Probe for in vivo imaging and its preparation method and application

Abstract

The present invention provides a probe for in vivo imaging, its preparation method, and its application, relating to the field of molecular probes. The probe for in vivo imaging proposed by the present invention comprises: a fluorescent protein unit, a contrast agent unit, and a targeting unit; wherein the fluorescent protein unit, contrast agent unit, and targeting unit are connected by a linker. The probe proposed by the present invention is a novel magnetic resonance probe targeting PD-L1, capable of noninvasive and radiation-free molecular imaging, and has tumor therapeutic effects.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular probes, and in particular to a probe for in vivo living imaging, a preparation method thereof, and an application thereof. Background Art

[0002] To address the limitations of traditional immunohistochemistry methods, which cannot dynamically detect PD-L1 expression in real time and cannot accurately evaluate the efficacy of tumor immune checkpoint inhibitors early and accurately, researchers are exploring the use of non-invasive molecular imaging techniques to target PD-L1. The goal is to establish an accurate correlation between imaging signals, pathological features, and key drug target molecules, providing a fast, accurate, and sensitive molecular imaging tool for predicting the efficacy of tumor immunotherapy. Because molecular imaging techniques can accurately and comprehensively image molecular targets across the entire tumor, and can be repeatedly monitored in real time and dynamically, the in vivo detection of PD-L1 expression through targeted PD-L1 imaging has become a research hotspot.

[0003] Currently, the molecular imaging methods targeting PD-L1 mainly include PET / CT, SPECT and fluorescence imaging. Researchers often use PD-L1 antibody-labeled radionuclides to achieve targeted imaging of PD-L1. In addition, there is also technology that uses optical molecular imaging.

[0004] However, imaging methods such as SPECT and PET / CT have drawbacks such as radiation damage, expensive imaging panels, and low signal-to-noise ratios. Fluorescence imaging in the near-infrared window has strong auto-tissue absorption and is subject to interference from autofluorescence, which affects the quality and depth of imaging and makes it difficult to effectively assess therapeutic efficacy. Although studies have been conducted on fluorescent / NMR dual-mode probes targeting PD-L1, they still cannot achieve high sensitivity and specificity in reflecting the efficacy of tumor immunotherapy. Furthermore, these methods still have significant deficiencies in their ability to detect PD-L1 expression in vivo. Therefore, a new in vivo imaging probe is urgently needed to provide new ideas for non-invasive molecular imaging and treatment of tumors. Summary of the Invention

[0005] (1) Technical problems solved

[0006] In view of the shortcomings of the existing technology, the present invention provides a probe for in vivo imaging and a preparation method and application thereof, which at least solves one or more problems existing in the existing related technology.

[0007] (2) Technical solution

[0008] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0009] In a first aspect, the present invention provides a probe for in vivo imaging, the probe comprising: a fluorescent protein unit, a contrast agent unit, and a targeting unit;

[0010] The fluorescent protein unit, contrast agent unit, and targeting unit are connected via a linker.

[0011] In one embodiment, the linker comprises a flexible linker peptide.

[0012] In one embodiment, the flexible connecting peptide comprises (G4S) n , wherein n is any integer selected from 1 to 8. In one embodiment, n is 2.

[0013] In one embodiment, the fluorescent protein unit includes but is not limited to EGFP, mGFP5, D2EGFP, multi-color GFP variants, DsRed2, DsRed-express, mRFP1, mCherry, and Kaede.

[0014] In one embodiment, the contrast agent unit comprises a protein-based contrast agent.

[0015] In one embodiment, the protein-based contrast agent may be configured as a polypeptide that binds paramagnetic or superparamagnetic ions.

[0016] In one embodiment, the protein-based contrast agent is ProCA32.

[0017] In one embodiment, the paramagnetic or superparamagnetic ions include, but are not limited to, paramagnetic or superparamagnetic ions of Gd, Fe, Mn, Li, O, Na, Mg, Al, Mo, Sn, Ca, Co, Ni, Sr, Ru, Rh, Pd, Ba, Ce, Nd, Sm, Eu, Tb, Dy, Ho, Er, Tm, W, Os, In and Pt.

[0018] In one embodiment, the targeting unit is selected from a PD-L1 binding peptide.

[0019] In one embodiment, the PD-L1 binding peptide includes peptide CLP002.

[0020] In a second aspect, the present invention further provides a method for preparing the probe as described above, the method comprising:

[0021] (1) constructing a vector for expressing the fluorescent protein unit, contrast agent unit, and targeting unit;

[0022] (2) transforming the vector obtained above, expanding the culture, and inducing expression to obtain a bacterial solution containing the target protein;

[0023] (3) breaking the bacterial solution containing the target protein and further purifying it to obtain the target probe protein.

[0024] In one embodiment, in step (1), the sequences for expressing the contrast agent unit and the targeting unit are constructed into a prokaryotic expression vector containing a fluorescent protein unit sequence.

[0025] In one embodiment, the prokaryotic expression vector contains 6 histidine sequences as molecular tags.

[0026] In one embodiment, the CLP002-ProCA32 sequence is constructed into a prokaryotic expression vector containing EGFP and 6 histidine sequences to obtain a magnetic resonance probe EGFP-CLP002-ProCA32 vector.

[0027] In one embodiment, in step (2), the vector is a plasmid, and recombinant screening is performed after the plasmid is transformed.

[0028] In a third aspect, the present invention further proposes the use of the above-mentioned probe or the probe prepared according to the above-mentioned method in the preparation of drugs for treating tumors.

[0029] Furthermore, the above-mentioned tumor is selected from melanoma.

