A lipase mutant with improved specific activity

Abstract

The present invention relates to the field of genetic engineering and protein modification technology, and specifically to a lipase mutant with improved specific activity. Compared with the wild-type lipase RL, the lipase mutant containing the S90A single-point mutation provided by the present invention has a specific activity increased by 51.8%, and the specific activity is as high as 4413 U / mg, achieving unexpected technical effects. The lipase mutant has a higher specific activity, which is conducive to reducing its production cost and promoting its wide application in the fields of oil processing.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and protein engineering, and in particular to a lipase mutant with improved specific activity. Background Art

[0002] Lipase is a type of hydrolase that can hydrolyze triglycerides to generate free fatty acids and glycerol of different chain lengths. The main sources of lipase are plants, animals and microorganisms. Microorganisms are characterized by a wide variety of species, rapid reproduction and easy variation. They secrete a wide variety of lipases with a wide spectrum of substrates and can adapt to different pH values ​​and temperature ranges. Some microbial strains obtained from extreme environments have more prominent enzymatic properties. At present, it has been found that lipase-producing microorganisms are widely distributed, and more than 60 genera have been isolated and identified, including 10 genera of yeast, 23 genera of other fungi, 4 genera of actinomycetes, and 28 genera of bacteria. Fungal strains with high lipase production are mostly derived from Rhizopus, Aspergillus, Penicillium, Mucor, Geotrichum, etc.

[0003] From the perspective of catalytic properties, lipase has mild reaction conditions, few by-products, and does not require coenzymes. It also has high chemical selectivity and stereoisomerism. At the same time, lipase also has the functions of catalyzing ester hydrolysis, ester synthesis, transesterification, aminolysis, alcoholysis, and drug synthesis.

[0004] At present, the application of lipase in the fields of medicine, oil processing, biodiesel, etc. is not widespread enough. Therefore, developing lipase with excellent performance and reducing its production cost are of great significance to promoting the application of this enzyme. Summary of the invention

[0005] The purpose of the present invention is to provide a lipase mutant with improved specific activity and application thereof.

[0006] The present invention relates to a lipase mutant, wherein the 90th amino acid of the lipase with the amino acid sequence of SEQ ID NO: 1 is mutated from Ser to Ala.

[0007] The amino acid sequence of the mutant is SEQ ID NO:3.

[0008] The present invention also relates to a DNA molecule encoding the above lipase mutant.

[0009] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0010] The present invention also relates to a host cell, comprising the above recombinant expression vector.

[0011] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed lipase mutant is significantly improved.

[0012] The host cell is Pichia pastoris ( Pichia pastoris ).

[0013] The host cell is Aspergillus niger ( Aspergillus niger ).

[0014] The host cell is Trichoderma reesei ( Trichoderma reesei ).

[0015] The invention also relates to the application of the lipase mutant in the production of immobilized lipase.

[0016] The present invention also relates to an immobilized lipase, which is prepared by combining the above lipase mutant with an immobilized carrier.

[0017] Compared with the wild-type lipase RL, the lipase mutant comprising the S90A single-point mutation provided by the present invention has a specific activity increased by 51.8%, with a specific activity as high as 4413 U / mg, achieving an unexpected technical effect.

[0018] In summary, the lipase mutant provided by the present invention has a higher specific activity, which is beneficial to reducing its production cost and promoting its wide application in the fields of oil processing and the like. DETAILED DESCRIPTION

[0019] The present invention discloses a lipase mutant, a preparation method and application thereof, a DNA molecule encoding the lipase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0020] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example MOLECΜLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECΜLAR BIOLOGY (Ausubel, 2003) in the method of recording. These general references provide definitions and methods known to those skilled in the art. But those skilled in the art can, on the basis of the technical scheme recorded in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:

[0021] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0022] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0023] Culture medium formula:

[0024] Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0025] Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0026] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0027] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0028] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0029] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0030] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0;

[0031] The present invention will be further described below in conjunction with embodiments:

[0032] Example 1 Construction of recombinant plasmid

[0033] The lipase gene was optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. The lipase was named RL, its amino acid sequence was SEQ ID NO: 1, and its encoding nucleotide sequence was SEQ ID NO: 2.

[0034] The lipase gene was digested with restriction enzymes EcoR I and Not I (Fermentas); at the same time, the plasmid pPIC9K was digested with restriction enzymes EcoR I and Not I. The digestion products were purified using a gel purification kit and ligated with T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced for accuracy (Sangon).

[0035] The plasmid was purified from the E. coli clone with the correct sequencing results using a plasmid miniprep kit (Omega) to obtain a recombinant plasmid, which was named pPIC9K-RL.

