A method for enhancing NK cell function by interfering with GPR132 and its application

Abstract

The present invention discloses a method for enhancing NK cell function by interfering with GPR132 and its application, comprising the following steps: S1, construction of pLL3.7-GPR132-shRNA-2 interference plasmid; S2, construction of pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR targeting plasmids; S3, packaging of lentivirus and determination of virus titer; S4, culturing NK92 cells; S5, infection of NK9 2 cells to determine the interference efficiency of GPR132; S6, detect the killing ability of NK92 with GPR132 knockdown to K562; S7, detect the expression level of activating factors in NK92 with GPR132 knockdown; S8, detect the proliferation and anti-apoptosis ability of NK92 with GPR132 knockdown; S9, detect the cytotoxicity of CAR-NK with GPR132 knockdown; S10, detect the killing ability of NKG2D-CAR-NK cells targeting human NKG2DL to colon cancer cells. The present invention illustrates the regulatory effect of GPR132 on NK function. Downregulating GPR132 in NK cells enhances NK cell effects, proliferation and anti-apoptosis ability, thereby enhancing the cytotoxicity of NK cells. At the same time, in the application of CAR-NK, the downregulation of GPR132 significantly improves the cytotoxicity, intratumor survival ability and colon cancer clearance ability of CAR-NK92.

Description

Technical Field

[0001] The present invention belongs to the technical field of anti-tumor cells, and specifically relates to a method for enhancing NK cell function by interfering with GPR132 and an application thereof. Background Art

[0002] Natural killer (NK) cells are a type of innate lymphocyte that play a crucial role in controlling malignancies and infections. They receive various signals through activating receptors, inhibitory receptors, stress-induced ligand receptors, and cytokine receptors. In response, they rapidly release cytotoxic granules, proinflammatory factors, and chemokines to kill target cells or modulate immune responses. Despite this, however, NK cells have not been widely used in the clinical treatment of solid tumors. Since solid tumors are difficult to reach and infiltrate, once inside the tumor, the responsiveness of NK cells is often hindered by the immunosuppressive tumor microenvironment (TME) and enters a state of exhaustion. In addition, the hypoxic TME produces a large amount of lactate through metabolism and inhibits the cytotoxicity of NK cells by downregulating the expression of natural cytotoxic receptors (NCRs) and NKG2D. Recently, most studies have focused on the use of immunostimulants, immune checkpoint blockade, and CAR NK cell therapy to enhance the anti-tumor function and specificity of NK cells.

[0003] To this end, we propose a method for enhancing NK cell function by interfering with GPR132 and its application. Summary of the invention

[0004] The technical problem to be solved by the present invention is: to provide a method for enhancing the function of NK cells by interfering with GPR132 and its application, to design and screen the interference sequence with the best effect by using RNA interference technology, to successfully knock down the expression of GPR132 mRNA, to downregulate the GPR132 gene in NK cells and CAR-NK cells by RNA interference technology, and to verify that this strategy can enhance the function and anti-tumor activity of NK cells and CAR-NK cells.

[0005] The objective of the present invention is achieved through the following technical solutions:

[0006] A method for enhancing NK cell function by interfering with GPR132, comprising the following steps:

[0007] S1, construction of pLL3.7-GPR132-shRNA-2 interference plasmid;

[0008] Construction of S2, pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR targeting plasmids;

[0009] S3, lentiviral packaging and virus titer determination;

[0010] S4, NK92 cell culture;

[0011] S5, infection of NK92 cells to determine the interference efficiency of GPR132;

[0012] S6. Detect the killing ability of GPR132-knockdown NK92 against K562;

[0013] S7, detecting the expression levels of activation factors in GPR132-knockdown NK92 cells;

[0014] S8. Detect the proliferation and anti-apoptosis ability of NK92 with GPR132 knockdown;

[0015] S9, detection of cytotoxicity of CAR-NK with GPR132 knockdown;

[0016] S10. Detect the killing ability of NKG2D-CAR-NK cells targeting human NKG2DL against colon cancer cells.

[0017] Furthermore, the construction method of the pLL3.7-GPR132-shRNA-2 interference plasmid in step S1 includes:

[0018] S1.1. RNAi target sequence design:

[0019] The gene number of Homo sapiens G protein-coupled receptor 132 (GPR132) was found on the NCBI website: EU432121.1, and the GPR132 gene RNAi target sequence was designed according to the gene number; the target sequence of shRNA-2 was GGTACTACTACGCCAGGTTCA.

[0020] S1.2. Design interference sequence according to target sequence:

[0021] Based on the selected target sequence, the interference sequence was designed and determined according to the following principles: the 5' end began with G, and the G+C content was set to 30% to 50%; according to the requirements of the pLL3.7 vector, (1) T was added to the 5' end of the positive strand to reconstruct the T at position 1 of the U6 promoter; (2) a loop "TTCAAGAGA" was added after the interference target sequence; (3) a reverse complementary sequence and a termination signal "TTTTTT" were added; (4) an EcoR I restriction site GAATTC was added to the 3' end to facilitate identification; and (5) the Xho I restriction site was filled in to synthesize a pair of complementary fragments, and the sequence was disrupted to design the NC (Negative Control) sequence.