[0030] (3) Beneficial effects

[0031] The present invention provides a probe for in vivo imaging, its preparation method, and its application. Compared with the prior art, it has the following advantages:

[0032] The present invention proposes a probe for in vivo imaging, comprising a fluorescent protein unit, a contrast agent unit, and a targeting unit connected by a linker. This probe is a novel magnetic resonance probe targeting PD-L1. Compared to existing PET and near-infrared imaging, it is noninvasive and radiation-free, exhibits excellent biosafety, lacks significant biotoxicity, and exhibits superior tumor therapeutic efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 Schematic diagram of the construction of the EGFP-CLP002-ProCA32 probe vector in an embodiment of the present invention;

[0035] Figure 2Schematic diagram comparing the structures of the EGFP-CLP002-ProCA32 probe and the mutation probe vector in the embodiments of the present invention;

[0036] Figure 3 This is a sequence alignment diagram of the EGFP-CLP002-ProCA32 probe and the mutation probe in the examples of the present invention;

[0037] Figure 4 Immunofluorescence staining to detect probe binding to cell membrane PD-L1 protein experiment; Figure 4 Figures 4A, 4B, and 4C are experimental results of immunofluorescence staining detection probes binding to MCF7, B16-F10, and MDA-MB-231 cell mesangial PD-L1 proteins, respectively, according to the present invention. Figure 4 D is the quantification of green fluorescence intensity on the cell membranes of MCF7, B16-F10, and MDA-MB-231 cells;

[0038] Figure 5 This is the contrast effect of EGFP-CLP002-ProCA32 probe under magnetic resonance imaging; Figure 5 A is a schematic diagram of EGFP-CLP002-ProCA32 chelated with Gd in an embodiment of the present invention; Figure 5 B is a schematic diagram of the imaging effect of BEGFP-CLP002-ProCA32 and Gd-DTPA-BMA;

[0039] Figure 6 This is a schematic diagram of the toxicity test results of the EGFP-CLP002-ProCA32 probe on three types of cells in an embodiment of the present invention;

[0040] Figure 7 This is a graph showing the weight change trend of experimental mice after injection of EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group) in the examples of the present invention;

[0041] Figure 8 The results of liver and kidney index detection of C57BL / 6 mice on days 1, 7, and 21 after injection of EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group); Figure 8 a, 8b, 8c, 8d, 8e, and 8f are comparative graphs of the liver and kidney index test results of mice injected with EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group) in the examples of the present invention;

[0042] Figure 9 Schematic diagram of HE staining results of heart, liver, spleen, lung, and kidney tissues of mice after injection of EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group) in the examples of the present invention;

[0043] Figure 10 This is an in vivo fluorescence imaging experiment of the EGFP-CLP002-ProCA32 probe; Figure 10 A is a schematic diagram of in vivo fluorescence imaging of the EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group) before and after injection at different time periods in an embodiment of the present invention; Figure 10 B and 10C are quantified graphs of fluorescence intensity 0.5 h and 1 h after injection of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group) in the embodiment of the present invention, respectively;

[0044] Figure 11 The EGFP-CLP002-ProCA32 probe was used for magnetic resonance imaging. Figure 11 A, 11B, and 11C are grayscale and color images of the magnetic resonance imaging results of the PBS group, EGFP-ProCA32 group, and EGFP-CLP002-ProCA32 group at different time points before and after tail vein injection, respectively, in the embodiment of the present invention; Figure 11 D is the trend diagram of magnetic resonance signal enhancement in each group;

[0045] Figure 12 The in vivo anti-tumor efficacy of the EGFP-CLP002-ProCA32 molecular probe; Figure 12 (A) Schematic diagram of the treatment of B16-F10 tumor model; Figure 12 (B) is a graph showing the changing trend of tumor volume in different groups; Figure 12 (C) Analysis of tumor weight after treatment in different drug-dosing groups; Figure 12 (D) is the survival rate of mice in different drug groups after treatment; Figure 12 (E) Tumor sizes after treatment in different drug-dosing groups. DETAILED DESCRIPTION

[0046] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0047] The embodiments of the present application provide a probe for in vivo living imaging, a preparation method and an application thereof, thereby solving the problem in the prior art that molecular probes cannot be directly imaged in vivo, thereby achieving assistance.

[0048] The technical solution in the embodiments of the present application is to solve the above technical problems, and the overall idea is as follows:

[0049] In order to solve the problem that existing molecular probes cannot be directly used for non-invasive imaging in vivo, the technical solution of this application proposes a probe for in vivo imaging, exploring the imaging of PD-L1 targets in vitro and in vivo using a dual-modal molecular probe targeting PD-L1 under fluorescence and magnetic resonance imaging, providing a new idea for non-invasive in vivo imaging of tumors (such as melanoma), and thus providing a good basis for the diagnosis and treatment of tumors.

[0050] In order to better understand the above technical solution, the above technical solution will be described in detail below with reference to the accompanying drawings and specific implementation methods.

[0051] Example 1: EGFP-CLP002-ProCA32-6xHis plasmid construction

[0052] In this application, the CLP002-ProCA32 sequence was constructed into a prokaryotic expression vector containing EGFP and 6 histidine sequences by gene synthesis as an experimental vector. During the construction of the EGFP-CLP002-ProCA32-6xHis plasmid, pET-28a-EGFP was selected as the vector. Figure 1 As shown, EGFP-6His is a sequence vector, and 6-His tag is a molecular tag that can help the protein probe bind to the nickel column, thereby achieving the purpose of separating and purifying the protein probe.

