Application of RNA interference in the transformation of Cordyceps sinensis from blastospores to hyphae by targeting genes related to the larvae of the bat moth
By interfering with the genes related to bat moth larvae, Cordyceps sinensis bacteria are promoted from spores to mycelium, solving the problem of low conversion efficiency of Cordyceps sinensis bacteria in bat moth larvae, improving the rigidity rate and shortening the artificial care cycle.
Patent Information
- Application Number
- CN202410767783.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-14
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2044-06-14
AI Technical Summary
The spores of Cordyceps sinensis fungi in the body of bat moth larvae are inefficient in the conversion of spores into mycelium, resulting in low rigidity rate and long artificial care cycle, affecting the artificial and efficient production of Cordyceps sinensis.
By interfering with RNA with bat moth larva-related genes, such as Flightin, larval cuticle protein LCP-30, 26-hydroxylase (CYP18A1), cuticle protein 18.6, isoform B and probable chitinase 3, it promotes the conversion of Cordyceps sinensis from budding spores to mycelium, and knock down the expression of these genes using siRNA.
The proportion of Cordyceps sinensis in the hemolymph of bat moth larvae has been significantly increased, which has promoted larval rigidity, shortened the artificial care cycle and reduced costs.
Smart Images

Figure CN118773215B_ABST
Abstract
Description
Technical field:
[0001] The present invention belongs to the technical field of artificial cultivation of Cordyceps sinensis, and specifically relates to the application of RNA interference with bat moth larvae-related genes in promoting the transformation of Cordyceps sinensis from blastospores to hyphae. Background technology:
[0002] Significant breakthroughs have been made in the artificial cultivation of Cordyceps sinensis. Simulating high-altitude environments at low altitudes allows the production of Cordyceps sinensis comparable to its wild counterpart, marking a significant leap from laboratory to industrial production for this rare biological resource. However, factors such as the instability of the Cordyceps sinensis strain, the high mortality rate of the pathogen against the larvae of the bat moth, and the low rigidification rate of the infected larvae have severely hampered the efficient artificial production of Cordyceps sinensis. The key factor influencing the rigidification rate of infected larvae (i.e., the proportion of rigid larvae formed after blastospores transform into hyphae) lies in the efficiency of the Cordyceps sinensis fungus in the hemolymph of the host insect.
[0003] Fungal dimorphism is the phenomenon in which some fungi undergo a transition between yeast and hyphae forms under the influence of environmental factors. Cordyceps sinensis is a typical dimorphic fungus (blastospore-hyphae). Under the induction of specific factors, it can produce more blastospores through budding growth or form elongated prehyphae and hyphae through apical growth. N-acetylglucosamine, proline, farnesol, tyrosol, methyl farnesate, and ecdysone can promote the conversion of Cordyceps sinensis blastospores to hyphae to varying degrees in vitro. Insect ecdysone, juvenile hormone, and mannitol have been reported to promote rigidification in bat moth larvae.
[0004] After Cordyceps sinensis infects the larvae of the bat moth, it grows in the larval hemolymph in the form of blastospores for a long time and is regulated by the bat moth larvae. However, there are no reports on which genes of the bat moth larvae regulate the transformation of Cordyceps sinensis blastospores in their hemolymph into hyphae. Small interfering RNA (siRNA), sometimes called short interfering RNA or silencing RNA, is a class of double-stranded RNA molecules with a length of 20-25 base pairs. It operates within the RNA interference (RNAi) pathway and interferes with the post-transcriptional degradation of mRNA that expresses specific genes with complementary nucleotide sequences, thereby preventing translation. This patent reports the application of RNA interference with genes related to bat moth larvae in promoting the transformation of Cordyceps sinensis from blastospores to hyphae. Summary of the invention:
[0005] Based on the problem of regulating the dimorphic transformation of Cordyceps sinensis in bat moth larvae, the purpose of the present invention is to provide the application of RNA interference with bat moth larvae-related genes in promoting the transformation of Cordyceps sinensis from blastospores to hyphae, thereby overcoming the problems of low rigidification rate of bat moth larvae carrying Cordyceps sinensis and long artificial cultivation period of Cordyceps sinensis.
[0006] The present invention has found through research that knocking down the relevant genes of the bat moth larvae using RNAi technology can promote the transformation of Cordyceps sinensis in the larvae's hemolymph from blastospores to hyphae.
