Ltd.), 55,000 SNP loci of 12 chicken breeds (local chicken breed resources in Guizhou Province such as Weining chickens, Qiandongnan Xiao Xiang chickens, Zhuxiang chickens, Bantam chickens, High-legged chickens, Wumeng Black-boned chickens, Xingwen Black-boned chickens, Wumeng Phoenix chickens, etc., representative domestic black-boned chicken breeds such as Silky fowl, Jinhu Black-boned chickens, etc., and representative foreign introduced breeds for cross-breeding such as Hubbard broilers, Leghorn chickens) were screened and determined. According to the comparison of each breed with other breeds, the set of loci with the largest differences was selected. Loci were screened based on the genetic differentiation index top 5% among populations, minor allele frequency > 0.4, and missing rate < 0.2, and 220 SNP loci were determined. Priority was given to selecting loci with allele frequencies of 1 or 0 in the Weining chicken reference genome locus. Then, the mean of different allele frequencies of each locus in the other 11 breeds was determined, and then compared with the different allele frequencies of each locus in the Weining chicken. SNP loci with relatively large differences in allele frequencies were screened, and loci with allele frequencies close to 0 or close to 1 in other populations. Finally, 6 SNP loci for the identification of the Weining chicken breed were determined.
[0011] On the other hand, the present invention provides a method for identifying the Weining chicken breed, and the identification method includes the following steps:
[0012] (1) Extract the total genomic DNA of the chicken to be tested;
[0013] (2) According to the SNP locus combination, use the corresponding primer combination to perform PCR amplification respectively;
[0014] (3) Sequence the PCR amplification product and then judge the genotype;
[0015] (4) If one of the genotypes corresponding to the SNP locus combination does not conform to the genotype of the Weining chicken, it is determined that the individual does not belong to the Weining chicken; if all the genotypes corresponding to the 6 SNP locus combinations conform to the genotype of the Weining chicken, it is determined that the individual belongs to the Weining chicken. The genotypes of the 6 SNP loci WN1 - WN6 are CC, TT, TT, TT, TT, GG, CC in sequence.
[0016] Preferably, in step (1), the genomic DNA of the chicken to be tested is obtained by collecting blood from the wing vein of an individual of this chicken breed.
[0017] Specifically, in step (2), the lengths of the PCR products of WN1 to WN6 are 246 bp, 199 bp, 233 bp, 220 bp, 178 bp, and 175 bp respectively. The information of each corresponding PCR product is as follows:
[0018] WN1--246bp (SNP locus: T / C at 62 bp)
[0019] TACAGTCCCCTTTCCTGTGGCATCAAATCCTAACCCAAATATTAATG TTTGTGCCTCCTGAK(T / C)GTTTCTTATGAGAAATTAAATTAATATTACTG TCAAAGGGAAACATAGCTTAAGTTCCAGTGATGAGATGACAGAGGGACCCACTCTGCATATAACATGTATAGACACTACAAGAGCAAAAAACACAGAACGAAAGTTCAGCAGCTCTGTTTTGAAAAGGACATGTTGCATTGGTGTGCTTGTC
[0020] WN2--199bp (SNP locus: C / T at 152 bp)
[0021] AAAGCAAGCAGTTTCACCTCATTTCAAGTAAAGTGAGACAGCTTATTAAAGGACCAGAATTAACTAATTTATCCATAGCCTCATTAACCCAGAATCACAAATAGGAGCCTGCAATAGGAGGCTGTTGAAGATGTGACTTCAACTGCCAAGGK(C / T)TGAGGTATCCCAACTGAGTTACGAAGTTAATAGTGC CTGCTGCACCA
[0022] WN3--233bp (SNP locus: T / C at 84 bp)
[0023] TCCCTCCCACTTTCTGCTTATCCTGTACCGCTTTTTATTTTTATTTTT TAAATGTTGGGCAAAGCTAAAATATTTTAGGCCTTK(T / C)GGGGTTTTTG TTTGTTTGTTTGCTTATTTTTGGTACAGGTAGAGGGGGAATTATGAAAAATGAATTGTCACAGAAGAACAAGTTCTGGAAAAAAAAAAAAAGAATATAAAATATTGACTATTCCATTTATGAAGGCACACTTGCATAGG
[0024] WN4--220bp(SNP locus: T / C at 23bp)
[0025] TTGGCTGCCATTGATATGACAAK(T / C)TGGAGTGAAATACTGGGGA AATACTGATTGACAAGACAGTTTTTCAGTTGGAGTTTAACAAATATCTCATCTCATTCTTTTTTTGCCATTGCCGTGTACTTTATGTTTTAGACTACTGTTACAACTGTATATGTTCCTCTTTTTCTTTGTTTATATTTGCAGTATATTCAGAGATTCCTAGACATTGCGATGTGTTT
[0026] WN5--178bp(SNP locus: G / C at 143bp)
[0027] CCATCAGAACAGGCCAAGTAAGAAAACGTGACATAAGCAAGAGA TTTCTGATTGCTTTAAATTATGAATACATTCTAACTACAAGCAGAGAATT CTTGCGCTGGTTTTACTTTTCAAACAGATTTGTTTGTTTGTTTTTGCTK(G / C)TGTCACTTACAATGTTACCTAGCCAATCTGCCACA