[0053] After synthesis and optimization, the sequence of CLP002-ProCA32 is shown in SEQ ID NO: 1. The sequence of SEQ ID NO: 1 is as follows:

[0054] GGTGGTGGTGGCAGCGGTGGTGGTGGTAGTAGCGGTTGGCATCGTAGCT

[0055] ATTATACCTGGAATCTGAATACCGGCGGCGGCGGCAGTGGTGGTGGTGGAAG

[0056] TGGTGGCGGCGGCAGCGGTGGAGGTGGTAGTATGAGCATGACCGATCTGCTG

[0057] AGTGCAGAAGATATTAAGAAAGCAATTGGTGCCTTTACCGCAGCAGATAGCT

[0058] TTGATCATAAAAAATTTTTCCAGATGGTGGGTCTGAAAAAGAAAAGCGCAGA

[0059] TGATGTGAAAAAAGTTTTTCATATCCTGGATAAGGACAAAGATGGTTTTATTG

[0060] AAGAAGATGAACTGGGTAGCATTCTGAAAGGTTTTAGTAGCGATGCCCGTGA

[0061] TCTGAGCGCCAAAGAAACCAAAACCCTGATGGCAGCAGGTGACAAAGATGG

[0062] CGATGGCAAAATTGGTGTTGAAGAATGGAGTACCCTGGTTGCAGAAAGCCTC

[0063] GAG.

[0064] To verify whether the vector is successfully constructed, analysis can be performed by sequencing. Figure 2 , Figure 2 Schematic diagram of the construction of magnetic resonance probe and its mutants, where: Figure 2 (A) The EGFP-CLP002-ProCA32 vector connects green fluorescent protein (EGFP), CLP002 (PD-L1 inhibitory peptide), and ProCA32 (Gd ion binding domain). The linker consists of two flexible peptides with the sequence GGGGSGGGGS, and 6His is a His tag. Figure 2 (B) Mutation probe EGFP-ProCA32 was used to delete the CLP002 sequence by homologous recombination. Figure 3 , Sequence alignment of magnetic resonance probe EGFP-CLP002-ProCA32 and mutation probe. Figure 3 (A) is the sequence alignment of the magnetic resonance probe EGFP-CLP002-ProCA32; Figure 3 (B) Sequence alignment of mutant probe EGFP-ProCA32.

[0065] See also Figure 2-3 It can be seen that the constructed sequences of the two probes are consistent with the actual sequence alignment results, and no frameshift mutation has occurred in the sequences.

[0066] For plasmid transformation, pipette 1 μl of plasmid at a concentration of approximately 100 ng / μl into approximately 100 μl of competent cells. Place on ice for 30 minutes, incubate at 42°C in a water bath for 90 seconds, and then place on ice for approximately 3 minutes. Add 800 μl of 37°C pre-warmed LB (Luria-Bertani) medium to each tube and shake gently at 200 rpm at 37°C for 40 minutes. The LB medium recipe contains 5g yeast extract, 10g peptone, and 10g NaCl per 100ml.

[0067] After plasmid transformation, recombinant screening is performed: 100 μl of bacterial solution is spread on an agar plate containing kanamycin resistance, and the bacteria are gently spread on the surface of the plate with a sterile glass applicator. The plate is placed in a 37°C incubator and cultured for 15 minutes; invert the plate and culture it in a 37°C incubator for 12-16 hours until colonies appear.

[0068] Example 2: Preparation and purification of EGFP-CLP002-ProCA32 protein

[0069] 1. EGFP-CLP002-ProCA32 protein expression

[0070] In a sterile operating environment, the bacteria cultured in Example 1 above were inoculated into 100 ml of LB medium, and then 100 μl of 50 ng / μl of kanamycin was added, and the bacteria were amplified in a shaker at 37°C and 200 rpm overnight. The bacterial solution containing 100 ml of LB medium was transferred to a 2 L LB culture flask, and 800 μl of kanamycin was added and the amplification was continued in a shaker at 37°C and 200 rpm. After about 2 hours, induction was started when the OD600 of the bacterial solution reached 0.8. Before induction, the culture flask was placed in an ice-water mixture for 5 minutes. 200 μl of IPTG with a final concentration of 1 mM was added, and the induction was continued for 18-22 hours in a shaker at 16°C and 220 rpm, waiting for the expression of EGFP-CLP002-ProCA32 protein.

[0071] 2. Purification of EGFP-CLP002-ProCA32 Protein

[0072] Since the target protein EGFP-CLP002-ProCA32 expressed in E. coli using the prokaryotic expression vector pET-28a-EGFP-6xHis carries six His tags, the affinity between the His tags and the Ni column can be used to separate the target protein EGFP-CLP002-ProCA32 from other proteins. The specific process is as follows:

[0073] Collect the bacterial suspension and centrifuge at 5000 rpm for 10 minutes at room temperature to retain the bacterial pellet. Resuspend the suspension in pre-chilled buffer (250 mM NaCl, 20 mM Tris, pH 7.5) until no significant precipitation is observed. Disrupt the bacterial suspension by sonication in an ice-water mixture (pulse 0.2, 0.2, probe power 40%) for 15 minutes until the suspension is clear. Centrifuge at 12000 rpm for 30 minutes to separate the supernatant from the pellet and transfer the supernatant to the Ni column. Add 2 ml of NiCl2 to bind to the Ni matrix gel. Equilibrate with one column volume of binding buffer (250 mM NaCl, 20 mM Tris, pH 7.5). Add 50 ml of 20 mM imidazole, 250 mM NaCl, 20 mM Tris, pH 7.5 washing buffer to elute the contaminants, collect the eluate, then add 20 ml of 30 mM imidazole, 250 mM NaCl, 20 mM Tris, pH 7.5 washing buffer to thoroughly elute the contaminants until the Coomassie Brilliant Blue solution does not change color, collect the eluate. Elute the target protein with 15 ml of 500 ml of 20 mM imidazole, 250 mM NaCl, 20 mM Tris, pH 7.5 elution buffer until the Coomassie Brilliant Blue solution does not change color, collect the eluate again.