[0007] Therefore, the present invention provides a gene that can regulate the transformation of Cordyceps sinensis from blastospores to hyphae in bat moth larvae, wherein the gene is any one of the following:
[0008] Flightin gene, the nucleotide sequence of which is shown in SEQ ID NO.8;
[0009] A larvalcuticle protein LCP-30 gene, the nucleotide sequence of which is shown in any one of SEQ ID NOs. 11-15;
[0010] 26-hydroxylase (CYP18A1) gene, the nucleotide sequence of which is shown in SEQ ID NO. 9 or 10;
[0011] cuticleprotein 18.6, isoform B gene, the nucleotide sequence of which is shown in any one of SEQ ID NOs. 21-27;
[0012] The probable chitinase 3 gene has a nucleotide sequence as shown in any one of SEQ ID NOs. 16-20.
[0013] The second object of the present invention is to provide siRNA for knocking down the expression of the above genes.
[0014] Preferably, the sequence of the siRNA is as shown in any one of the following siRNAs or a combination of two or more:
[0015]
[0016]
[0017]
[0018]
[0019] The English letters represent the copy number of the gene, and the Arabic numerals represent the sense upper strand -1, sense lower strand -2, antisense upper strand -3, and antisense lower strand -4 of the siRNA in each copy of the gene.
[0020] The third aspect of the present invention is to provide the use of the above gene in regulating the transformation of Cordyceps sinensis from blastospores to hyphae.
[0021] Preferably, the preparation for reducing the expression level of the above-mentioned gene is used to promote the transformation of Cordyceps sinensis from blastospores to hyphae.
[0022] Preferably, the method is used to promote the transformation of Cordyceps sinensis from blastospores to hyphae by knocking down the expression of the above-mentioned gene through RNAi.
[0023] Preferably, the preparation for reducing the expression level of the above-mentioned gene is used to promote the rigidification of bat moth larvae carrying Cordyceps sinensis, that is, to prepare a preparation for promoting the rigidification of bat moth larvae.
[0024] A fourth object of the present invention is to provide a method for promoting rigor mortis in bat moth larvae, characterized in that siRNAs of the above genes are introduced separately or mixed into bat moth larvae carrying Cordyceps sinensis to promote rigor mortis in the bat moth larvae.
[0025] Preferably, the Cordyceps sinensis is Ophiocordyceps sinensis.
[0026] Preferably, the bat moth larvae are at the 6th instar.
[0027] Preferably, the siRNA is inoculated at a dose of 4 μg per larva.
[0028] The present invention aims to solve the problems of long-term retention of blastospores in bat moth larvae infected with Cordyceps sinensis, time-consuming rigidification process, low rigidification rate, and long artificial cultivation period and high cost of Cordyceps sinensis. siRNAs of flightin, larval cuticle protein LCP-30, 26-hydroxylase, cuticle protein 18.6, isoform B and probable chitinase 3 genes of bat moth larvae are injected separately or mixed into the bat moth larvae. The conversion ratios of blastospores in the hemolymph of the bat moth larvae into prehyphae are flightin (83.33±11.02%), larval cuticle protein LCP-30 (78.25±3.55%), 26-hydroxylase (CYP18A1) (40.48±6.30%), cuticle protein 18.6, isoform B (39.81±2.31%) and probable chitinase 3, respectively. 3 (34.52±7.81%), while in the control group, only blastospores were present in the hemolymph of the bat moth larvae. This indicates that knocking down the relevant gene in the bat moth larvae can significantly increase the proportion of Cordyceps sinensis fungi in the larval hemolymph converted from blastospores to hyphae. Description of the drawings:
[0029] Figure 1This is a picture of blastospores carried in the hemolymph of the small golden bat moth larvae and converted into prehyphae or hyphae. It shows blastospores (marked by yellow arrows, white in grayscale) and prehyphae (marked by red arrows, gray in grayscale) in the hemolymph of the larvae 120 hours after injection of dsRNA of larvae-related genes (400x fluorescence microscope).
