Use of inhibitors of lats1 / 2 proteins in the manufacture of a medicament for treating multiple sclerosis

Abstract

The application discloses application of a functional inhibitor of LATS1 / 2 protein in preparation of a drug for treating multiple sclerosis. The application studies the role of LATS1 / 2 protein in multiple sclerosis, constructs a mouse autoimmune encephalomyelitis model, and explores the T cell differentiation mechanism of LATS1 / 2 in multiple sclerosis, and proves that knocking out or inhibiting LATS1 / 2 hinders Th17 differentiation to delay the EAE process.

Description

TECHNICAL FIELD

[0001] The present application relates to the medical use of compounds, in particular the application of LATS1 / 2 protein inhibitors in the preparation of drugs for treating multiple sclerosis, belonging to the technical field of biological medicine. BACKGROUND

[0002] After activation, naive T cells differentiate into different T cell subsets, such as Th1, Th2, Th17 and regulatory T cells, which correspond to different functions. For example, Th2 cells produce interleukin-4 (IL-4), IL-5 and IL-13, which play an important role in anti-parasitic infection; Th17 cells secrete IL-17, which enhances the immune response of the body to fungi and bacteria. At the same time, the excessive activation and proliferation of these effector cells can lead to immune damage, such as the uncontrolled activation of Th1 and Th17, which often leads to the occurrence of inflammatory bowel disease and multiple sclerosis and other autoimmune diseases.

[0003] The signal transducer and activator of transcription family (STAT) plays an important role in the differentiation of CD4 + T cells. STAT3 in the cytoplasm is activated by extracellular signals and enters the nucleus to regulate gene transcription. There are three activation pathways of STAT3: JAK / STAT signaling pathway, also known as IL-6 signaling pathway; mitogen-activated protein kinase (MAPK) activation pathway; and non-receptor tyrosine kinase activation pathway. After being phosphorylated, STAT3 is activated to form a dimer, which is transferred from the cytoplasm to the nucleus, binds to specific DNA elements, and regulates the expression of cytokine response genes. Current research has shown that STAT3 is involved in the regulation of inflammatory response and various biological processes such as cell proliferation, survival and apoptosis. Abnormal activation of STAT3 mediates the occurrence of autoimmune diseases such as psoriasis and rheumatoid arthritis. For example, in psoriasis, the secretion of IL-6 leads to the sustained activation of STAT3, which increases RORγt and induces the differentiation of precursor cells into TH17.

[0004] Multiple sclerosis (MS) is an autoimmune disease characterized by inflammatory demyelination and axonal degeneration in the white matter of the central nervous system, affecting cognitive, emotional, motor, sensory or visual function of human, and also appearing astrocyte scar as a chronic inflammation. The disease is prone to occur in people aged 20-40 years old, and currently there is no complete cure. Existing academic research shows that multiple sclerosis is mediated by Th1 and Th17 cells, and after initial contact with antigens, Th17 cells secrete interleukin-17 (IL-17), Th1 cells secrete IL-1 and interferon-γ (IFN-γ), these inflammatory factors lead to Th cell up-regulation, thereby damaging the blood-brain barrier and migrating to the central nervous system. Current treatment is still limited to reducing the frequency of disease recurrence and delaying disease progression, so research on the disease has clinical significance.

[0005] Experimental autoimmune encephalomyelitis (EAE) is a CD4 + T cell-mediated autoimmune disease characterized by mononuclear cell infiltration and demyelination around small blood vessels in the central nervous system, which is generally induced by myelin oligodendrocyte glycoprotein (MOG) in mice, and its pathological changes are similar to multiple sclerosis (MS), so the model is often used to simulate the immune conditions of MS disease, but the current exploration of the treatment mechanism of the EAE model is not comprehensive, and whether LATS1 / 2 is involved in EAE disease and MS has not been reported at home and abroad. C57BL / 6 mice are more susceptible to gene knockout and knock-in, so the LATS1 conditional knockout mouse of the strain is selected as an experimental animal for the disease research. SUMMARY

[0006] The present application overcomes the shortcomings of the prior art and provides a use of a LATS1 / 2 protein inhibitor in the preparation of a multiple sclerosis treatment drug.