[0074] Example 3: Preparation and purification of EGFP-ProCA32 protein

[0075] In order to obtain the control protein for the experiment, the CLP002 sequence needs to be mutated in the original sequence (EGFP-CLP002-ProCA32).

[0076] 1. Construct the pET-28a-EGFP-ProCA32-6xHis vector. Ligate the processed target fragment to the vector via multi-segment recombination. The reaction system consists of 5 μl of purified PCR product, 5 μl of digested vector, 10 μl of seamless assembly MIX, and 20 μl of Total. Incubate the ligation solution at 52°C for 30 minutes.

[0077] 2. Clone the plasmid. During the PCR amplification process, add all the PCR system components to the PCR tube, centrifuge at low speed, centrifuge the liquid in the tube wall to the bottom of the tube, mix thoroughly, and place the tube into the PCR instrument, and work according to the set program. Finally, screen the positive clones using the bacterial liquid PCR method, inoculate the obtained positive bacterial liquid into LB medium, amplify at 37℃ overnight, and extract the plasmid for use.

[0078] The upstream primer sequence is shown in SEQ ID NO: 2, and the sequence of SEQ ID NO: 2 is as follows:

[0079] TCTCGGCATGGACGAGCTGTACAAGGGCGGCGGCGGCAGTGGTGGTGG TGGAAGTGGTGGC.

[0080] The downstream primer sequence is shown in SEQ ID NO: 3, and the sequence of SEQ ID NO: 3 is as follows:

[0081] AGCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCGAGGCTTTCTGCAACC AGGGTACTCCATTCT.

[0082] 3. Plasmid extraction: Extract the plasmid according to the instructions of the Omega kit, mark the plasmid that has been sequenced correctly, and freeze it in a -20℃ refrigerator for long-term storage.

[0083] 4. Expression and purification of EGFP-ProCA32 protein.

[0084] The expression and purification process of EGFP-ProCA32 protein is basically the same as that of EGFP-CLP002-ProCA32 protein. For details, please refer to the specific steps in Example 2, which will not be repeated here.

[0085] Example 4: Determination of the ability of the EGFP-CLP002-ProCA32 probe to specifically target PD-L1 at the cellular level

[0086] In this example, laser confocal microscopy was used to detect the ability of the EGFP-CLP002-ProCA32 probe to specifically target PD-L1 at the cellular level. The cell lines used in the study include the human breast cancer cell line MDA-MB-231, the mouse breast cancer cell line MCF7, and the mouse melanoma cell line B16-F10. Among them, MDA-MB-231 and B16-F10 are cell lines with high expression of PD-L1, and MCF7 is a cell line with low expression of PD-L1, which are used to explore the PD-L1 targeting ability of the magnetic resonance probe at the cellular level. MB-MDA-231, MCF-7, B16-F10, and cell lines all use DMEM high-glucose medium (containing 10% FBS serum and 1% double antibody) and are cultured at a constant temperature in a 37°C, 5% CO2 incubator. The specific steps for using laser confocal microscopy to detect the ability of the EGFP-CLP002-ProCA32 probe to specifically target PD-L1 at the cellular level are as follows:

[0087] Cell seeding: Cells cultured to 80% density were trypsinized for 1 minute and centrifuged at 800 g for 3 minutes. The appropriate number of cells was then seeded into a 12-well plate, with triplicate wells per group. Each well was pre-wetted with culture medium and a cell slide was added to allow the cells to adhere to the plate for subsequent observation.

[0088] Incubate the protein with the cells. Observe the cell status and density under a microscope. Once the cells have grown to an appropriate number, add 100 μl of fresh protein solution to each well and incubate in a 37°C, 5% CO2 incubator for 1.5 hours.

[0089] Fix the cells. Carefully discard the probe solution and wash three times with sterile PBS buffer, 5 minutes each wash. Fix with 1 ml of 4% paraformaldehyde solution for 20 minutes. Wash the paraformaldehyde solution three times with PBS buffer, 2 minutes each wash.

[0090] Nuclear staining: Add 300 μl of DAPI staining solution to each well and stain for 10 minutes. Wash twice with sterile PBS buffer, each time for 5 minutes.

[0091] Cell patching and sealing: Add 20 μl of anti-fluorescence quencher to the slide, avoiding bubbles. Carefully remove the cell slide with tweezers and tilt it 45° onto the slide. Seal the slide with nail polish and air-dry in the dark.

[0092] Use a laser confocal microscope to capture the images. Adjust the confocal microscope parameters to ensure consistency, capture the signals from each fluorescence channel separately, and merge them for data analysis.

[0093] The specific targeting detection results of EGFP-CLP002-ProCA32 probe on PD-L1 at the in vitro and cellular levels are as follows Figure 4 As shown. Among them, Figure 4 (A) Representative images of MCF7 cells, with the first row incubated with the experimental probe and the second row incubated with the control probe. From left to right: blue fluorescence: DAPI staining of the cell nucleus; green fluorescence: probe binding to cell membrane PD-L1; Merge: merging of the two channels. Figure 4 (B) represents B16-F10 cells incubated with experimental probes in the first row and control probes in the second row. From left to right: blue fluorescence: DAPI staining of cell nuclei; green fluorescence: probe binding to cell membrane PD-L1; Merge: merging of the two channels. Figure 4 (C) Representative images of MDA-MB-231 cells, with the first row incubated with the experimental probe and the second row incubated with the control probe. From left to right: blue fluorescence: DAPI staining of the cell nucleus; green fluorescence: probe binding to cell membrane PD-L1; Merge: merging of the two channels. Figure 4(D) Specific quantification of green fluorescence intensity on three cell membranes.