[0022] S1.3. Construction of interference plasmids pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP:

[0023] The designed target oligonucleotide sequence was submitted to Suzhou Genewise Biotechnology Co., Ltd. to synthesize the double-stranded DNA sequence of the target sequence, and the empty pLL3.7 was double-digested with restriction endonucleases HpaI and XhoI, and ligated with T4 DNA ligase to construct recombinant plasmids pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP.

[0024] Furthermore, the construction method of the pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR targeting plasmids in step S2 is as follows:

[0025] The pLL3.7-NKG2D-CAR vector was double-digested with restriction endonucleases XbaI and NheI to recover the large fragment (6975 bp), pLL3.7-shRNA-2-EGFP and

[0026] pLL3.7-shRNA-NC-EGFP was double-digested with restriction endonucleases XbaI and NheI, and small fragments were recovered and ligated with T4 DNA ligase to obtain pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR plasmids.

[0027] Furthermore, the method for packaging the lentivirus and determining the virus titer in step S3 is as follows:

[0028] S3.1 Lentivirus packaging:

[0029] (1) 293T cells in a 10 cm cell culture dish;

[0030] (2) When the cell density grows to nearly 70%, the virus is packaged. 9 ml of DMEM complete medium is added to each dish. The target plasmid and the packaging auxiliary plasmid of the chronic disease (pMD2.G, psPAX2) are dissolved in serum-free DMEM medium at a ratio of 5 μg:3 μg:5 μg. The transfection reagent PEI is mixed at a ratio of PEI:DNA mass of 3:1, and the mixture is allowed to stand at room temperature for 15 min.

[0031] (3) Add 1 ml of the plasmid PEI mixed liquid dropwise to the culture medium and continue culturing for 8 h. After changing the medium, add 10 ml of DMEM complete medium to each dish;

[0032] (4) After culturing for 48 h, the first cell culture medium was collected, fresh DMEM medium was added and cultured for another 24 h, and the second cell culture supernatant was collected;

[0033] (5) centrifugation (4000 g, 10 min) to remove cell debris;

[0034] (6) Filter the virus with a 0.45 μm syringe filter to further remove impurities, and filter again with a 0.22 μm syringe filter;

[0035] (7) Add the filtered virus solution to a sterilized ultracentrifuge tube and perform ultracentrifugation (25,000 g, 2 h). After centrifugation, remove the culture medium supernatant, mark the concentrated spots of the virus with a marker, add 400 ul of culture medium, dissolve the virus overnight, collect the virus, and divide the virus into 1.5 ml EP tubes and store it in a -80 ° C refrigerator for later use;

[0036] S3.2. Virus titer determination

[0037] (1) 293T cells were seeded in a 24-well plate, with 2×10 cells per well. 5 , different volumes of virus concentrate were added to 24-well plates, and uninfected wells were set as blank control groups, cultured for 48 h, and cells were collected by digestion after 48 h;

[0038] (2) Resuspend the cells in 100 μl FACS buffer, add the corresponding 0.3 μl APC anti-human NKG2D antibody, and stain at 4°C in the dark for 30 min. After incubation, add 1 ml FACS buffer and centrifuge (400 g, 3 min) to wash the cells;

[0039] (3) Finally, resuspend the cells in 400 μl of FACS buffer and perform flow cytometry to detect the positive rate;

[0040] (4) Uninfected 293T cells were used as negative control. The titer was calculated based on the positive rate of infected 293T cells. The formula for calculating the virus titer was as follows: T (TU / ml) = (number of 293T cells × positive rate × 1000) / virus volume (μl). The calculation results are as follows:

[0041] The titers of pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP viruses were 2.75×10 8 , 2.58×10 8 The titers of pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR were 3.32×10 8, 2.8×10 8 .

[0042] Furthermore, the NK92 cell culture method in step S4 is as follows:

[0043] S4.1. Preparation of NK92-specific culture medium: Complete culture medium: αMEM + 0.2 mM inositol + 0.1 mM 0.02 mM folic acid + β-mercaptoethanol + 12.5% ​​HS and 12.5% ​​FBS, add hIL-2 (200 IU / ml) before use, and use up within one week;

[0044] S4.2. NK92 cell recovery: After thawing in a 37°C water bath, add 5 times the volume of complete culture medium, centrifuge at 1000 rpm for 5 min, discard the supernatant, add culture medium and gently resuspend, and culture in a T25 culture flask with an initial density of 3×10 per ml. 5 During the culture period, the frequency of subculturing and medium replacement is determined according to the cell density;

[0045] S4.3, NK92 cell medium replacement: When changing the medium halfway, gently tilt the culture bottle against the centrifuge tube rack. After the cell clusters are precipitated, gently aspirate half of the supernatant and centrifuge at 800 rpm for 5 min. After centrifugation, resuspend the precipitate with an equal amount of fresh complete medium and add it to the original bottle for continued culture. When changing the medium completely, gently blow the cells to mix well and take a small amount of cells for counting. Centrifuge at 800 rpm for 5 min and count at 3×10 per ml. 5 Add appropriate amount of culture medium for cultivation;

[0046] S4.4. Passaging of NK92 cells: When the cell density is very high, gently shake the T25 flask to roughly mix the cells, then pipette half the volume of the cell solution into a new T25 flask, and add an equal amount of complete culture medium to both flasks for continued culture.