[0007] The present application provides a use of a LATS1 / 2 protein functional inhibitor in the preparation of a multiple sclerosis treatment drug.

[0008] Further, the protein functional inhibitor is shRNA, siRNA or gRNA targeting LATS1 / 2 knockdown or knockout, or a small molecule compound targeting LATS1 / 2 kinase activity.

[0009] Further, the small molecule compound targeting LATS1 / 2 kinase activity is TRULI.

[0010] Specifically, the LATS1 protein knockout can inhibit the disease progression of autoimmune encephalomyelitis.

[0011] Specifically, the LATS1 / 2 protein knockout or knockdown can inhibit the differentiation of CD4 + T cells and Th17 cells infiltrating the central nervous system, inhibit the differentiation of Th17 cells, and improve the condition of autoimmune encephalomyelitis.

[0012] Specifically, the LATS1 protein deletion affects the STAT3 phosphorylation in CD4 + T cells and Th17 cells.

[0013] Specifically, the LATS1 / 2 inhibitor can alleviate the symptoms of autoimmune encephalomyelitis in mice by inhibiting the LATS1 / 2 kinase activity or expression level.

[0014] Beneficial effects

[0015] The present application studies the role of LATS1 / 2 protein in multiple sclerosis, and discusses the mechanism of LATS1 / 2 regulating T cell differentiation in multiple sclerosis by constructing a mouse model of autoimmune encephalomyelitis. We prove that knocking out or inhibiting LATS1 / 2 hinders the differentiation of Th17 to delay the progression of EAE.

[0016] Further, we prove that pharmacological inhibition of LATS1 / 2 can inhibit the inflammatory process in EAE. Therefore, we prove the function of LATS1 / 2 in alleviating multiple sclerosis by studying, which indicates that targeting protein kinase LATS1 / 2 may be a key to developing drugs for treating multiple sclerosis. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Clinical scores (A) and body weights (B) of LATS1-CKO mice and wild-type mice (LATS1-WT) in an experimental autoimmune encephalomyelitis model. Figure 1 A), body weights ( Figure 1 B).

[0018] Figure 2 Pathological immune damage of spinal cords of LATS1-CKO mice and wild-type mice (LATS1-WT) in an experimental autoimmune encephalomyelitis model.

[0019] Figure 3 Infiltration of CD4 + T cells in the central nervous system of LATS1-CKO mice and wild-type mice (LATS1-WT) in an experimental autoimmune encephalomyelitis model.

[0020] Figure 4 RORyt in the central nervous system of LATS1-CKO mice and wild type mice in experimental autoimmune encephalomyelitis model + , IL-17 + cell ratio.

[0021] Figure 5 RORyt, IL-17A mRNA level in CD4 + T cells in the central nervous system of LATS1-CKO mice and wild type mice in experimental autoimmune encephalomyelitis model

[0022] Figure 6 IL-17 secretion of CD4 + T cells after isolation of spleen cells of LATS1-CKO mice and wild type mice in experimental autoimmune encephalomyelitis model and stimulation with MOG peptide.

[0023] Figure 7 STAT3 phosphorylation after LATS1 protein knockout in anti-CD3 / CD28 activated CD4 + T cells.

[0024] Figure 8 STAT3 phosphorylation after LATS1 protein knockout in Th17 cells.

[0025] Figure 9 Th17 cell polarization after shRNA knockdown of LATS1 protein in CD4 + T cells isolated from spleen and lymph nodes of wild type mice.

[0026] Figure 10 Th17 cell polarization after shRNA knockdown of LATS2 protein in CD4 + T cells isolated from spleen and lymph nodes of wild type mice.

[0027] Figure 11 Clinical score (A) and body weight change (B) of mice after induction of EAE model using C57 mice with or without TRULI administration.

[0028] Figure 12 Th17 cell polarization after administration or not of TRULI in CD4 + T cells isolated from C57 mice after induction of EAE. DETAILED DESCRIPTION

[0029] The following will be further described in combination with specific experimental examples. The related embodiments involved in the present application, the related changes and modifications of the skilled in the art on this basis, if there is no creative labor, will be regarded as the protection scope of the present application.

[0030] Experimental reagent details, not disclosed for laboratory commonly used reagents.