[0030] Figure 2 RNAi efficiency was detected by qRT-PCR 120 h after siRNA injection;
[0031] Note: 1: Pupalcuticleprotein; 2: Ecdysone-induced protein 78C; 3: Coactosin-likeprotein; 4: Flightin; 5: Larval / pupalrigid cuticleprotein 66; 6: 26-hydroxylase (CYP18A1); 7: LarvalcuticleproteinLCP-30; 8: Multidrugresistanceprotein 1; 9: Probable chitinase 3;10: Cuticleprotein 18.6, isoformB. Specific implementation method:
[0032] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0033] Example 1:
[0034] Cordyceps sinensis (Ophiocordyceps sinensis, code: KD) was isolated from wild Cordyceps sinensis in Kangding, Sichuan by tissue separation method. It was confirmed as Cordyceps sinensis by molecular identification and stored at -80℃. Cordyceps sinensis liquid PMG culture medium: 200g potato boiled juice, 20g maltose, 10g peptone, 3g potassium dihydrogen phosphate, 1.5g magnesium sulfate, 0.02g vitamin B1, 5g grinding liquid of artificially reared fresh greater wax moth larvae, mixed and diluted to 1L with distilled water, and divided into 250mL Erlenmeyer flasks, 150mL per bottle, and sterilized by autoclave at 121℃ for 30min. Use after cooling. On the clean bench, solid cultured Cordyceps sinensis blocks (about 0.5cm 3) were inoculated into the above liquid culture medium and cultured on a shaker at 120 rpm and 13°C for 45 days. The liquid culture was filtered through three layers of sterile lens paper, and the filtrate was collected into a 50 mL sterilized centrifuge tube. The tube was centrifuged at 8000 rpm and 10°C for 15 min, and the supernatant was discarded. The tube was resuspended in sterile phosphate buffered saline (PBS; pH = 7.0), centrifuged again, and the supernatant was discarded. The collected blastospores were diluted with sterile PBS to 6 × 10 6 / mL was used for injection to infect the 6th instar larvae of the small golden bat moth.
[0035] The larvae of Thitarodes xiaojinensis were raised in a low-altitude laboratory on a diet of Daucus carota and Potentilla anserina. Thitarodes xiaojinensis is a commonly used bat moth insect.
[0036] siRNAs targeting genes in the bat moth larvae were synthesized using the following method (see Table 1 for siRNA sequences for each gene). Primers were designed using the website http: / / rnaidesigner.thermofisher.com / rnaiexpress / design.do and synthesized by Sangon Biotech (Shanghai) Co., Ltd. siRNAs were synthesized according to the instructions for the M5 HiPer T7 In Vitro Transcription Kit. Annealed oligonucleotide DNA templates were prepared by adding DNA annealing buffer and oligonucleotides #1 and #2 at 95°C. The annealed oligonucleotide DNA templates were incubated with 2xT7 InVitro Transcription Mix in a PCR instrument. Following incubation, DNase I was treated to eliminate potential genomic DNA in all samples. Separate sense and antisense reactions were combined. Purification was performed using 3M sodium acetate (pH 5.2) and isopropanol, followed by centrifugation and washing with 70% cold ethanol. The concentration and quality of the synthesized siRNAs targeting each gene were determined by UV spectrophotometry and agarose gel electrophoresis.
[0037] Thirty larvae of the Cordyceps sinensis-infected larvae were injected with siRNA for each gene (at a concentration of 4 μg / μL, with each larva receiving 4 μg of siRNA. If multiple copies of a gene were present, equal amounts of siRNA for each copy were mixed and injected). After injection, the larvae were examined for mortality, dead larvae, pupation rate, and molting rate. Five days after injection, hemolymph was collected from the treated larvae in a 13-16°C operating room. The hemolymph stock solution was mixed with a fluorescent dye in equal proportions and observed and photographed under an inverted fluorescence microscope at 400x magnification. Spore morphology (blastospores and prehyphae) and bacterial survival rate were examined and photographed under the fluorescence microscope. The spores were further diluted with sterile double-distilled water and counted using a hemocytometer. The entire experiment was repeated twice.