[0028] WN6--175bp(SNP locus: C / T at 39bp)
[0029] AAAGGAAACCCAAACCATCCTTTTCCCCTGAAACAGTAK(C / T)TTG AGGAAATGCTGTGCTGTCTCCTGCTATAGCATGCTGGGTGCCAGAGTCCCTCTCCTGTTGCTCCAGGTCAGACAAGCAGAGTCCTTCCAGAAAGAAGGTATCTCCATGCTGGTTCTTGTTCCCAGGTGAGGAG
[0030] Through the above technical solutions, the present invention achieves the following beneficial effects:
[0031] When using the SNP locus combination provided by the present invention for the identification of Weining chicken breed, as long as the genotype of one SNP locus does not conform to the corresponding genotype of Weining chicken, the individual can be completely excluded from belonging to Weining chicken; the probability that the combined genotype of all 6 SNP loci is determined to be Weining chicken is 100%. This method is simple to operate and highly accurate, and can effectively combat the fake Weining chicken products in the market. Specific Embodiments
[0032] The following further elaborates on the specific embodiments of the present invention in conjunction with examples. It should be understood that the specific embodiments described herein are only for the purpose of illustrating and explaining the present invention, and are not intended to limit the present invention.
[0033] Example 1: Screening of SNP Loci
[0034] The screening method for the SNP loci is as follows: Using the optimized 55K Jingxin-1 chip in 2023 (redesigned with reference to the Gallus_gallus 6 genome, Beijing Compass Biotechnology Co., Ltd.), 55,000 SNP loci of 12 chicken breeds (local chicken breed resources in Guizhou Province such as Weining chicken, Qiandongnan Xiao-Xiang chicken, Zhuxiang chicken, Dwarf chicken, Tall chicken, Wumeng Black-bone chicken, Xingwen Black-bone chicken, Wumeng Phoenix chicken, etc., representative domestic black-bone chicken breeds such as Silky fowl, Jinhu Black-bone Phoenix chicken, etc., and representative foreign introduced breeds for crossbreeding such as Hubbard broiler, Leghorn chicken) are screened and determined. According to the comparison of each breed with other breeds, the set of loci with the largest differences is taken, and the top 5% of the genetic differentiation index between populations, the minor allele frequency > 0.4, and the missing rate < 0.2 are used for screening to determine 220 SNP loci. Priority is given to the allele frequency of the Weining chicken reference genome locus being 1 or 0. Then, the average value of different allele frequencies of each locus of the other 11 breeds is determined, and then compared with the different allele frequencies of each locus of Weining chicken to screen SNP loci with relatively large differences in allele frequencies. For other populations, loci with allele frequencies close to 0 or close to 1 are selected, and finally 6 SNP loci for the identification of Weining chicken breed are determined.
[0035] The genotype frequencies of SNP loci in Weining chickens and other breeds are as follows:
[0036]
[0037] The information of 6 SNP loci is shown in the following table:
[0038]
[0039]
[0040] According to the physical positions of the 6 SNP loci, based on the reference genome sequence of red jungle fowl (Galgal6), using the UCSC website https: / / genome-asia.ucsc.edu / cgi-bin / hgGateway?hgsid=791993043_MvNmFj6QPMRQsauOxQixq3gPtEUU, the DNA sequences of the 6 SNP loci were obtained, and then primers were designed using Primer5.0. The primer sequences, PCR product lengths, and annealing temperatures of each SNP are shown in the following table:
[0041]
[0042] Example 2: Identification of Weining Chicken Breed
[0043] Randomly select 30 Weining chickens, 30 Silky fowls, 30 Wumeng Feng chickens, 30 Wumeng black-boned chickens, 30 Jinhu black-boned chickens, and 30 Hubbard broilers preserved in the poultry germplasm resource genetic material library of the Jiangsu Key Laboratory, and make marks. Blood was collected from the wing vein, and genomic DNA was extracted by the phenol-chloroform method. Primers for a total of 6 SNP loci from WN1 to WN6 were selected for PCR amplification.