[0031] Mouse CD4 + MicroBeads (130-117-043, Miltenyi Biotec)

[0032] Mouse CD4 + T cell isolation kit (130-104-453, Miltenyi Biotec)

[0033] Anti-CD3 antibody (555329, BD)

[0034] Anti-CD28 antibody (555725, BD)

[0035] TRULI reagent (HY-139489, MedChemExpress)

[0036] Flow antibody CD45-BV786 (30-F11, 564225, BD Biosciences)

[0037] Flow antibody CD4-PE (GK1.5, 100408, Biolegend)

[0038] Flow antibody RORγt-BV421 (Q31-378, 562894, BD Biosciences)

[0039] Flow antibody CD8-BV510 (53-6.7, 100752, Biolegend)

[0040] Flow antibody CD3-FITC (145-2C11, 561827, BD Biosciences)

[0041] P-STAT3 antibody (Tyr705, 9145, Cell Signaling Technology)

[0042] STAT3 antibody (9139, Cell Signaling Technology)

[0043] Gapdh antibody (2118, Cell Signaling Technology)

[0044] Goat anti-rabbit lgG antibody (2729, Cell Signaling Technology)

[0045] Experimental methods

[0046] 1. Construction of experimental autoimmune encephalomyelitis mouse model and neurological function score

[0047] Select 6-week-old CD4 + 5 T cell conditional knockout LATS1 mice and 5 wild type mice, CD4 + T cell conditional knockout LATS1 group is referred to as LATS1-CKO group, and the control group is referred to as LATS1-WT group. Induce experimental autoimmune encephalomyelitis (EAE for short), day 0: after emulsifying MOG33-35 (10 mg / mL) dissolved in 1xPBS solution, tuberculin (1 mg / mL) into the same volume of Freund's complete adjuvant, subcutaneously inject animals according to the dose of 200 μg MOG per mouse. Day 2: intraperitoneal injection of 200ug pertussis toxin. Observe the onset of mice every day, and evaluate the clinical score of each day respectively Figure 1 A) and body weight change Figure 1 B). The scoring criteria are: no symptoms, 0 points; tail weakness, 1 point; double hind limb weakness, 2 points; double hind limb paralysis, 3 points; double hind limb delay and forelimb weakness, 4 points.

[0048] 2. Hematoxylin-eosin staining analysis

[0049] The score ended on day 25 after modeling in the above manner, and the brain tissue and spinal cord of the mice in the two groups were taken respectively, fixed in 4% paraformaldehyde for 24 hours, and paraffin-embedded to prepare paraffin sections of 4 μM. Hematoxylin-eosin staining (HE) was performed on the sections, and they were sequentially immersed in xylene I, II, III for 10 minutes, and 95%, 85%, 70% ethanol for 5 minutes, and then washed with distilled water for 5 min. Hematoxylin, hydrochloric acid ethanol, and eosin were used for staining in turn. Then anhydrous ethanol and xylene were used for dehydration and permeation. After completion, they were observed under an optical microscope.

[0050] 3. Flow cytometry analysis

[0051] After the end of the scoring, the brain tissue and spinal cord of the mice in each group were taken and grinded to obtain the single nuclear cells of the brain tissue and spinal cord of the mice by 30% / 70% Percoll density gradient centrifugation. The surface antibody staining solution was prepared using PBS buffer, and incubated at 4°C for 30 minutes. After the cells were washed with PBS solution, the nucleic and membrane breaking solution (BD Pharmingen fixation and membrane breaking kit) was used for incubation at 4°C for 30 minutes, and the transcription factor and cytokine were stained respectively. After washing and resuspension, the flow cytometry analysis was performed, and the data was further analyzed by FlowJo software.

[0052] 4. ELISA experiment

[0053] LATS1-CKO mice and LATS1-WT mice after EAE induction were selected, and the spleen was taken to prepare a single cell suspension, and CD4 + T cells were sorted. 0.3-30 μg / ml pMOG peptide was added to the cell supernatant for 3 days, the supernatant was collected, and IL-4, IL-17, IL-10, and IFN-γ were detected according to the ELISA kit instructions.

