A cotton fiber length-related gene, GhMYS1, and its application.
By providing the cotton fiber length-related gene GhMYS1 and its application, and using genetic engineering and the CRISPR/Cas9-sgRNA editing system to regulate cotton fiber length, the problem of poor cotton fiber quality in existing technologies has been solved, and high-quality long-fiber cotton has been obtained.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-10
- Publication Date
- 2026-03-13
AI Technical Summary
Current technologies have failed to effectively elucidate the function of the GLK gene in cotton fiber development, resulting in poor cotton fiber quality that cannot meet the market demand for high-quality cotton.
This study provides information on the cotton fiber length-related gene GhMYS1 and its applications. By regulating the expression level of the GhMYS1 gene or protein, the length of cotton fibers can be altered using genetic engineering and the CRISPR/Cas9-sgRNA editing system.
It has enabled effective control over cotton fiber length, resulting in high-quality long-fiber cotton varieties that meet the demand for differentiated products.
Smart Images

Figure CN118773204B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a cotton fiber length-related gene GhMYS1 and its application. Background Technology
[0002] Cotton is a crucial raw material for the textile, chemical, pharmaceutical, and defense industries, with an industrial output value reaching hundreds of billions of US dollars, holding a pivotal position in my country's national economy. Cotton fiber quality is a key indicator determining yarn quality, primarily manifested in short fibers, low fiber strength, and high micronaire values, failing to meet market demand for high-quality cotton. Further improving fiber quality is of great significance for enhancing my country's competitiveness in the international cotton market, ensuring my country's cotton security, and promoting the sustainable development of my country's cotton industry.
[0003] GLK (Golden 2-like) transcription factors belong to the GARP superfamily. GLK was first discovered in the C4 plant maize. ZmGLK1 and ZmGLK2 are a pair of homologous genes with essentially the same function, expressed in mesophyll cells and bundle sheath cells, respectively, and are speculated to be related to the structural and functional differentiation of C4 chloroplasts. In the C3 plants Arabidopsis thaliana and rice, GLK1 and GLK2 exhibit significant functional redundancy in regulating chlorophyll synthesis and photosynthetic organ development. Besides participating in chloroplast formation and development, GLK also participates in plant defense responses to various biotic and abiotic stresses. A total of 146 GLK family transcription factors have been identified in cotton. Except for GhGLK1, which has been reported to be involved in cotton's tolerance to drought and cold stress, the functions of most GLK transcription factors in cotton, especially in fiber development, have not been reported, and their molecular mechanisms regulating fiber development remain unclear. Therefore, elucidating the biological functions of GLK genes and their genetic networks regulating fiber development is of great significance. Summary of the Invention
[0004] The purpose of this invention is to overcome at least one deficiency of the prior art and to provide a cotton fiber length-related gene GhM YS1 and its application.
[0005] Another object of the present invention is to provide a method for changing the length of cotton fibers.
[0006] The technical solution adopted in this invention is:
[0007] The cotton fiber length-related gene GhMYS1, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0008] The cotton fiber length regulating protein GhMYS1, the amino acid sequence of which is shown in SEQ ID NO:2.
[0009] The application of the GhMYS1 gene in regulating cotton fiber length, the nucleotide sequence of which is shown in SEQ ID NO:1.
[0010] In some embodiments of the present invention, the amplification primers for the GhMYS1 gene include SEQ ID NO:3 and / or SEQ ID NO:4.
[0011] The application of GhMYS1 protein in regulating cotton fiber length, wherein the amino acid sequence of GhMYS1 protein is shown in SEQ ID NO:2.
[0012] A method for altering cotton fiber length, the method comprising altering the expression level of the GhMYS1 gene in cotton, and / or altering the expression level of the GhMYS1 protein in cotton, wherein the nucleotide sequence of the GhMYS1 gene is shown in SEQ ID NO:1, and the amino acid sequence of the GhMYS1 protein is shown in SEQ ID NO:2.
[0013] The changes include, but are not limited to, increasing or decreasing. Those skilled in the art can adjust the expression levels of the GhMYS1 gene or GhMYS1 protein in cotton to obtain cotton varieties with fibers of different lengths, thus meeting the needs of differentiated products.