[0094] See also Figure 4 (AC) As can be seen, after incubation of EGFP-CLP002-ProCA32 with MDA-MB-231 and B16-F10, two cell lines with high PD-L1 expression, strong green fluorescence was observed on the cell membrane surface. After incubation with MCF7, the green fluorescence was weaker. This shows that EGFP-CLP002-ProCA32 can bind to cell lines expressing PD-L1 protein, and the intensity of fluorescence is positively correlated with the expression level of PD-L1. The fluorescence intensity of the mutant EGFP--ProCA32 group is negligible compared with that of each experimental group. This indicates that EGFP-CLP002-ProCA32 specifically binds to PD-L1 on the cell membrane.

[0095] See also Figure 4 (D) Analysis of the fluorescence intensity of cells using Image J software showed that the PD-L1 protein expression in the B16-F10 cell line was significantly different from that in MCF7 (P < 0.0001). The PD-L1 protein expression level in the MDA-MB-231 cell line was also significantly different from that in MCF7 (P < 0.0001).

[0096] In summary, among the three cell lines, the B16-F10 cell line had the highest expression of PD-L1 protein. This experimental result was consistent with the results of protein immunoblotting, indicating that it is feasible to construct a subsequent in vivo tumor model using the B16-F10 cell line in this example.

[0097] Example 5: Determination of the ability of the EGFP-CLP002-ProCA32 probe to bind to lanthanide metal gadolinium in vitro

[0098] The EGFP-CLP002-ProCA32 probe was bound to the lanthanide metal gadolinium (Gd) by dialysis. The specific process is as follows:

[0099] Obtain a Gd-bound magnetic resonance probe. Add the purified magnetic resonance probe to a dialysis bag and clamp it with a clamp. Immerse the dialysis bag in a dialysis solution with a final concentration of 1 mM GdCl3 (its concentration is much higher than the concentration of the magnetic resonance probe to ensure sufficient binding) and dialyze overnight until the solution is in equilibrium; wherein, the dialysis buffer formula is 250 mM NaCl, 20 mM Tris (pH = 7.5). Dialyze at least three times with a dialysis buffer that does not contain GdCl3, with a single dialysis time of more than 5 hours, to remove unbound Gd ions in the protein solution. Collect the probe after binding to Gd, and use one drop to detect the concentration of the magnetic resonance probe for subsequent experiments.

[0100] The specific detection results of EGFP-CLP002-ProCA32 probe binding to Gd are shown in Figure 5 shown. Figure 5 This is the MRI effect of EGFP-CLP002-ProCA32 probe. Figure 5 (A) Schematic diagram showing the EGFP-CLP002-ProCA32 probe chelating Gd ions. The schematic diagram shows that the probe chelates Gd ions through the ProCA32 domain, and one probe molecule can chelate two Gd ions. Figure 5 (B) is the imaging effect of EGFP-CLP002-ProCA32 and Gd-DTPA-BMA. Figure 5 As shown in (B), under MR T1 sequence scanning, the probe and Gd-DTPA-BMA have similar contrast effects under magnetic resonance imaging. Notably, the probe and Gd-DTPA-BMA exhibit the best brightness at a concentration of 0.6 mM.

[0101] Because Gd is a paramagnetic material, it is often used as a contrast agent in magnetic resonance imaging to enhance image contrast. However, free Gd ions are toxic to living organisms. Gd ions bound to biomaterials can significantly reduce their own toxicity while also enhancing image contrast.

[0102] Here, the cytotoxicity of the EGFP-CLP002-ProCA32 probe was investigated. Six different concentrations (100 μg / ml, 50 μg / ml, 25 μg / ml, 12.5 μg / ml, 6.25 μg / ml, 3.125 μg / ml, and 0 μg / ml as a control) of the probe were used to incubate three different cell lines. The cell survival rate was measured after 24 hours. The experimental results are as follows: Figure 6 As shown, Figure 6 The figure is a schematic diagram of the cytotoxicity test results of the EGFP-CLP002-ProCA32 probe, wherein the blue bar represents the incubation of EGFP-CLP002-ProCA32 with MCF7, the red bar represents the incubation of EGFP-CLP002-ProCA32 with B16-F10, and the green bar represents the incubation of EGFP-CLP002-ProCA32 with MDA-MB-231 cell line. Figure 6 The probe showed no cytotoxicity to any of the three cell lines, and even at a high concentration of 100 μg / ml, the cell viability remained above 90%, demonstrating that the EGFP-CLP002-ProCA32 probe has high biosafety at the cellular level.

[0103] Example 6: In vitro nuclear magnetic resonance imaging detection using a magnetic resonance probe

[0104] After obtaining the freshly prepared magnetic resonance probe, you can perform magnetic resonance imaging experiments. The specific steps are as follows:

[0105] Perform a gradient dilution of the T1Gd-DTPA-BMA contrast agent (500 mM) and the measured protein concentration to 0.6 mM, 0.3 mM, 0.15 mM, 0.075 mM, and 0.0375 mM, respectively. The diluted samples were placed in PCR tubes. The samples were arranged sequentially according to the gradient concentration, with water films placed on both sides. The appropriate coil was selected. The 3-PI Loc CRE sequence was selected for contour acquisition, followed by the T1SE sequence for acquisition, and the acquired data was saved.

[0106] Example 7: Safety testing of EGFP-CLP002-ProCA32 probe at the cellular level

[0107] Cultured human breast cancer cell line MDA-MB-231, murine breast cancer cell line MCF7, and murine melanoma cell line B16-F10 were seeded into 96-well plates, with 5,000 cells per well, in triplicate. After 8 hours of culture, 200 μl of probe solution at varying concentrations was added and incubated for 24 hours. Cell morphology and growth were observed, and cell numbers and survival rates were calculated.