[0044] The total PCR reaction system is 50 μL: 2 μL of DNA template, 4 μL of dNTP (2 mmol / L), Mg 2+ (3 mmol·L -1 ) 0.6 μL, 5 μL of 1×PCR reaction buffer, 1 μL each of upstream and downstream primers (10 μmol·L -1 ), 2.5 μL of Taq polymerase (1 U·μL -1 ), and make up to 50 μL with ultrapure water.
[0045] PCR reaction program: Pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min. The PCR amplified target fragment was detected by 1.5% agarose gel electrophoresis.
[0046] The PCR products were sent to a biological company for sequencing, and polymorphisms and genotype determination were performed on the sequences. According to the sequencing results, 30 individuals with the combined genotype of CCTTTTTTGGCC at 6 loci were determined to be Weining chickens, and the results were consistent with the markers. The remaining individuals did not fully conform to the CCTTTTTTGGCC genotype, so they were determined to be non-Weining chickens.
[0047] The preferred embodiments of the present invention have been described in detail above in combination with the embodiments. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.
[0048] In addition, it should be noted that among the various specific technical features described in the above specific embodiments, they can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.
[0049] In addition, any combination can be made between various different embodiments of the present invention as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention.
Claims
1. Identification method of Weining chicken breed, characterized in that, It includes the following steps: (1) Extract the total genomic DNA of the chicken to be tested; (2) According to the SNP locus combinations, use the corresponding primer combinations to perform PCR amplification respectively, where the SNP locus combinations include locus WN1 to locus WN6: WN1 is located at position 33118105 on chromosome 3 of NC_006090.5, and it is polymorphic between T and C; WN2 is located at position 4874520 on chromosome 17 of NC_006104.5, and it is polymorphic between C and T; WN3 is located at position 5250487 on chromosome 1 of NC_006088.5, and it is polymorphic between T and C; WN4 is located at position 5058164 on chromosome 1 of NC_006088.5, and it is polymorphic between T and C; WN5 is located at position 80005962 on chromosome 3 of NC_006090.5, and it is polymorphic between G and C; WN6 is located at position 14460350 on chromosome 13 of NC_006101.5, and it is polymorphic between C and T; The nucleotide sequences of the primers for each SNP locus are: WN1-F: 5’TACAGTCCCCTTTCCTGTGG3’ WN1-R: 5’GACAAGCACACCAATGCAAC3’ WN2-F: 5’AAAGCAAGCAGTTTCACCTCA3’ WN2-R: 5’TGGTGCAGCAGGCACTATTA3’ WN3-F: 5’TCCCTCCCACTTTCTGCTTA3’ WN3-R: 5’CCTATGCAAGTGTGCCTTCA3’ WN4-F: 5’TTGGCTGCCATTGATATGAC3’ WN4-R: 5’AAACACATCGCAATGTCTAGGA3’ WN5-F: 5’CCATCAGAACAGGCCAAGTAA3’ WN5-R: 5’TGTGGCAGATTGGCTAGGTA3’ WN6-F: 5’AAAGGAAACCCAAACCATCC3’ WN6-R: 5’CTCCTCACCTGGGAACAAGA3’; (3) Sequence the PCR amplification products and then determine the genotypes; (4) If one of the genotypes corresponding to the SNP locus combinations does not match the genotype of the Weining chicken, then determine that this individual does not belong to the Weining chicken; If all the genotypes corresponding to the 6 SNP locus combinations match the genotype of the Weining chicken, then determine that this individual belongs to the Weining chicken, and the genotypes of the 6 SNP loci WN1~WN6 are CC, TT, TT, TT, GG, CC in sequence.
2. The identification method according to claim 1, characterized in that In step (1), the genomic DNA of the chicken to be tested is obtained by collecting blood from the wing vein of an individual of this chicken breed.
3. The identification method according to claim 1, characterized in that, In step (2), the lengths of the PCR products of WN1~WN6 are 246 bp, 199 bp, 233 bp, 220 bp, 178 bp, and 175 bp respectively.
Citation Information
Patent Citations
A chicken whole genome SNP chip and its application
CN111225986B
A SNP molecular marker for identifying Taihe black-bone chicken breeds and its application
CN114921572B