[0047] Another object of the present invention is to provide a method for enhancing NK cell function by interfering with GPR132 and applying it to CAR-NK treatment of colon cancer.

[0048] Compared with the prior art, the present invention has the following beneficial effects:

[0049] The present invention illustrates the regulatory effect of GPR132 on NK function. Downregulation of GPR132 in NK cells enhances NK cell effect, proliferation and anti-apoptosis ability, thereby enhancing NK cell cytotoxicity. At the same time, in the application of CAR-NK, downregulation of GPR132 significantly improves the cytotoxicity, intratumor survival ability and colon cancer clearance ability of CAR-NK92. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1The plasmid maps of pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP in the present invention;

[0051] Figure 2 This is a diagram of vector enzyme digestion and recombinant plasmid identification in the present invention;

[0052] Figure 3 The plasmid maps are pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR;

[0053] Figure 4 This is a diagram of vector restriction enzyme digestion and recombinant plasmid identification;

[0054] Figure 5 This is the result of the GFP positive rate test of NK92;

[0055] Figure 6 This is the result diagram of GPR132 interference efficiency verification;

[0056] Figure 7 This is a statistical diagram of the killing efficiency of NK92 cells against K562 cells;

[0057] Figure 8 The figure is a flow cytometry graph of the expression level of activated cytokines;

[0058] Fig. 9 The figure is the flow cytometry detection diagram of proliferation ability and anti-apoptosis ability;

[0059] Fig.10 This is the flow cytometry graph of CAR positivity;

[0060] Fig.11 This is a statistical chart of the killing efficiency of CAR-NK cells on target cells;

[0061] Fig.12 This is a diagram of the in vivo anti-tumor effect of CAR-NK. DETAILED DESCRIPTION

[0062] The following will describe the implementation methods of the present application in detail with the help of accompanying drawings and examples, so that the implementation process of how the present application uses technical means to solve technical problems and achieve technical effects can be fully understood and implemented accordingly.

[0063] The present invention provides a method for enhancing NK cell function by interfering with GPR132, which is as follows:

[0064] 1. Construction of pLL3.7-GPR132-shRNA interference plasmid

[0065] 1.1 RNAi target sequence design

[0066] The gene number of Homo sapiens G protein-coupled receptor 132 (GPR132) was found on the NCBI website: EU432121.1. The GPR132 gene RNAi target sequence shRNA-2 was designed on the website (https: / / rnaidesigner.thermofisher.com / rnaiexpress / design.do) according to the gene number. The results are shown in Table 1.

[0067] Table 1. GPR132 gene RNAi target sequences

[0068] Target sequence name Starting position Nucleotide sequence of RNAi target sequence GC% SEQ ID NO. Target sequence 2 593 GGTACTACTACGCCAGGTTCA 52.39 SEQ ID NO.: 1

[0069] 1.2 Design interference sequence according to target sequence

[0070] Based on the selected target sequence, the interference sequence was designed and determined according to the following principles: the 5' end began with G, and the G+C content was set to 30% to 50%; according to the requirements of the pLL3.7 vector, (1) T was added to the 5' end of the positive chain to reconstruct the T at position 1 of the U6 promoter; (2) a loop "TTCAAGAGA" was added after the interference target sequence; (3) a reverse complementary sequence and a termination signal "TTTTTT" were added; (4) an EcoR I restriction site GAATTC was added to the 3' end to facilitate identification; (5) the Xho I restriction site was then filled in to synthesize a pair of complementary fragments; the sequence was shuffled to design the NC (Negative Control) sequence, and the sequences are shown in Table 2.

[0071] Table 2. Oligonucleotide sequences designed for target sequences and negative control sequences

[0072]

[0073] 1.3 Construction of interference plasmids pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP

[0074] The designed target oligonucleotide sequence was submitted to Suzhou Jinweizhi Biotechnology Co., Ltd. to synthesize the double-stranded DNA sequence of the target sequence, and the empty pLL3.7 was double-digested with restriction endonucleases HpaI and XhoI, and the recombinant plasmid was constructed by ligation with T4 DNA ligase.

[0075] pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP, as Figure 1 , Figure 2 A. The recombinant plasmid was identified by EcoR I single restriction enzyme digestion and sequenced as shown in Figure 2 As shown in B.

[0076] 2. Construction of pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR targeting plasmids

[0077] The pLL3.7-NKG2D-CAR vector was double-digested with restriction endonucleases XbaI and NheI to recover the large fragment, and the pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP were double-digested with restriction endonucleases XbaI and NheI to recover the small fragments, which were then ligated with T4 DNA ligase to obtain pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR plasmids, as shown in Figure 3 and Figure 4 As shown in A and B. The results of EcoR I single enzyme digestion identification of the recombinant plasmid are as follows Figure 4 As shown in C.