[0038] Total RNA was extracted from gutted bat moth larvae by grinding the tissue into a fine powder in liquid nitrogen. RNA purity and quantity were assessed using a Onedrop OD-1000+ spectrophotometer. RNA integrity was assessed by 1% agarose gel electrophoresis. Only RNA samples with high integrity, an A260 / A280 ratio between 2.000 and 2.124, and an A260 / A230 ratio greater than 2.0, were used to generate first-strand cDNA. Reverse transcription was performed according to the ToloScript All-in-one RT EasyMix for qPCR instructions. The first cDNA was synthesized from 1 μg of total RNA extracted from a total volume of 20 μl and stored at −20°C. Primer design for real-time fluorescence quantitative PCR: Primers were designed using primer-blast from NCBI and synthesized by Sangon Biotech (Shanghai) Co., Ltd. qRT-PCR experiments were performed according to the instructions for 2×SYBR Green qPCR Premix (Universal). The template was 1 μL, F-Primer (10 μM) 0.4 μL, R-Primer (10 μM) 0.4 μL, and 2× TransStartTip Green qPCR SuperMix 10 μL. Two technical replicates were set up for each treatment. Reverse-transcribed cDNA was diluted 5-fold and used as template for qPCR reactions, with three replicates per sample. Reaction conditions included 40 cycles of 95°C for 30 s, 95°C for 10 s, 55°C for 15 s, and 72°C for 10 s. After the reaction, melting curve analysis was performed from 65°C to 95°C to ensure the consistency and specificity of the amplified products. All reactions were performed on a CFX96 system according to the manufacturer's instructions. Data analysis was performed using a PCR instrument to identify and eliminate outliers, and the relative expression levels were calculated using the 2-ΔΔCt method.
[0039] The results (Table 2) showed that 120 hours after injection of siRNA targeting relevant genes (flightin, larval cuticle protein LCP-30, 26-hydroxylase (CYP18A1), cuticle protein 18.6, isoform B, and probable chitinase 3), blastospores in the hemolymph transformed into prehyphae (Table 2) at a rate of 83.33±11.02%, 78.25±3.55%, 40.48±6.30%, 39.81±2.31%, and 34.52±7.81%, respectively. However, no prehyphae were observed in the hemolymph of live larvae injected with siRNA targeting pupal cuticle protein, ecdysone-induced protein 78C, and multidrug resistance protein 1. No prehyphae were also observed in the control group injected with siGFP and sterile ultrapure water. qRT-PCR verification results showed that after injection of siRNA, the expression of the interfered genes in the larvae of the fungus-carrying bat moth decreased to varying degrees (the inhibition rate ranged from 38.64% to 91.54%) ( Figure 2 These results indicate that RNAi interference with flightin, larval cuticle protein LCP-30, 26-hydroxylase (CYP18A1), cuticle protein 18.6, isoformB, and probable chitinase 3 genes in the bat moth larvae promotes the conversion of blastospores in the hemolymph of the fungus-carrying larvae into prehyphae, further leading to the rigidification of the fungus-carrying larvae.
[0040] Table 1. siRNA sequences targeting genes of bat moth larvae
[0041]
[0042]
[0043]
[0044]
[0045] Note: The English letters in the table (e.g., A, B, C, D, etc., A1, A2, A3, A4 represent the same siRNA, and the same applies to B, C, D, E) represent the copy number of the gene (Pupal cuticle protein has 2 copies, Ecdysone-induced protein 78C has 1 copy, Multidrug resistance protein 1 has 3 copies, Flightin has only 1 copy, 26-hydroxylase (CYP18A1) has 2 copies, Larval cuticle protein LCP-30 has 5 copies, Probablechitinase 3 has 5 copies, Cuticle protein 18.6, isoform B has 3 copies); Arabic numerals represent the sense upper strand (1), sense lower strand (2), antisense upper strand (3), and antisense lower strand (4) of the siRNA in each copy of the gene.
[0046] Table 2. Percentage of larvae containing blastospores and prehyphae in hemolymph 120 h after injection of dsRNA of larvae-related genes
[0047]
[0048]
[0049] Note: Data are mean ± SD 120 hours after dsRNA injection. Gene knockdown in larvae was achieved by injecting dsRNA targeting different genes (4 μg / μL of siRNA in 4 μL of RNase-free water) into the hemolymph of larvae containing only blastospores. Data with different letters within each column indicate significant differences (Duncan test, p < 0.05).