[0108] Example 8: In vivo safety testing of EGFP-CLP002-ProCA32 magnetic resonance probe

[0109] Twenty female C57 / BL6 mice were randomly divided into four groups of five. Three experimental groups were administered a probe dose of 10 mg / kg via tail vein injection (200 μl), while the control group received an equal volume of PBS. Various indices of the mice were measured on days 1, 7, and 21 after injection.

[0110] 1. Mouse weight monitoring: Monitor the weight change trend of mice every 2 days, record the weight data of mice, and observe the mice's mental state, eating and drinking habits, and activity.

[0111] 2. Blood biochemical analysis. Blood was collected from the mouse eyeballs on days 1, 7, and 21 after probe injection. The mouse eyeballs were removed with forceps and the remaining blood sample was collected in a 1.5ml EP tube. The sample was allowed to stand at room temperature for 15 minutes and then centrifuged in a pre-cooled high-speed centrifuge at 3000 rpm at 4°C for 15 minutes. The centrifuged blood sample was removed, avoiding shaking, and the supernatant serum was carefully pipetted into a clean 1.5ml EP tube. The sample was used for analysis of blood biochemical indicators to assess whether liver and kidney function in the mouse was damaged after probe injection.

[0112] 3. HE staining to detect organ histological changes. Mice were sacrificed on the 1st, 7th, and 21st day after probe injection, and the heart, liver, spleen, lungs, and kidneys were isolated. HE staining was performed to observe whether there were significant changes in the morphology of each tissue. The specific process was as follows:

[0113] The removed organ tissues were soaked in 4% paraformaldehyde (PFA) overnight, sliced ​​with a microtome, and baked in a drying oven at 66°C for 20 minutes. The slices were soaked in xylene three times for 5 minutes each. The slices were soaked in ethanol in a high-low concentration gradient (100%-95%-80%) for 3 minutes each. The slices were washed with water until clean and transparent. Hematoxylin was added to the slices and stained for 5 minutes, then washed. The slices were differentiated with 1% hydrochloric acid alcohol for a few seconds and then washed. They were bluing with saturated lithium carbonate solution and then washed. Dehydrated with 95% ethanol for 2 minutes. The slices were stained with eosin solution for a few seconds and then washed. They were then passed through two layers of 95% and 100% ethanol. The slices were transparentized in cresol-xylene, xylene I, and III for two minutes each. The sealed slices were then observed under a microscope.

[0114] When testing the safety of EGFP-CLP002-ProCA32 magnetic resonance probe in vivo, the experiment continuously monitored the weight changes of mice 14 days after the probe and the control group PBS injection. The results are as follows Figure 7 shown. Figure 7 The figure shows the weight change trend of C57BL / 6 mice after injection of EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group). The weight of mice was monitored every two days. Figure 7 It can be seen that there was no significant change in the body weight of the two groups of mice within two weeks.

[0115] In addition, the liver and kidney functions of mice after probe injection were evaluated, and the evaluation results were as follows: Figure 8 shown. Figure 8 The figure shows the results of liver and kidney index detection on the 1st, 7th and 21st day after injection of EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group) in C57BL / 6 mice. Figure 8 (af) respectively show the change diagrams of ALT, AST, AKP, Y-GT, BUN and CRE indicators. Figure 8 It can be seen that the probe has no significant toxicity to the liver and kidneys of mice.

[0116] Furthermore, HE staining of the main organs of the mice, including heart, liver, spleen, lung, and kidney, was performed 1, 7, and 21 days after the probe injection to observe the organ damage of the mice. The results are as follows: Figure 9 shown. Figure 9The HE staining results of the heart, liver, spleen, lung, and kidney tissues of C57BL / 6 mice on days 1, 7, and 21 after injection of the EGFP-CLP002-ProCA32 probe (experimental group) and PBS (control group) are shown in the figure. The scale bar is 100 μm. Figure 9 It can be seen that the organ slices of mice injected 1, 7, and 21 days after injection were structurally intact, with no obvious pathological damage, and no significant changes compared with the control group. This indicates that the molecular probe has no obvious acute or medium- to long-term toxicity to mice.

[0117] The above results show that the EGFP-CLP002-ProCA3 molecular probe has good biocompatibility and can be used in subsequent animal imaging and treatment experiments.

[0118] Example 9: In vivo fluorescence imaging detection of the B16-F10 tumor model using the EGFP-CLP002-ProCA32 probe

[0119] In the present examples, the experimental mice were C57 / BL6, female, 6-8 weeks old, and a B16-F10 tumor mouse model was established in these mice. After the B16-F10 tumor mice developed tumors, the EGFP-CLP002-ProCA32 probe was used to detect in vivo fluorescence imaging of the B16-F10 tumor model. The specific detection process and steps are as follows:

[0120] Mice bearing established B16-F10 tumors were randomly divided into two groups: a control group of two mice and an experimental group of three mice. Mice were anesthetized with isoflurane, with the anesthesia machine parameters set to an induction concentration of 2 and an airflow rate of 0.5. After anesthesia, pre-injection imaging was performed, using an excitation wavelength of 465nm-520nm and region D. Mice in the experimental group were injected with a 14mg / kg dose of EGFP-CLP002-ProCA32 probe solution; mice in the control group were injected with an equivalent dose of EGFP-ProCA32 protein solution (non-targeted). In vivo fluorescence imaging data were collected at 0.5h, 1h, 1.5h, 2h, 3h, and 4h after injection. Fluorescence imaging data were saved, and regions of interest (ROIs) were circled using in vivo fluorescence imaging analysis software. The mean fluorescence intensity of each ROI was calculated and quantitatively analyzed.