[0078] 3. Lentivirus Packaging and Virus Titer Determination

[0079] 3.1 Lentiviral packaging

[0080] (1) 293T cells were cultured in a 10 cm cell culture dish;

[0081] (2) When the cell density reaches nearly 70%, virus packaging is performed. 9 ml of DMEM complete medium is added to each dish. 2 The lentiviral packaging auxiliary plasmid was dissolved in serum-free DMEM medium at a ratio of 5 μg:3 μg:5 μg, and the transfection reagent PEI was mixed at a ratio of PEI:DNA mass 3:1, and allowed to stand at room temperature for 15 min;

[0082] (3) Add 1 ml of the plasmid PEI mixed liquid dropwise to the culture medium and continue culturing for 8 h. After changing the medium, add 10 ml of DMEM complete medium to each dish;

[0083] (4) After culturing for 48 h, the first cell culture medium was collected, fresh DMEM medium was added and cultured for another 24 h, and the second cell culture supernatant was collected;

[0084] (5) centrifugation (4000 g, 10 min) to remove cell debris;

[0085] (6) Filter the virus with a 0.45 μm syringe filter to further remove impurities, and filter again with a 0.22 μm syringe filter;

[0086] (7) Add the filtered virus solution to a sterilized ultracentrifuge tube and perform ultracentrifugation (25,000 g, 2 h). After centrifugation, remove the culture medium supernatant, mark the concentrated spots of the virus with a marker, add 400 ul of culture medium, dissolve the virus overnight, collect the virus, and package the virus in 1.5 ml EP tubes and freeze it in a -80°C refrigerator for later use.

[0087] 3.2 Virus titer determination

[0088] (1) 293T cells were cultured in a 24-well plate, with 2×10 cells per well. 5 , different volumes of virus concentrate were added to 24-well plates, and uninfected wells were set as blank control groups, cultured for 48 h, and cells were collected by digestion after 48 h;

[0089] (2) Resuspend the cells in 100 μl FACS buffer, add the corresponding 0.3 μl APC anti-human NKG2D antibody, and stain at 4°C in the dark for 30 min. After incubation, add 1 ml FACS buffer and centrifuge (400 g, 3 min) to wash the cells;

[0090] (3) Finally, resuspend the cells in 400 μl of FACS buffer and perform flow cytometry to detect the positive rate;

[0091] (4) Uninfected 293T cells were used as negative controls. The virus titer was calculated based on the positive rate of infected 293T cells. The formula for calculating the virus titer was as follows: T (TU / ml) = (number of 293T cells × positive rate × 1000) / virus volume (μl). The calculation results are as follows: The titers of pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP were 2.75 × 10 8 , 2.58×10 8 The titers of pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR were 3.32×10 8 , 2.8×10 8 .

[0092] 4. NK92 Cell Culture

[0093] (1) Preparation of NK92-specific culture medium: Complete culture medium: αMEM + 0.2 mM inositol + 0.1 mM 0.02 mM folic acid + β-mercaptoethanol + 12.5% ​​HS and 12.5% ​​FBS, add hIL-2 (200 IU / ml) before use, and use up within one week.

[0094] (2) NK92 cell recovery. After thawing in a 37°C water bath, add 5 times the volume of complete culture medium, centrifuge at 1000 rpm for 5 min, discard the supernatant, add culture medium and gently resuspend, and culture in a T25 culture flask with an initial density of 3×10 per ml. 5 During the culture period, the frequency of subculturing and medium replacement was determined according to the cell density.

[0095] (3) Replacement of NK92 cell medium. When changing the medium halfway, gently tilt the culture bottle against the centrifuge tube rack. After the cell clusters are precipitated, gently aspirate half of the supernatant and centrifuge at 800 rpm for 5 min. After centrifugation, resuspend the precipitate with an equal amount of fresh complete medium and add it to the original bottle for continued culture. When changing the medium completely, gently blow the cells to mix well and take a small amount of cells to count. Centrifuge at 800 rpm for 5 min and count at 3×10 per ml. 5 Add appropriate amount of culture medium for cultivation.

[0096] (4) Passaging of NK92 cells. When the cell density is very high, gently shake the T25 flask to roughly mix the cells, then pipette half of the cell solution into a new T25 flask, and add an equal amount of complete culture medium to both flasks to continue culturing.

[0097] 5. Infect NK92 cells to determine the interference efficiency of GPR132

[0098] (1) NK92 cells were seeded in 24-well plates, with 5×10 cells per well. 5 cells, 3 wells in total. Divided into 3 groups: negative control group without virus infection, pLL3.7-shRNA-NC-EGFP non-interference control group and pLL3.7-shRNA-2-EGFP lentivirus interference group, 2 wells in each group. The two experimental groups were added with the corresponding volume of virus at MOI=10, and the cells were collected after 24 hours, centrifuged at 1000rpm for 5 minutes, and the culture medium was discarded to obtain GPR132-interfered and non-interfered NK92 cells, named: NC-NK92 and SH-NK92, respectively.

[0099] After 48 hours, the cells were collected and the GFP expression efficiency, i.e., the virus infection positive rate, was detected by flow cytometry. The infection efficiency of pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP on NK92 cells was close to 100%. Figure 5 As shown, the GFP positive rate of NC-NK92 was 99.6%, and the positive rate of SH-NK92 was 99.5%.