[0050] >Pupal cuticle protein-Contig09967 of T.xiaojinensis(SEQ ID NO.1)
[0051] ATGAATCCAATGGCACTCATCTTCTTCGCAGCTATGGCCGTGGTCGCGCCAATCAGCGCCAGCAACTGGGGAGGATCCGGCTACGCAGCGCCCAACTGGGCCGCCGTGCCCGCCAACATCGCCCTCTCGCAGGACGGCAAGAACGTGCTGGACACGCCCGAGGTAGCTGCCGCTAAGTCAGCCCACCTCGCCGCCCTAGCCCAGGCCCAATCCCACGGAGGCAATTCCAACGACGACGGATCCTACGACCCCAGGTGGGAGAACGAGAACTATCAAGAGCAAGCCGCCCACTCCTCCTGGAACGGAGCGCCTGCTGCCCAATCCTGGAACGCTGCTCCCGCGCAATCCTGGAACTCCGCCCCCGCCCAATCCTGGAACTCTGCCCCCGCCCAGTCCTGGAACTCCGCCCCCGCTCAATCGTGGAACGGTAAGGCCGATTCCGGTCAATGGTCTCAGGCCCCAGCTCAGAGCTGGTCTGCCGCTCCCGCGCCCATCCAGCTGTCTTCTGATGGACACCACGTCTTGGACACCCCTGAAGTAGCTCAAGCTAGAGCCGCCCACTTGGCCGCTCACGCTTCCGCCGGTCCCCACTCCGCCCCTGCCCCATCCTGGAACGGCGCCCCATCCTGGCAGGCGGGTCCCTCTGCCCACGCTCCCGCCCAGGTCCGTCTCTCCCACGACGGTTCCAACATCCTGGACACTCCTGAAGTAGCGCAAGCCAGAGCAGCCCACTTGGCCGCGCACGCGCAAGCCGCCGCCCACGCCGGGCCAGCCCCCGCCCACAACCAGTGGTAA
[0052] >Pupal cuticle protein-Contig09966 of T.xiaojinensis(SEQ ID NO.2)
[0053] ATGAATCCGATGGTTACCCTCACCCTCGCCCTCATGGCTGCAGCATCCAGCGCCTCCTACGCGCCGGCCTACTACCAGGGACCCCAGGCCCACATTCAGCTCAGCCACGACGGCAAACACGTGCTCGACACGCCCGAGGTAGCGCACGCTAGGGCCGCCCACCTCGCCGCACACGCCGCCGCCGCCCACGGTTCCTACGGCGGACAAGACTCTGGCGCCTGGGACGGAGGACATGACTCTGGCGCCTGGGACGGTGGACATGACTCCGGTGCTTACTACGGCGATAGCGGTTCATACGGTGGTGGCGCACACTACGGCGCACCCGGCGCCGGACTCCACAAGTACGGCCCCGCTCCCCTCGCTCATGACGGTAGAGTGATTGACACGCCCGAGGTAGCCCACGCTAAGGCCGCCCACCTCGCCGCCCACGCTGGTGCCGCCCATGGAGGATACGGTTTGGGCGGACACGCCCTCGCCCCTGTAGCCTACGCCGGCGCCGGACACGGCTACGCTGCCGGCTACGGAAAATGGACCGGACCCCAGGCTCAAGTTCAGCTGACCCATGATGGCAAATACGTAGTGGACACTCCCGAGGTTGCCCACGCTAGGGCCGCCCACCTCGCCGCCCACGCGTCCGCCTCGCACGGCTCCGCCGGCTGGTCCGGCGATGATGGCTACAGCGGCTATTCTCACGGCCCCGTCGGCATCACGCACGGCGGATACCTCGCCGACACGCCCGCGGTAGCGCACGCTAAGGCCGCCCACTTCGCCGCCAAGGCCTCTGCCGGCGGTCACGGCGGATGGTACTGA
[0054]
[0055] >Multidrug resistance protein 1-Contig10994 of T.xiaojinensis(SEQ IDNO.4)
[0056]
[0057] >Multidrug resistanceprotein 1-Contig14002 of T.xiaojinensis(SEQ IDNO.5)
[0058]
[0059] >Multidrug resistance protein 1-Contig10993 of T.xiaojinensis(SEQ IDNO.6)
[0060]
[0061] >Multidrug resistance protein 1-Contig10992 of T.xiaojinensis(SEQ IDNO.7)
[0062]
[0063] >Flightin-Contig09927 of T.xiaojinensis(SEQ ID NO.8)
[0064] ATGGCTGATGACGAACCTTGGGAGATTGAAGACCCTAGCGAAGATGCACCTGTTGAGGAAACGTCAGCACCCGAAACACCAGCAAATGATGTGAAACCTCAAACAGAAGAGCCTACACCTGCAGAACCAGAAGAGTCCTCTGTAACAGAGAACAATGATACTAAAAAATTAATTTTCAAGCACTGGGTCAGACCAAAGTTCCTACAGTACGGATACCTATATGACTATCAGCGTAACTACTACGACGACGTGATCGACTTCTTGGATCGCCGCCAGTGGGGCTACAAGCGGGAGGTGCCGCGTGCACAGACCTGGGCCGAGCGCGCGCTGCGCACATACACCAGCAAGCCGGGCTCGACGGCCGCCTCGCGCGCCTCGCTCCAGGACAGGCGCCTGCTGGCGCACATATCGAGCGGTGCCAGGTTCCACCGCTACCACAGCAAATCACTTATCAGCAGGAAGTATTCCTCGCTCGGTTTTACAACCATTACTATTTAG
[0065] >26-hydroxylase(CYP18A1)-Contig08142 of T.xiaojinensis(SEQ ID NO.9)
[0066]
[0067] >26-hydroxylase(CYP18A1)-Contig08141 of T.xiaojinensis(SEQ ID NO.10)
[0068]
[0069] >Larval cuticle protein LCP-30-Contig11775 ofT.xiaojinensis(SEQ IDNO.11) .