[0054] 5. Western-blot experiment

[0055] LATS1-CKO mice and LATS1-WT mice were separated CD4 + T cells were collected after anti-CD3 / CD28 stimulation for 48 hours or Th17 polarization to prepare protein samples. The concentration of protein gel was selected as 7.5%, the electrophoresis condition was constant voltage 90v, 100min, the membrane transfer condition was constant current 300mA, 90min. After blocking with 5% milk (dissolved in 1xTBST solution) for 1 hour, the corresponding primary antibody diluent was added and incubated at 4°C overnight. After incubation, the cells were washed with 1xTBST solution, the corresponding secondary antibody diluent was added and incubated at room temperature for 1 hour, after incubation, the cells were washed with 1xTBST solution, and exposure and development were performed.

[0056] 6. shRNA in vitro knockdown of LATS1 and LATS2, in vitro induction of Th17 cell differentiation experiment

[0057] The LATS1 and LATS2 related shRNA sequences were cloned into the PLKO.1-U6-EGFP vector to obtain the LATS1 shRNA expressing retroviral vector and the LATS2 shRNA retroviral vector, respectively. The interference target sequence of LATS1 related shRNA is LATS1-SH3: GCATCGGAAGAAGCAGCTAGA (SEQ ID NO: 1),

[0058] The LATS1 related shRNA sequence is:

[0059] S: CCGGTCGCATCGGAAGAAGCAGCTAGATTCAAGAGAtctagctgcttcttccgatgc TTTTTG (SEQ ID NO: 2), A: AATTCAAAAAGCATCGGAAGAAGCAGCTAGATCTCTTGAAtctagctgcttcttccgatgc GA (SEQ ID NO: 3);

[0060] The interference target sequence of the LATS2 related shRNA sequence is:

[0061] LATS2-SH3: GCAGGTTCTTCGATGACAACG (SEQ ID NO: 4),

[0062] The LATS2 related shRNA sequence is:

[0063] S:

[0064] CCGGTCGCAGGTTCTTCGATGACAACGTTCAAGAGAcgttgtcatcgaagaacctgc TTTTG (SEQ ID NO: 5), A:

[0065] AATTCAAAAAGCAGGTTCTTCGATGACAACGTCTCTTGAAcgttgtcatcgaagaacctgc GA (SEQ ID NO: 6).

[0066] The constructed LATS1 shRNA retrovirus vector and LATS2 shRNA retrovirus vector were respectively transfected into 293T cells with a cell fusion density of 80% by Jet prime, and the virus supernatant was collected after 72 hours, filtered through a 0.45 μm filter membrane, and stored for use. At the same time, 6-week-old wild-type mice were selected, and single-cell suspensions were prepared from mouse lymph nodes and spleens, and sorted CD4 + T cells were activated with 2 μg / ml anti-CD3 / CD28 for 72 hours, and the prepared virus supernatant was used to infect T cells in the presence of 8 μg / ml polybrene, and the cells were centrifuged at 900g for 90 min at 30°C, and the cytokines for inducing Th17 polarization were added at the same time, and the cells were cultured for 3 days, and the cells were collected for flow cytometry analysis of Th17 cell differentiation.

[0067] 7. RNA extraction and RT-qPCR analysis

[0068] After extracting the sample RNA using the RNA rapid extraction kit (Fugene), cDNA was obtained by reverse transcription, and the premix was configured according to the ratio of SYBR 5 μl, sterile water 3 μl, cDNA 1 μl, primer F 0.5 μl, and primer R 0.5 μl per well, and then the machine was started. According to the Δct value analysis and processing.

[0069] 8. LATS1 / 2 inhibitor TRULI animal administration test

[0070] The C57 mice successfully induced the EAE model were divided into the administration group and the control group. The administration group was intraperitoneally injected with 200 μl of TRULI at a dose of 25 mg / kg per day on the 10th day of the onset, and the control group was intraperitoneally injected with the same volume of DMSO. The administration was continued to the 25th day, and the clinical score and body weight were recorded daily.

[0071] Conclusion

[0072] (1) EAE mouse CD4 + T cells after knocking out LATS1, the clinical score decreased, and the body weight increased.

[0073] The results showed that, compared with WT group mice, LATS1-CKO group mice had lower clinical scores ( Figure 1 A), and increased body weight ( Figure 1 B).