[0100] NK92 cells were taken after infection for 48 hours. The cells were lysed with Trizol, total RNA was extracted, reverse transcribed, and the interference effect of the recombinant plasmid was analyzed by RT-PCR. The results are as follows Figure 6As shown. After the pLL3.7-shRNA-2-EGFP lentivirus infected cells, it could significantly interfere with the transcription of GPR132mRNA, causing the expression of GPR132mRNA to drop significantly to 20% of the original. The statistical results showed that there was a very significant difference (P < 0.0001) compared with the uninfected virus group and the pLL3.7-shRNA-NC-EGFP virus group.

[0101] 6. Detection of the killing ability of GPR132-knockdown NK92 against K562

[0102] (1) Take NK92 cells (NC-NK92, SH-NK92) and K562 target cells after 72 hours of virus infection, count and adjust the density. Target cells are 3*10 per well. 4 The cells were seeded in a 96-well plate, and NK92 cells were added according to different effector-target ratios (E:T, 2.5:1, 5:1, and 10:1), that is, 7.5×10 4 , 1.5×10 5 , 3×10 5 The final volume of the medium was 200 μl. No target cells were added to the control wells.

[0103] (2) After 4 h of co-incubation, the cells were collected and stained with APC-Cy7 anti-human CD56 antibody. After staining, the cells were washed once with FACS buffer and then stained with Annexin V antibody at room temperature for 15 min. The positive ratio of Annexin V in the CD56 negative population was detected by flow cytometry. The killing efficiency of effector cells was obtained based on the spontaneous apoptosis of target cells. The results are shown in Figure 2. Figure 7 shown.

[0104] (3) The results showed that as the effector-target ratio increased, the killing ratio of NK92 cells with downregulated GPR132 against K562 increased significantly. The killing efficiency of NC-NK92 against K562 at three effector-target ratios was 41.7%, 43.5%, and 49.5%, respectively; the killing efficiency of SH-NK92 against K562 was 44.5%, 56.4%, and 64.9%, respectively. And statistical analysis showed that the difference in killing efficiency between the two was extremely significant (P < 0.001). This shows that downregulation of GPR132 enhances the killing ability of NK92.

[0105] 7. Detection of the expression level of activation factors in GPR132 knockdown NK92

[0106] (1) Take NK92 cells (NC-NK92, SH-NK92) and K562 cells infected with the virus for 72 hours

[0107] Count the target cells and adjust the cell density. The target cells are 3×104 The cells were inoculated in a 96-well plate, and three replicate wells were set up. NK92 cells were added at an effector-target ratio of 5:1, and the final volume of the culture medium was 200 μl.

[0108] (2) Add 1 μl of 10 μg / ml BFA to each well, gently shake to disperse the BFA in the cell suspension, and incubate in an incubator for 4 h.

[0109] (3) After incubation, transfer each group of samples to a 1.5 ml centrifuge tube, wash twice with FACS buffer, add 200 μL of membrane permeabilization fixative and incubate at 4°C for 30 min.

[0110] (4) Add FACS buffer to wash the cells, centrifuge at 400g for 5 min, discard the supernatant, add 100 μL FACS buffer to suspend the cells, add 0.3 μL each of PECy7 anti-human GzmB and APC anti-human IFN-γ flow cytometry antibodies, and gently tap the tube wall to mix.

[0111] (5) Stain at 4°C in the dark for 30 min, add FACS buffer to wash away excess antibodies. Add 300 μL FACS buffer to resuspend the cells and perform flow cytometry. Figure 8 .

[0112] According to the results, the expression levels of GzmB and IFN-γ in the SH group were higher than those in the NC group. Figure 7 The results were consistent with those of , demonstrating that GPR132 interference enhanced NK activation.

[0113] 8. Detection of proliferation and anti-apoptosis ability of NK92 cells with GPR132 knockdown

[0114] (1) As described above, NK92 cells (NC-NK92, SH-NK92 and K562 cells) were taken after 72 hours of virus infection, counted and adjusted for cell density. They were added to a 48-well plate at a ratio of 5:1 between effector and target, with a final volume of 200 μl.

[0115] (2) After 5 days of culture, transfer each group of samples to a 1.5 ml centrifuge tube, wash twice with FACS buffer, add 200 μL of membrane permeabilization fixative and incubate at 4°C for 30 min.

[0116] (3) Wash the cells with FACS buffer, centrifuge at 400g for 5 min, discard the supernatant, resuspend the cells with 100 μl FACS buffer, add 0.3 μl of APC anti-human Ki67 or APC anti-human Bcl-2 flow cytometry antibody, and mix by gently tapping the tube wall.

[0117] (4) Stain at 4°C in the dark for 30 min, add FACS buffer to wash away excess antibodies. Add 300 μL FACS buffer to resuspend the cells and perform flow cytometry. Fig. 9 As can be seen from the figure, the SH-NK92 group expressed more proliferation antigen Ki67 and anti-apoptotic protein Bcl-2 than the NC-NK92 group, indicating that downregulation of GPR132 enhanced the proliferation and anti-apoptotic ability of NK92.