[0036] Example 2 Screening of mutants with improved specific activity

[0037] In order to further improve the specific activity of lipase RL, the applicant screened a large number of mutations of the enzyme using directed evolution technology.

[0038] Design of PCR primers RL-F1, RL-R1:

[0039] RL-F1: GGA GAATTC GTCCCTGTCGCTGGCCATAAA (underlined is the restriction endonuclease EcoRI recognition site);

[0040] RL-R1: ATA GGCGGCCG TTACAGGCAGGAGCCCTCGTT (the underline indicates the recognition site of restriction endonuclease NotI).

[0041] The RL gene (SEQ ID NO: 1) was used as a template and PCR amplification was performed using the above primers using the GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plates, and cultured inverted at 37°C. After the transformants appeared, they were picked up one by one with a toothpick to a 96-well plate, and 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were cultured at 37°C and 220 rpm for about 6 h, and the supernatant was discarded after centrifugation. The cells were resuspended in buffer and repeatedly frozen and thawed to break the cell wall to obtain Escherichia coli cell lysate containing lipase.

[0042] The enzyme activity of lipase was determined at 37°C and pH 7.5. 20 μL of lysate was taken out to a new 96-well plate, and 80 μL of substrate solution was added (the substrate solution was prepared by slowly mixing solution A and solution B in a ratio of 1:9 and preparing it immediately before use. Solution A: 18 mg of p-nitrophenol palmitate was accurately weighed and dissolved in 30 ml of isopropanol. Solution B: 50 mmol / L phosphate buffer, pH 7.5), and reacted at 37°C for 10 min, then 80 μL of anhydrous ethanol was added to terminate the reaction, and the absorbance was measured at 410 nm.

[0043] The experimental results showed that some mutations had no effect on the specific activity of lipase RL, and some mutations even made it worse, which did not meet the requirements. Finally, the applicant screened out a mutation site that could significantly improve the specific activity of lipase RL without affecting its original enzymatic properties: S90A.

[0044] Based on the above wild-type lipase RL, the present invention provides a mutant comprising a single mutation site of S90A, and the amino acid sequence thereof is SEQ ID NO: 3.

[0045] Example 3 Expression of lipase in Pichia pastoris

[0046] 3.1 Construction of expression vector

[0047] The gene sequences of lipase RL and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0048] According to the method described in Example 1, the gene sequences of the synthesized lipase RL and its mutants were double-digested with EcoRI and NotI, and then connected with the pPIC-9K vector digested with the same enzymes at 16°C overnight, and transformed into Escherichia coli DH5a, coated on LB+Amp plates, and inverted cultured at 37°C. After the transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5μL, 10×Buffer 2.0μL, dNTPs (2.5mM) 2.0μL, 5'AOX primer (10mM): 0.5μL, 3'AOX primer: 0.5μL, ddH2O 14.5μL, reaction procedure: 95°C pre-denaturation 5min, 30 cycles: 94°C 30sec, 55°C 30sec, 72°C 2min, 72°C 10min). The positive clones were verified, and the correct recombinant expression plasmid was obtained after sequencing verification.

[0049] 3.2 Construction of Pichia pastoris engineered strains

[0050] 3.2.1 Preparation of competent yeast

[0051] The Pichia pastoris GS115 strain was activated on a YPD plate, cultured at 30°C for 48 h, and then the activated GS115 monoclonal was inoculated into 6 mL YPD liquid medium. The culture was incubated at 30°C and 220 rpm for about 12 h, and then the bacterial solution was transferred to a conical flask containing 30 mL YPD liquid medium. The culture was incubated at 30°C and 220 rpm for about 5 h. The bacterial density was detected by a UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of the bacterial cells were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The remaining supernatant was absorbed with sterile filter paper, and the bacterial cells were resuspended with 1 mL of precooled sterile water, centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. After repeated washing with 1 mL of sterile water, the cells were centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then washed with 1 mL of sterile water, centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were then washed with 1 mL of precooled sorbitol (1 mol / L); centrifuge at 4°C, 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the bacteria in 100-150 μL pre-cooled sorbitol (1 mol / L).

[0052] 3.2.2 Transformation and screening

[0053] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I, and the linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0054] The obtained transformants were transferred to BMGY medium and cultured at 30°C and 250 rpm for 1 day; then transferred to BMMY medium and cultured at 30°C and 250 rpm; 0.5% methanol was added every day to induce expression for 4 days; the bacteria were removed by centrifugation at 9000 rpm for 10 minutes to obtain the fermentation supernatant containing lipase RL and lipase mutants, respectively.