[0014] In some embodiments of the present invention, a method for increasing cotton fiber length is provided, wherein the method increases the expression level of the GhMYS1 gene in cotton, and / or the method increases the expression level of the GhMYS1 protein in cotton, wherein the nucleotide sequence of the GhMYS1 gene is shown in SEQ ID NO:1, and the amino acid sequence of the GhMYS1 protein is shown in SEQ ID NO:2.
[0015] In some embodiments of the present invention, the method utilizes genetic engineering methods.
[0016] An expression suppression vector, wherein the vector is a virus-mediated gene silencing vector, and the vector contains the gene described above.
[0017] An expression vector for a CRISPR / Cas9-sgRNA editing system, wherein the expression vector contains the aforementioned gene GhMYS1.
[0018] In some embodiments of the present invention, the expression vector is an Agrobacterium-mediated gene editing vector.
[0019] The beneficial effects of this invention are:
[0020] This invention provides a cotton gene GhMYS1, which contains a typical Myb_DNA domain, is a member of the GLK transcription factor family, and has a positive regulatory effect on cotton fiber length.
[0021] This study found that the expression levels of the GhMYS1 gene in the standard genetic reference line TM-1 and the long-fiber cultivar J02 of upland cotton were 11.3 and 14.2 after 15 days of fiber development, respectively, which were significantly higher than those in the wild cotton material TX2094 and the short-fiber cultivar ZRI015 (5.0 and 3.9, respectively, t.test, P-value = 0.002812 and 0.00043). This fully demonstrates that the GhMYS1 gene has a positive regulatory effect on cotton fiber length.
[0022] Technicians in this industry can obtain high-quality long-fiber cotton varieties by adjusting the content (or expression level) of the GhMYS1 gene or GhMYS1 protein in cotton, thus meeting the needs of differentiated products.
[0023] This invention constructed a viral silencing vector and a gene editing vector for GhMYS1. The results showed that GhMYS1 positively regulates the fiber length of cotton, meaning that GhMYS1 plays a very important role in the fiber length of cotton. Attached Figure Description
[0024] Figure 1 Phylogenetic tree analysis of the GhMYS1 gene.
[0025] Figure 2 This is a multiple sequence alignment analysis of GhMYS1. GhMYS1 contains a typical Myb_DNA domain.
[0026] Figure 3 Analysis of the expression pattern of GhMYS1 gene in materials with different fiber lengths.
[0027] Figure A shows the expression pattern analysis in wild and domesticated cotton fibers; Figure B shows the expression pattern analysis in long fiber variety J02 and short fiber variety ZRI015 fibers.
[0028] Figure 4 The fiber phenotype of plants with silenced GhMYS1 gene.
[0029] Figure A shows the expression analysis of GhMYS1 in pCLCrVA:GhMYS1 and pCLCrVA:00; Figure B shows the fiber length measurement results of cotton plants with pCLCrVA:GhMYS1 and pCLCrVA:00; Figure C shows the fiber phenotype of cotton plants with pCLCrVA:GhMYS1 and pCLCrVA:00.
[0030] Figure 5The fiber phenotype of transgenic cotton plants with GhMYS1 gene knockout.
[0031] Figure A shows the analysis of GhMYS1 gene editing types;
[0032] Figure B shows the fiber length measurement results of cotton plants edited with the GhMYS1 gene.
[0033] Figure C shows the fiber phenotype of cotton plants edited with the GhMYS1 gene. Detailed Implementation
[0034] The embodiments of the present invention will be described in detail below with reference to examples. However, those skilled in the art will understand that the following examples are only for illustrating the present invention and should not be regarded as limiting the scope of the present invention.
[0035] The cotton varieties involved in the embodiments include:
[0036] Wild cotton variety TX2094, upland cotton standard genetic reference line TM-1, long fiber cultivar J02, short fiber cultivar ZRI015, and cotton variety Jin668 used for transgenic purposes.
[0037] Example 1: Cloning of the GhMYS1 gene
[0038] Fiber RNA was extracted from the upland cotton standard genetic reference line TM-1 15 days after flowering and reverse transcribed into cDNA. Using this cDNA as a template, primers were designed based on the CDS sequence of GhMYS1 to clone the cDNA sequence of GhMYS1.