[0118] 9. Detection of cytotoxicity of GPR132 knockdown CAR-NK

[0119] (1) Based on the above results, we infected NK92 cells with NKG2D-CAR, shRNA-NC-NKG2D-CAR, and shRNA-2-NKG2D-CAR viruses (MOI = 10), collected the cells after 24 hours, and replaced the culture medium with fresh culture medium after centrifugation at 1000 rpm for 5 min to obtain NKG2D-CAR-NK92, shRNA-NC-NKG2D-CAR-NK92, and shRNA-2-NKG2D-CAR-NK92 cells, which were named CAR-NK92, NC-CAR-NK92, and SH-CAR-NK92, respectively. Mock-NK92 was used as a negative control without virus infection.

[0120] (2) After 48 hours, cells were collected by digestion, resuspended in 100 μl FACS buffer, and 0.3 μl APC anti-human NKG2D antibody was added. After staining at 4°C in the dark for 30 minutes, the NKG2D positive rate was detected by flow cytometry. Fig.10 As shown, compared with Mock, the NKG2D expression of CAR-NK92, NC-CAR-NK92, and SH-CAR-NK92 was all above 90%.

[0121] 10. Detection of the killing ability of NKG2D-CAR-NK cells targeting human NKG2DL against colon cancer cells

[0122] (1) Take NK92 cells (CAR-NK and NC-CAR-NK, SH-CAR-NK92), Mock-NK92 cells and NKG2DL after 72 hours of virus infection + The tumor cells HCT116-Luciferase were counted and the cell density was adjusted. They were co-cultured in a low-adsorption 96-well cell culture plate at an effector-target ratio of 2.5:1, 5:1, and 10:1, with 3×10 target cells per well. 4 Three replicate wells were set for each effector-target ratio, the control cells were HCT116-Luciferase without effector cells, and the final volume of the culture medium was 200 μl.

[0123] (2) After 4 h of co-culture, carefully pipette the cell suspension from the 96-well wells and detect the expression level of luciferase using a multifunctional microplate reader according to the instructions of the Firefly Luciferase Reporter Gene Assay Kit (Shanghai Biotech Co., Ltd.). Calculate the killing efficiency. The statistical results are shown in Fig.11 .

[0124] (3) The results showed that with the increase of the effector-target ratio, the killing ratio of target cells in the CAR-expressing group increased significantly. The killing efficiency of effector cells against HCT116-luci cells at three effector-target ratios were: Mock-NK92 (10.43%, 23.08%, 24.9%); CAR-NK92 (27.34%, 33.50%, 38.12%); NC-CAR-NK92 (23.32%, 35.66%, 38.41%); SH-CAR-NK92 (33.13%, 43.76%, 56.87%). The killing efficiency of SH-CAR-NK92 was better than that of CAR-NK92 and NC-CAR-NK92 groups, and statistical analysis showed that the difference in killing efficiency between the two groups was extremely significant (P < 0.01), and there was no significant difference between CAR-NK92 and NC-CAR-NK92 groups. This indicates that interference with GPR132 enhances the in vitro cytotoxicity of CAR-NK92 cells.

[0125] Experiment 1

[0126] Colon cancer xenograft model was established using 8-week-old female NOD / SCID / γ-chain- / - (NSG) mice. 6 HCT116-luci cells were subcutaneously injected into the right hind abdomen of NSG mice. When the tumor volume reached about 60-100mm3, the mice were randomly divided into 3 groups and subjected to IVIS imaging. Mock-NK92, CAR-NK92, and SH-CAR-NK92 cells were intravenously injected into the mice every 7 days. At the same time as the treatment, 20,000IU of human recombinant IL-2 was injected intraperitoneally. IVIS live imaging was performed every few days to show the growth of the tumor and observe the survival of the mice. Fig.12 shown.

[0127] from Fig.12 As can be seen from A, the fluorescent area of ​​mice treated with CAR-NK92 and SH-CAR-NK92 gradually decreased, indicating that the tumor volume was decreasing. Fig.12 B shows that on the 35th day of the experiment, the tumors of some mice were removed and photographed. Fig.12C is the test of mouse survival curve. The survival rate of SH-CAR-NK92 mice was 100%, the survival rate of CAR-NK92 group was 70%, and the Mock group began to die on the 26th day and all died on the 45th day.

[0128] In summary, the therapeutic effect of SH-CAR-NK92 group was better than that of CAR-NK92 group, and that of CAR-NK92 group was better than that of Mock group. This indicates that the expression of NKG2D can target HCT116 cells with high expression of NKG2DL, thereby effectively killing tumors. The interference of GPR132 promoted the cytotoxicity and activity of NK cells and enhanced the anti-apoptosis ability of NK cells, thereby further enhancing the ability of CAR-NK to clear colon cancer in vivo.

[0129] Experiment 2

[0130] In the process of screening the shRNA-2 interference sequence of the present application, different interference sequences were designed for multiple different target sequences at the same time, and relevant experiments were carried out. The experimental method is the same as above. The other RNAi target sequences screened out are shown in Table 3, and the upstream and downstream fragments of the interference sequences corresponding to each target sequence are shown in Table 4, wherein shRNA-2 is the original sequence of the embodiment.