[0121] When the EGFP-CLP002-ProCA32 probe was used for in vivo fluorescence imaging of the B16-F10 tumor model, the EGFP-CLP002-ProCA32 probe was injected into the experimental group mice through the tail vein, and the mutant probe with the same concentration was injected into the mice through the tail vein as the control group. Fluorescence intensity images of the tumor area were collected at different time points. The results are shown in Figure 2. Figure 10 As shown, Figure 10This is a diagram of the in vivo fluorescence imaging experiment of the EGFP-CLP002-ProCA32 probe, where: Figure 10 (A) In vivo fluorescence imaging of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group) before injection and 0.5h, 1h, 1.5h, 2h, and 4h after injection. White circles represent tumor areas. Figure 10 (B) is a graph showing the changes in fluorescence intensity during the experiments with EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group). Figure 10 (C) Quantification of fluorescence intensity of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group) at 0.5 h after injection. Figure 10 (D) Quantification of fluorescence intensity 1 h after injection of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group). Figure 10 (E) Quantification of fluorescence intensity 1.5 h after injection of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group). Figure 10 (F) Quantification of fluorescence intensity 2 h after injection of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group). Figure 10 (G) Quantification of fluorescence intensity 4 h after injection of EGFP-CLP002-ProCA32 probe (experimental group) and EGFP-ProCA32 (control group).

[0122] See also Figure 10 It can be seen that within 1 hour, the fluorescence intensity of the tumor area of ​​the experimental group mice increased with time, and then the fluorescence intensity weakened, while the fluorescence intensity of the control group did not change significantly; within 0.5h-3h, there was a significant statistical difference in the fluorescence intensity of the tumor area of ​​the experimental group mice and the fluorescence intensity of the tumor area of ​​the control group mice (p<0.01).

[0123] Experiments have shown that the EGFP-CLP002-ProCA32 probe has the ability to aggregate to tumor areas in vivo, and this aggregation process can be visualized through fluorescence intensity analysis. In vivo experimental results show that the EGFP-CLP002-ProCA32 probe can target PD-L1 in vivo and can be used as a fluorescent probe targeting PD-L1 in vivo.

[0124] Example 10: Application of EGFP-CLP002-ProCA32 probe in in vivo magnetic resonance imaging of B16-F10 tumor model

[0125] The process and steps for testing the EGFP-CLP002-ProCA32 probe for in vivo MRI of the B16-F10 tumor model are as follows:

[0126] Tumor-bearing mice were randomly divided into three groups of three. The experimental group received an injection of 14 mg / kg of the EGFP-CLP002-ProCA32 probe solution. Two control groups received the same dose: a PBS blank control group and a negative control group of EGFP-ProCA32. Preparations were completed by installing the mouse restraint device, positioning two water membranes, and adjusting the MRI machine to the appropriate position. Mice were anesthetized with isoflurane at an induction concentration of 2 and an airflow rate of 0.5. For prolonged anesthesia, the airflow rate was adjusted to 0.3-0.4.

[0127] Expose the tumor site of the mouse, collect images before injection, and select the sequence

[0128] 3-PI Loc CRE1: Specific parameters are: Slices 3, Fov Read 200mm, Fov Phase 100%, Slice Thickness 6mm, TR: 8.3ms, TE: 3.69ms, Average: 1;

[0129] 3-PILoc CRE2: Specific parameters are: Slices 18, Fov Read 36mm, Fov Phase 100%, Slice Thickness 1.1mm, TR: 3700ms, TE: 96ms, Average: 1;

[0130] T2-TSE-TRA-256: Specific parameters are: Slices 32, Fov Read 59mm, Fov Phase 50%, Slice Thickness 0.7mm, TR: 800ms, TE: 16ms, Average: 1;

[0131] T1SE-TRA-HIGHRE-384: Specific parameters are: Slices 32, Fov Read 59mm, Fov Phase 50%, Slice Thickness 0.7mm, TR: 800ms, TE: 16ms, Average: 1;

[0132] Determine the positioning phase, frame the area where the tumor is located, and scan the approximate range. Refine the location of the tumor area, click the OK button, and scan in the sequence of T2-TSE-TRA-256 and T1SE-TRA-HIGHRE-384. Save and copy the magnetic resonance data, and use the MRI tool to organize the images. The process is to organize Dicom—copy the folder—read dicom—batch read dicom—apply the window function—open the image with the graphic tool. Use 3D slicer to analyze the image: name the image to be analyzed in nii format—align the image: select 0.02 for Percent of samples, select 12 for affine, apply for alignment, and if the alignment criteria cannot be achieved, manually circle the ROI for analysis. Use MATLAB to run the written program, select the appropriate path—read the file—get the average value of the ROI area—further analyze and process the image.

[0133] In order to test whether EGFP-CLP002-ProCA32 has good targeting and aggregation in vivo, magnetic resonance imaging was used for further verification. First, a B16-F10 melanoma tumor model was established using C57BL / 6 mice. When the tumor volume reached approximately 300 mm3, the model mice were used for magnetic resonance imaging observation. The test results are shown in Figure 2. Figure 11 shown. Figure 11 The figure shows the experimental results of EGFP-CLP002-ProCA32 probe in magnetic resonance imaging.

[0134] Figure 11 (A) MRI grayscale and color images of the PBS group before and after 0.5 h and 1 h after tail vein injection. The red arrows indicate the tumor area. Figure 11 (B) Magnetic resonance imaging grayscale and color images of the EGFP-ProCA32 group before and after tail vein injection, 0.5 h and 1 h later. Figure 11 (C) Magnetic resonance imaging (MRI) grayscale and color images of the EGFP-CLP002-ProCA32 group 0.5 h and 1 h before and after tail vein injection. Figure 11 (D) Statistics and quantification of the percentage of MRI signal enhancement in each group.