[0039] The primers required for cloning are as follows:
[0040] GhMYS1-F: ATGGCAAGTGATGATAACCTTTGA (SEQ ID NO: 3);
[0041] GhMYS1-R: TCATAAAGTGAGATCTAGAGTATTTGC (SEQ ID NO: 4).
[0042] The amplified sequences were ligated into the PMDT-19 vector, and positive clones were screened and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The nucleotide sequence is shown in SEQ ID NO:1. The protein sequence is shown in SEQ ID NO:2.
[0043] (1) Cotton (Gossypium hirsutum) GhMYS1 gene CDS sequence (1)..(1050):
[0044]
[0045] (2) GhMYS1 protein sequence:
[0046] MIEMHDEEQGEDVRAMPSRSRKCSSFDLNDEAGSERDCIGETSVEEEEIENITEGSSSNNNNGNGNDRRRVRQYVRSKLPRLRWTPDLHYSFVRAVERLGGQERATPKLVLQLMNVRGLSIAHVKSHLQMYRSKKLDEAGQVLSQSKRAIQGRGEFGSLLCQAMTTLSPHHRHQQQHFRMENGGIVLASESLDGSNTTFKANFPRHHQFPNSFISKAFGQENGFYIQNQIHGTGPIRAMASRFLEEKRWHPFERISNRWKVNGNMYKDMQSQSHCFWQRPSSDEDKHEPLTKFSSCRTEFEWNQDKVLKDGERLPDLQLRLSQRNGKFDEEKNNHCKGTHEISTQLSLS (SEQ ID NO:2) performed a phylogenetic analysis of GhMYS1 with some known GLK transcription factors in Arabidopsis and other species.
[0047] The results are as follows Figure 1 As shown, this sequence has the highest homology with Arabidopsis thaliana AtMYS1, so the applicant named it GhMYS1.
[0048] In addition to GhMYS1, the amino acid sequences of MYS1 from other representative plants were selected and analyzed using DANMAN software for multiple sequence alignment.
[0049] The results are as follows Figure 2 As shown, GhMYS1 contains a typical Myb_DNA domain and is a member of the GLK transcription factor family.
[0050] Example 2: Analysis of GhMYS1 Expression Patterns
[0051] RNA was extracted from the fibers of wild cotton (TX2094), upland cotton (TM-1), long-fiber cultivar J02, and short-fiber cultivar ZRI015 at 5, 10, 15, 20, and 25 days after flowering. The extraction method followed the centrifugation column-type polysaccharide and polyphenol plant total RNA extraction kit from Tiangen Biotech Co., Ltd. (Beijing).
[0052] After extraction, RNA concentration and purity were determined using a Nanodrop ND-2000 micro spectrophotometer. RNA integrity was further assessed using 1.2% agarose gel electrophoresis (120V, 15min). Two very clear rRNA bands, representing 28S and 18S rRNA, were observed under UV irradiation after electrophoresis. Samples that passed the tests were temporarily stored at -80℃.
[0053] Take 1 μg of RNA template and use the reverse transcription kit from TransGen Biotech (Beijing). All-in-OneFirst-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal catalog number: AT341) synthesizes cDNA.
[0054] Using Full Gold Trans The Top Green qPCR Supermix kit (catalog number: AQ131) was used for qRT-PCR detection on an ABI QuantStuidio 6 real-time quantitative PCR instrument. Based on the CDS sequences of genes within candidate regions, specific qRT-PCR primers were designed using the NCBI online tool (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), and the primers were synthesized by Shanghai Sangon Biotech (Shanghai) Co., Ltd.
[0055] The RT-qPCR primer sequences for GhMYS1 are as follows:
[0056] GhMYS1-qF:AAAAAGTCGACCACCGGATC(SEQ ID NO:5);
[0057] GhMYS1-qR: AACCAACTTGGGTGTTGCTC (SEQ ID NO: 6).
[0058] The housekeeping gene GhUBQ7 was used as an internal reference gene, and its sequence is as follows:
[0059] GhUBQ7-F:GAAGGCATTCCACCTGACCAAC (SEQ ID NO:7);
[0060] GhUBQ7-R: CTTGACCTTCTTCTTCTTGTGCTTG (SEQ ID NO: 8).