[0131] Table 3. GPR132 gene RNAi target sequences

[0132] Example Target sequence name Starting position Nucleotide sequence of RNAi target sequence GC% SEQ ID NO Example 1 Target sequence 2 593 GGTACTACTACGCCAGGTTCA 52.39 SEQ ID NO.: 1 Comparative Example C1 Target sequence 1 293 GGGTCATCTATATCCGCAACC 52.39 SEQ ID NO.:5 Comparative Example C2 Target sequence 3 974 GGTGGAAAGAGTGGTCCATGA 52.39 SEQ ID NO.:6

[0133] Table 4. Oligonucleotide sequences designed for target sequences and negative control sequences

[0134]

[0135]

[0136] Using the same method as the above-mentioned vector construction, the interfering shRNA was designed and the interfering sequence DNA double-stranded was synthesized by the company and connected to the pLL3.7 vector.

[0137] The same method was used to package and titer lentivirus.

[0138] The interference effects of pLL3.7-shRNA-1-EGFP, pLL3.7-shRNA-2-EGFP, pLL3.7-shRNA-3-EGFP, and pLL3.7-shRNA-NC-EGFP plasmids were detected using the same method.

[0139] Figure 6The RT-PCR results showed that, from the perspective of GPR132 mRNA expression, among the many screened interfering RNAs, the mRNA expression levels of the shRNA-1 and shRNA-3 interference groups were higher than that of the shRNA-2 group, so the shRNA-2 fragment had the best interference effect.

[0140] result

[0141] As part of the innate immune cells, NK cells play a vital role in monitoring tumor immune responses. Unlike T cells, NK cells can recognize cancer cells and quickly fight cancer cells without prior sensitization. In addition, adoptive NK cell therapy does not cause GVHD of the body's receptors. However, its clinical effectiveness has been limited to date. The expression of chimeric antigen receptors (CARs) helps NK cells to specifically target tumor cells based on the presence of certain antigens. However, there are still some challenges in the treatment of solid tumors with CAR-NK cell therapy. On the one hand, it is the design of the CAR structure and the selection of the target antigen. On the other hand, the immunosuppressive tumor microenvironment hinders the effectiveness of NK cells by metabolizing a large amount of lactate. It has been reported that GPR132 is sensitive to lactate in the breast cancer microenvironment, thereby inhibiting the function of macrophages. We found that after knocking down GPR132, the function of NK was significantly enhanced. This strategy was applied to CAR-NK treatment of colon cancer. The results also proved that downregulating GPR132 in CAR-NK92 not only exhibited excellent anti-tumor activity against colon cancer in vitro, but also enhanced the functional execution in vivo and improved the survival of mice. Based on the above results, we speculate that GPR132 knockdown may attenuate lactate inhibition of CAR-NK in the solid tumor microenvironment and may become a drug target.

[0142] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any simple modification, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention are within the scope of the technical solution of the present invention.

Claims

1. A method for enhancing NK cell function by interfering with GPR132, characterized in that: The following steps are involved: S1, construction of pLL3.7-GPR132-shRNA-2 interference plasmid; Construction of S2, pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR targeting plasmids; S3, lentiviral packaging and virus titer determination; S4, NK92 cell culture; S5, infection of NK92 cells to determine the interference efficiency of GPR132; S6. Detect the killing ability of GPR132-knockdown NK92 against K562; S7, detecting the expression levels of activation factors in GPR132-knockdown NK92 cells; S8. Detect the proliferation and anti-apoptosis ability of NK92 with GPR132 knockdown; S9, detection of cytotoxicity of CAR-NK with GPR132 knockdown; S10, detecting the killing ability of NKG2D-CAR-NK cells targeting human NKG2DL against colon cancer cells; The construction method of the pLL3.7-GPR132-shRNA-2 interference plasmid in step S1 includes: S1.

1. RNAi target sequence design: The gene number of Homo sapiens G protein-coupled receptor 132 (GPR132) was found on the NCBI website: EU432121.

1. The GPR132 gene RNAi target sequence was designed based on the gene number; the target sequence of shRNA-2 was GGTACTACTACGCCAGGTTCA; S1.

2. Design interference sequence according to target sequence: Based on the selected target sequence, the interference sequence was designed and determined according to the following principles: the 5' end began with G, and the G+C content was set to 30% to 50%; according to the requirements of the pLL3.7 vector, (1) T was added to the 5' end of the positive strand to reconstruct the T at position 1 of the U6 promoter; (2) a loop "TTCAAGAGA" was added after the interference target sequence; (3) a reverse complementary sequence and a termination signal "TTTTTT" were added; (4) an EcoR I restriction site GAATTC was added to the 3' end to facilitate identification; (5) the Xho I restriction site was then filled in to synthesize a pair of complementary fragments, and the sequence was disrupted to design the NC (Negative Control) sequence; S1.

3. Construction of interference plasmids pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP: The designed target oligonucleotide sequence was submitted to Suzhou Genewise Biotechnology Co., Ltd. to synthesize the double-stranded DNA sequence of the target sequence, and the empty pLL3.7 was double-digested with restriction endonucleases HpaI and XhoI, and ligated with T4 DNA ligase to construct the recombinant plasmids pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP; The construction method of the pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR targeting plasmids in step S2 is as follows: The pLL3.7-NKG2D-CAR vector was double-digested with restriction endonucleases XbaI and NheI to recover the large fragment, with a value of 6975bp. The pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP were double-digested with restriction endonucleases XbaI and NheI to recover the small fragments, which were then connected with T4 DNA ligase to obtain pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR plasmids.