[0135] Through analysis, we can know that Figure 11 In (A), there was no significant change in the MRI grayscale image and color image within 1 hour before and after the injection of PBS (blank group). Figure 11(B) and (D) show that the magnetic resonance intensity of the EGFP-ProCA32 group (control group) showed an increasing trend after injection, but the increase rate of the magnetic resonance signal was smaller than that of the experimental group, about 10%. This was due to the nonspecific binding of Gd-EGFP-ProCA32, which further verified that the ProCA32 domain can bind to Gd and remain stable in the mouse body environment. Figure 11 As shown in (C) and (D), the magnetic resonance signal of Gd-EGFP-CLP002-ProCA32 also showed an increasing trend, with the rate of increase being approximately 35%, indicating that Gd-EGFP-CLP002-ProCA32 can specifically bind to tumor PD-L1 in vivo. Gd-EGFP-CLP002-ProCA32 showed good aggregation at 0.5 hours and substantial aggregation at 1 hour, demonstrating a significant effect.

[0136] above Figure 11 The corresponding experimental results overall show that Gd-EGFP-CLP002-ProCA32 can specifically target tumor PD-L1 in vivo and has good magnetic resonance imaging effects. It is expected to become a new magnetic resonance imaging contrast agent targeting PD-L1, providing a good basis for tumor diagnosis.

[0137] Example 11: EGFP-CLP002-ProCA32 molecular probe for the treatment of B16-F10 melanoma model

[0138] A B16-F10 melanoma tumor model was established in C57BL6 / mice. The experiment was divided into three groups, with six mice in each group. The experimental group was injected with 14 mg / kg of the EGFP-CLP002-ProCA32 probe solution. Two control groups were injected with the same dose of EGFP-ProCA32: a PBS blank control group and a negative control group.

[0139] in, Figure 12 (A) Schematic diagram of in vivo probe therapy. Mice were treated with the drug 8 days after inoculation with B16-F10 cells, with daily injections. Treatment ended on day 18. Tumor size was monitored every two days during this period, and mice were sacrificed when tumor size exceeded 1000 mm3. Figure 12 (B) shows that the growth rate of mouse tumor volume slowed down after EGFP-CLP002-ProCA3 drug treatment compared with the control probe and PBS. There was a significant difference compared with the EGFP-ProCA32 group (p<0.01); there was a very significant difference compared with the PBS group (p<0.001). After the mice were sacrificed, the tumor tissue was removed and weighed. Figure 12As shown in (C), the tumor weight of the EGFP-CLP002-ProCA32 molecular probe group was significantly different from that of the EGFP-ProCA32 group and PBS group (p<0.0001), indicating that the EGFP-CLP002-ProCA32 molecular probe can inhibit the growth of melanoma. Figure 12 (D) shows the tumor size of mice 15 days after treatment. The PBS group had the largest tumor size, followed by the EGFP-ProCA32 group, and the smallest tumor size was in the EGFP-CLP002-ProCA32 group. Figure 12 As shown in (E), the EGFP-CLP002-ProCA32 group prolonged the survival rate of mice compared to the control group. This difference was highly significant compared to the PBS group (p<0.001). These results indicate that EGFP-CLP002-ProCA32 can slow the growth of B16-F10 melanoma cells and has a certain anti-tumor effect.

[0140] In summary, compared with the existing technology, the present invention has the following beneficial effects:

[0141] 1. The present invention proposes a probe for in vivo imaging, comprising a fluorescent protein unit, a contrast agent unit, and a targeting unit connected by a linker. The probe for in vivo imaging proposed by the present invention is a novel magnetic resonance probe targeting PD-L1. Compared with existing PET imaging and near-infrared imaging, it is non-invasive and radiation-free, has good biosafety, no significant biotoxicity, and has a good tumor treatment effect.

[0142] 2. The present invention proposes a probe for in vivo imaging, which has a targeting unit including CLP002, so that the probe for in vivo imaging of the present invention can specifically target tumor PD-L1 in vivo.

[0143] 3. The present invention proposes a probe for in vivo imaging, which has a contrast agent unit including a chelated Gd ion and has a good magnetic resonance imaging effect. It can become a new magnetic resonance contrast agent targeting PD-L1, providing a good basis for tumor diagnosis.

[0144] 4. The present invention proposes a probe for in vivo imaging, which has a tumor therapeutic effect and provides a new idea for tumor treatment.

[0145] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply the existence of any such actual relationship or order between these entities or operations. Moreover, the terms "comprise", "include" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "comprises a ..." does not exclude the presence of other identical elements in the process, method, article or device comprising the element.

[0146] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A probe for in vivo imaging, characterized in that The probe comprises: a fluorescent protein unit, a contrast agent unit, and a targeting unit; the fluorescent protein unit, the contrast agent unit, and the targeting unit are connected by a linker; the contrast agent unit comprises a protein-based contrast agent; The fluorescent protein unit is selected from EGFP; the contrast agent unit and the targeting unit are connected by a linker to form a whole nucleic acid sequence of CLP002-ProCA32, and the CLP002-ProCA32 sequence is shown in SEQ ID NO:

1.

2. The probe according to claim 1, wherein The protein-based contrast agents may be formulated as polypeptides that bind paramagnetic or superparamagnetic ions.

3. The probe according to claim 2, wherein The paramagnetic or superparamagnetic ions are selected from paramagnetic or superparamagnetic ions of Gd.

4. A method for preparing the probe according to claim 1, characterized in that: The method comprises: (1) constructing a vector for expressing the fluorescent protein unit, contrast agent unit, and targeting unit; (2) Transforming, expanding, and inducing the expression of the vector obtained above to obtain a bacterial solution containing the target protein; (3) The bacterial solution containing the target protein is broken and further purified to obtain the target probe.

5. Use of the probe according to any one of claims 1 to 3 or the probe prepared according to claim 4 in the preparation of a drug for treating tumors; the tumor is selected from melanoma.

Images