[0055] 3.3 Lipase activity assay

[0056] (1) Definition of lipase activity unit

[0057] Under the conditions of 40°C and pH 7.5, the amount of enzyme required to hydrolyze the substrate to produce 1 μmol of titratable fatty acid in 1 min is one enzyme activity unit U.

[0058] (2) Enzyme activity determination method

[0059] Weigh 40 g of polyvinyl alcohol (PVA: degree of polymerization 1750±50), add 800 mL of water, soak for 4-6 hours, heat in a boiling water bath, stir until completely dissolved, stir and cool, then make up to 1000 mL, filter with clean 6-8 layers of gauze, and set aside the filtrate.

[0060] Take 150 mL of the above filtrate, add 50 mL of olive oil, and process with a high-speed homogenizer for 10 minutes (processed 4 times, 5 minutes apart, 2-3 minutes each time), and you will get a milky white PVA emulsion. Prepare it before use.

[0061] Take two 100 mL Erlenmeyer flasks, add 4 mL of substrate solution and 5 mL of pH 7.5 phosphate buffer to the blank bottle (A) and the sample bottle (B), respectively, then add 15 mL of 95% ethanol to the blank bottle (A), and preheat in a 40°C water bath for 5 min;

[0062] Add 1 mL of the enzyme solution to be tested to the blank bottle (A) and the sample bottle (B), mix well and time immediately. After the reaction lasts for 15 minutes, use a sample pipette to immediately add 15 mL of 95% ethanol to the sample bottle (B) to terminate the reaction and take it out;

[0063] Pour the above reaction solution into a 50mL beaker, add 5mL of pure water to the conical flask, shake well and pour into the 50mL beaker, add 2 drops of phenolphthalein indicator;

[0064] Using a pH meter calibrated for alkaline conditions, add 0.05 mol / L sodium hydroxide solution to the beaker under stirring and titrate to a pH of 9.92. Titrate until the pH value does not change within 20 seconds as the endpoint, and record the volume of the sodium hydroxide standard solution consumed.

[0065] Enzyme activity calculation formula:

[0066]

[0067] X——lipase activity, U / mL;

[0068] V1——Volume of sodium hydroxide standard solution consumed when titrating the sample, mL;

[0069] V2——the volume of sodium hydroxide standard solution consumed when titrating the blank, mL;

[0070] C——Concentration of sodium hydroxide standard solution, mol / L;

[0071] 50——1mL of 0.05mol / L sodium hydroxide solution is equivalent to 50μmol of fatty acid;

[0072] n——enzyme solution dilution multiple;

[0073] 0.05——Conversion coefficient of sodium hydroxide standard solution concentration;

[0074] 15——Time conversion factor.

[0075] (3) Enzyme activity assay results

[0076] Enzyme activity was detected according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the Pichia pastoris strain expressing the recombinant lipase RL constructed above was 436 U / mL, and the enzyme activity of the fermentation supernatant of the Pichia pastoris strain expressing the recombinant lipase mutant was 667 U / mL.

[0077] 3.4 Calculation of lipase specific activity

[0078] The protein content of the fermentation supernatant of the Pichia pastoris strain expressing the recombinant lipase RL and its mutant constructed above was detected by the Coomassie Brilliant Blue method, and the specific activity was calculated.

[0079] Specific activity (U / mg) = enzyme activity / protein content.

[0080] The specific results are shown in Table 1.

[0081] Table 1 Analysis of specific activity of lipase mutants

[0082] Lipase Specific activity (U / mg) Wild-type lipase RL 2907 S90A single point mutant 4413

[0083] From the data in Table 1, it can be seen that compared with the wild-type lipase RL, the lipase mutant containing the S90A single point mutation provided by the present invention has a specific activity increased by 51.8%, reaching 4413 U / mg, achieving an unexpected technical effect.

[0084] Furthermore, immobilized lipase can be prepared by combining the lipase mutant with an immobilized carrier, which greatly reduces the production cost, thereby promoting its wide application in the fields of oil processing, biodiesel, etc.

Claims

1. A lipase mutant, characterized in that: The mutant is a lipase with an amino acid sequence of SEQ ID NO: 1, in which the 90th amino acid is changed from Ser to Ala.

2. A DNA molecule encoding the lipase mutant according to claim 1.

3. A recombinant expression vector comprising the DNA molecule of claim 2.

4. A host cell comprising the recombinant expression vector according to claim 3, characterized in that: The host cell is Pichia pastoris ( Pichia pastoris ).

5. Use of the lipase mutant according to claim 1 in the production of immobilized lipase.

6. An immobilized lipase, characterized in that: The immobilized lipase is prepared by combining the lipase mutant according to claim 1 with an immobilized carrier.

Images