2. The method for enhancing NK cell function by interfering with GPR132 according to claim 1, characterized in that: The method for packaging the lentivirus and determining the virus titer in step S3 is as follows: S3.1 Lentivirus packaging: (1) 293T cells were cultured in a 10 cm cell culture dish; (2) When the cell density grows to nearly 70%, the virus is packaged. 9 ml of DMEM complete medium is added to each dish. The target plasmid and the packaging auxiliary plasmid of the chronic disease are dissolved in serum-free DMEM medium at a ratio of 5 μg:3 μg:5 μg. The transfection reagent PEI is mixed at a ratio of PEI:DNA mass 3:

1. The mixture is allowed to stand at room temperature for 15 minutes. The auxiliary plasmids are pMD2.G and psPAX2. (3) Add 1 ml of the plasmid PEI mixed liquid dropwise to the culture medium and continue culturing for 8 h. After changing the medium, add 10 ml of DMEM complete medium to each dish; (4) After culturing for 48 h, the first cell culture medium was collected, fresh DMEM medium was added and cultured for another 24 h, and the second cell culture supernatant was collected; (5) centrifugation to remove cell debris at 4000 g for 10 min; (6) Filter the virus with a 0.45 μm syringe filter to further remove impurities, and filter again with a 0.22 μm syringe filter; (7) Add the filtered virus solution to a sterilized ultracentrifuge tube and perform ultracentrifugation at 25,000 g for 2 h. After centrifugation, remove the culture medium supernatant, mark the concentrated spots of the virus with a marker, add 400 μl of culture medium, dissolve the virus overnight, collect the virus, and aliquot the virus into 1.5 ml EP tubes and store in a -80°C refrigerator for later use; S3.

2. Virus titer determination (1) 293T cells were seeded in a 24-well plate, with 2×10 cells per well. 5 , different volumes of virus concentrate were added to 24-well plates, and uninfected wells were set as blank control groups, cultured for 48 h, and cells were collected by digestion after 48 h; (2) Resuspend the cells in 100 μl FACS buffer, add the corresponding 0.3 μl APC anti-human NKG2D antibody, and stain at 4°C in the dark for 30 min. After incubation, add 1 ml FACS buffer and centrifuge (400 g, 3 min) to wash the cells. The centrifugation parameters are 400 g, 3 min; (3) Finally, resuspend the cells in 400 μl of FACS buffer and perform flow cytometry to detect the positive rate; (4) Uninfected 293T cells were used as negative control. The titer was calculated based on the positive rate of infected 293T cells. The formula for calculating the virus titer was as follows: T (TU / ml) = (number of 293T cells × positive rate × 1000) / virus volume (μl). The calculation results are as follows: The titers of pLL3.7-shRNA-2-EGFP and pLL3.7-shRNA-NC-EGFP viruses were 2.75×10 8 , 2.58×10 8 The titers of pLL3.7-shRNA-2-NKG2D-CAR and pLL3.7-shRNA-NC-NKG2D-CAR were 3.32×10 8 , 2.8×10 8 .

3. The method for enhancing NK cell function by interfering with GPR132 according to claim 1, characterized in that: The NK92 cell culture method in step S4 is as follows: S4.

1. Preparation of NK92-specific culture medium: complete culture medium: αMEM + 0.2 mM inositol + 0.02 mM folic acid + 0.1 mM β-mercaptoethanol + 12.5% ​​HS and 12.5% ​​FBS, add 200 IU / ml hIL-2 before use, and use up within one week; S4.

2. NK92 cell recovery: After thawing in a 37°C water bath, add 5 times the volume of complete culture medium, centrifuge at 1000 rpm for 5 min, discard the supernatant, add culture medium and gently resuspend, and culture in a T25 culture flask with an initial density of 3×10 per ml. 5 During the culture period, the frequency of subculturing and medium replacement is determined according to the cell density; S4.3, NK92 cell medium replacement: When changing the medium halfway, gently tilt the culture bottle against the centrifuge tube rack. After the cell clusters are precipitated, gently aspirate half of the supernatant and centrifuge at 800 rpm for 5 min. After centrifugation, resuspend the precipitate with an equal amount of fresh complete medium and add it to the original bottle for continued culture. When changing the medium completely, gently blow the cells to mix well and take a small amount of cells for counting. Centrifuge at 800 rpm for 5 min and count at 3×10 per ml. 5 Add appropriate amount of culture medium for cultivation; S4.

4. Passaging of NK92 cells: When the cell density is very high, gently shake the T25 flask to roughly mix the cells, then pipette half the volume of the cell solution into a new T25 flask, add an equal amount of complete culture medium to both flasks and continue culturing.

4. Use of the method for enhancing NK cell function by interfering with GPR132 as described in any one of claims 1 to 3 in CAR-NK drugs for treating colon cancer.

Images