[0061] The reaction procedure was a three-step process: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 10 s, 60℃ annealing for 10 s, and 72℃ extension for 15 s, for 40 cycles. Three biological replicates and three technical replicates were also set up to verify the accuracy of the qRT-PCR results.
[0062] The –ΔΔCt method is used to calculate gene expression levels.
[0063] See results Figure 3 As shown. Figure 3 In Figure A, the expression pattern of the GhMYS1 gene in wild and domesticated cotton fibers is analyzed; in Figure B, the expression pattern of the GhMYS1 gene in long-fiber variety J02 and short-fiber variety ZRI015 fibers is analyzed.
[0064] like Figure 3 As shown, the expression levels of the GhMYS1 gene in the upland cotton standard genetic reference line TM-1 and the long-fiber cultivar J02 at 15 days of fiber development were 11.3 and 14.2, respectively, which were significantly higher than those in the wild cotton material TX2094 and the short-fiber cultivar ZRI015 (5.0 and 3.9, respectively, t.test, P-value = 0.002812 and 0.00043).
[0065] Example 3: Identification of the function of the GhMYS1 gene in cotton fiber development using VIGS technology
[0066] VIGS primers were designed based on the coding sequence of the GhMYS1 gene, and the sequences are as follows:
[0067] GhMYS1-VIGS-F:caaaatggcatgcctgcagactagtATTAGGAGGACAAGATAGAGCAAC (SEQID NO:9);
[0068] GhMYS1-VIGS-R: gaattcactagacctaggggcgcgccTCCAATACATTTTTATTGTTGTTCCCTCT (SEQ ID NO: 10).
[0069] Using cDNA from the upland cotton standard genetic reference line TM-1 fiber as a template, a silencing fragment of the GhMYS1 gene (300 bp) was amplified and ligated into the PMDT-19 vector. PCR sequence amplification was performed using a correctly sequenced plasmid as a template. The pCLCrVA vector and the silencing fragment of the GhMYS1 gene were double-digested with restriction endonucleases Spe I and Asc I, respectively. Then, the purified and recovered VIGS-GhMYS1 fragment was fused with pCLCrVA using T4 ligase to construct a viral vector, which was then transformed into competent E. coli DH5α cells. The cells were grown overnight in LB solid medium containing kanamycin, and single colonies were picked, shaken, and sequenced. The correctly sequenced pCLCrVA:GhMYS1, the empty vector control pCLCrVA, and the helper vector pCLCrVB were transformed into competent Agrobacterium LBA4404 cells.
[0070] The upland cotton standard genetic reference line TM-1 was sown in seedling pots and cultured in a cotton culture room at a constant temperature of 25℃ with a 16 / 8-hour photoperiod. Agrobacterium tumefaciens suspension (pCLCrVB) and a mixture of pCLCrVA:GhMYS1 and pCLCrVA at a 1:1 ratio were injected into the cotyledons of cotton seedlings with two leaves and one bud. Fibers from six individual plants 15 days after flowering were collected for qRT-PCR to detect the silencing efficiency of the GhMYS1 gene. The results showed that GhMYS1 expression in pCLCrVA:GhMYS1 was significantly lower than that in pCLCrVA:00, and the expression level of the GhMYS1 gene in the silencing material decreased by 90.68% compared to the control line. Figure 4 Part A of the document.
[0071] To reduce experimental error, the length of individual boll fibers was measured from bolls harvested from the middle of the cotton plant. The average length of the fibers from the three middle bolls was used to represent the total fiber length of each plant. Figure 4 As shown in sections B and C, the average fiber length of the six control materials was 29.24 mm, while the average fiber length of the GhMYS1 gene-silenced material was 25.63 mm. Compared with the control materials, the average fiber length of the GhMYS1 gene-silenced material was significantly reduced by 12.83%.
[0072] Example 4: Identifying the function of GhMYS1 in cotton fiber development using gene editing technology
[0073] Using the CRISPR-P website (http: / / cbi.hzau.edu.cn / crispr / ), target sites for the target gene were searched. Sequences with high scores were subjected to BLAST alignment, and specific sequences were selected as targets. Upland cotton contains two MYS1 homologous genes, GH_D10G2748 (named GhMYS1-A) and GH_A10G2643 (named GhMYS1-D). Therefore, sgRNA primers were designed to simultaneously target and knock out GhMYS1-A and GhMYS1-D.