[0074] (2) CD4 + T cells after knocking out LATS1, the clinical score decreased, and the body weight increased.

[0075] The results showed that, under the observation of an optical microscope, it was found that, compared with WT group mice, LATS1-CKO group mice had reduced spinal cord inflammatory cell infiltration, reduced white matter demyelination area of the spinal cord, and reduced spinal cord immunopathological damage ( Figure 2 ).

[0076] (3) EAE mouse CD4 + T cells after knocking out LATS1, the CD4 + T cell infiltration of the central nervous system was significantly reduced ( Figure 3 ).

[0077] (4) EAE mouse CD4 + T cells after knocking out LATS1, the proportion of Th17 cells decreased.

[0078] The results showed that, compared with wild-type mice, the proportion of RORγt + cells in the CD4 + T cells infiltrating the central nervous system was significantly reduced, and the IL-17 +Cell proportion is reduced Figure 4 ).

[0079] The specific transcription factors and cytokines were detected at mRNA level by qPCR experiment, and the results showed that the mRNA levels of RORyt and IL-17A were significantly reduced after LATS1 deletion Figure 5 ).

[0080] After the spleen cells of LATS1 CKO mice and wild type mice were separated in vitro, the results showed that the secretion of IL-17 by CD4 + T cells was reduced after LATS1 knockout Figure 6 ).

[0081] LATS1 CKO mice and wild type mice CD4 + T cells were separated in vitro, and the results showed that the phosphorylation of STAT3 in CD4 + T cells was reduced after LATS1 protein knockout Figure 7 ).

[0082] LATS1 CKO mice and wild type mice CD4 + T cells were separated in vitro, and the results showed that the phosphorylation of STAT3 in Th17 cells was reduced after LATS1 protein knockout Figure 8 ).

[0083] (5) After knocking down LATS1 and LATS2 in CD4 + T cells, the proportion of Th17 cells was significantly reduced.

[0084] The results showed that the proportion of Th17 cells was reduced under the condition of inducing Th17 polarization after knocking down LATS1 protein in vitro by shRNA Figure 9 ).

[0085] The results showed that the proportion of Th17 cells was reduced under the condition of inducing Th17 polarization after knocking down LATS2 protein in vitro by shRNA Figure 10 ).

[0086] (6) LATS1 / 2 inhibitor improves the incidence of EAE.

[0087] The results showed that TRULI treatment significantly reduced the clinical score of MOG-induced EAE Figure 11 A), and also increased the body weight of miceFigure 11 B).

[0088] (7) LATS1 / 2 inhibitors inhibit CD4 + T cell differentiation to Th17 cells Figure 12 ).

[0089] Wild-type mice were isolated in vitro CD4 + T cells, anti-CD3 / CD28 activation and induction of Th17 polarization were detected by flow cytometry, and the results showed that the proportion of Th17 cells was reduced under TRULI stimulation.

Claims

1. Use of a functional inhibitor of LATS1 protein in the preparation of a drug for treating multiple sclerosis, characterized in that: The functional inhibitor of the protein is a shRNA that targets and knocks down or eliminates LATS1. The nucleotide sequences of the shRNA that targets and knocks down or eliminates LATS1 are shown in SEQ ID NO: 2 and SEQ ID NO:

3.

2. Use of a functional inhibitor of LATS1 protein in the preparation of a drug for inhibiting the progression of autoimmune encephalomyelitis, wherein the functional inhibitor of the protein is a shRNA that targets and knocks down or eliminates LATS1, and the nucleotide sequence of the shRNA that targets and knocks down or eliminates LATS1 is shown in SEQ ID NO: 2 and SEQ ID NO:

3.

3. The use according to claim 1, characterized in that: The drug is a drug that reduces the number of CD4+T cells and the proportion of Th17 cells infiltrating the central nervous system and inhibits the differentiation of Th17 cells.

4. The use according to claim 1, characterized in that: The drug is a drug that affects STAT3 phosphorylation in CD4+T cells and Th17 cells.

5. The use according to claim 1, characterized in that: The drug is a drug that inhibits the activity or expression level of LATS1 kinase and alleviates the symptoms of autoimmune encephalomyelitis.

Images