[0074] The primer sequences required for constructing the GhMYS1 gene knockout vector are shown below:
[0075] GhMYS1s: AAGCACCTTCCTTTACATTCgttttagagctagaaatagaaata (SEQ ID NO: 11);
[0076] GhMYS1as: TTACTTTGTCAACGTAGCTGtgcaccagccgggaa (SEQ ID NO: 12);
[0077] inf GhMYS1as:ttctagctctaaaacTTACTTTGTCAACGTAGCTG (SEQ ID NO: 13).
[0078] inf pRGEB32-7s:AAGCATCAGATGGGCAAACAAA (SEQ ID NO: 14);
[0079] pRGEB32-7s: AAGCATCAGATGGGCAAACAAAGCACCAGTGGT (SEQ ID NO: 15).
[0080] Using cotton DNA sequences as templates, fragments 1 and 2 were obtained by PCR amplification using pRGEB32-7s and GhMYS1as, and GhMYS1s and GhMYS1as primers, respectively. Fragment 1 and fragment 2 were ligated using inf pRGEB32-7s and inf GhMYS1as primers to obtain ligation products. The ligation products digested with BSA1 were ligated to the pGERB32-GhU6.9-NPTⅡ vector using an in-fusion system to obtain a gene editing vector. The successfully constructed gene editing vector was electroporated into Agrobacterium LB4404 for subsequent cotton genetic transformation. The hypocotyls of cotton seedlings (Jin668) containing the CRISPR / Cas9-sgRNA editing system with the GhMYS1 target site sequence were infected. After several subcultures on selective medium containing kanamycin, embryogenic callus was generated. Embryonic callus tissue proliferates and differentiates on differentiation medium, producing numerous cotyledonary embryos, which eventually differentiate into seedlings. Changes in nucleotide sequences are identified by PCR amplification and sequencing to detect sequences containing the target site, allowing for the screening of successfully gene-edited plants.
[0081] Gene-edited plant seedlings (T0 generation) obtained from tissue culture were transplanted to an experimental field and propagated further in Hainan. Based on the GhMYS1 sequence, PCR primers were designed to amplify the target site and detect the editing type in the T1 generation plants. The primer sequences are shown below:
[0082] GhMYS1-DF:TGGCAATGGCAACGATAGAAGA;
[0083] GhMYS1-DR:TTTGATGAACTTACTCTCTTGA.
[0084] The results showed that, compared with the control plant Jin668, the four GhMYS1 gene knockout lines (mys1-7, mys1-14, mys1-21, and mys1-25) exhibited varying degrees of base deletion at both target sites. Figure 5 A). Observation of its fiber phenotype showed that the fiber length of T1 generation plants was significantly shorter than that of the control J668 (16.8-28.1%). Figure 5 (BC). This result is consistent with the previous phenotype of pCLCrVA:GhMYS1 cotton fibers, further indicating that GhMYS1 is involved in the regulation of cotton fiber elongation development.
[0085] The above is a further detailed description of the present invention and should not be considered as a limitation on the specific implementation of the present invention. For those skilled in the art, simple deductions or substitutions without departing from the concept of the present invention are all within the protection scope of the present invention.
Claims
1. Application of GhMYS1 gene in positively regulating the growth of cotton fiber in the elongation stage, characterized in that, A nucleotide sequence of the GhMYS1 gene is shown as SEQ ID NO:
1.
2. Use according to claim 1, characterized in that, The amplification primer of the GhMYS1 gene comprises SEQ ID NO:3 and / or SEQ ID NO:
4.
3. Use of GhMYS1 protein in positively regulating the growth of cotton fiber in the elongation stage, characterized in that, An amino acid sequence of the GhMYS1 protein is shown as SEQ ID NO:
2.
4. A method of positively modulating the duration of the elongation phase of cotton fiber, characterized in that, The method is to increase the expression amount of the GhMYS1 gene in the cotton, and / or the method is to increase the expression amount of the GhMYS1 protein in the cotton, wherein a nucleotide sequence of the GhMYS1 gene is shown as SEQ ID NO:1, and an amino acid sequence of the GhMYS1 protein is shown as SEQ ID NO:2.