[0070] ATGTTCAAAATTACGGCTGTTTGCGCCTTGTGCATTGTGGGAGCACTCGCCCAGAGTGACGGAAGGTATCGTCCTGAAAACACGGGCCGGTATACTGGCACAAATACTGCTTACACTGGAGGTGTTAGTACTGCCGCTGGAAAGTATTCTCAGGAGAGTCGCTATGTAGCTGCCGGTGATGGGAAATACAAAGGTTCCAATGACGGAAGGTACTCTGGCGGCAATGATGGCAGATACAACGGAGGAAACGATGGCCGCTACGTGCCCGACCAAACTGGAAATTTCAACGGCGACCGAGGAAGTGCTGGAGGCAAATATGACGGGGATAATGGCGCTTACAGTGGAAGTTCCAACCCCTACGTCCACTCTTCAAGTGGATCGGGCGGATCCGGAGGTTCAGGTGGCGGCGGTAGCGGAGGGGCGTACTCAGGTGGAAAGTATGGCAGCGGGAACAGCGGATCGGGTGCATCCGGTAGTGGTTCGGCCGGGTCTGGAAGTAATTCCGGAATTGGCAGCGGCGCGGTTAGCTCCTTAATCGGCGCCACAAGCGGATCTGGAAGTGGATTAGCCAGTGGATCGGGGGCTGGAAAGAAATATGGTGCTGGTAGCGGCGCGGAGAGCGGTGCGGGAAGTGGAGCTTCCGGTTATGGTGTCGGCAGCGGAACGGGCAAGGGTTTCAGCAATGAATACCAATACGGTATTATCCGCAAGGAATTCGACGAAGTTCCCGATGGATATCACTACTTGTACGAAACTGAGAACAAAATCCTTGCTGAAGAACACGGTAAAGTGGAAAAGATCGACAATGAGCGTGAAGGTCTTAGGTCGAAGGGTTTCTACGAATATGTCGGACCTGATGGTGTTACATACAGAGTCGACTACATTGCTGATGAAAATGGTTTCCAACCGACTGGAGCCCACATTCCTGTTTAA
[0071] >Larval cuticleprotein LCP-30-Contig02140 ofT.xiaojinensis(SEQ IDNO.12)
[0072] ATGTTTAACTTGGTGATCTTGGCTGTGTGCCTGGGGAGCGTTATGGCGGAAGACGGCAAGTGGTCCAGTCCTGCTCGTTATGGAGATTCTGGAAAGTATATTCCATCTGACGAAGGGAAGTATGTTCACGTCCCGAATCCCTACATCCACATCCACAACCCGTACGGAGGCGGCTTTGGACCATATGCTCACCAAAACGATCCTTACAAAGGCGAGGAGTCCCAGCAGCCTCAGTACAAACTGGTAATTGAGCCACCAAAGGACATTCCGTTCTACAGACCTGGATACTACGAAAACAACGGTATCAAGATCATCCGCCAGAACCACGACCTCAACGAAGATAAATACAAGTTTCTGTACGAGACCGAAAACAGCATCCTCGCTGAAGAAAATGCCAGACTAAAGAATGTGGGAGACAAGGATGAAGGTATTGCATCTGCTGGATACTACCAGTATATCGGACCCGATGGCTACCTCTACCGCGTCGACTACACAGCTGATGAGAACGGATTCCGTCCCAAAGTGACCCGGTTATCGACCAAGTACTCTGGAAAGTATGAATATGTTAAGGTCTAA
[0073] >Larval cuticleprotein LCP-30-Contig11774ofT.xiaojinensis(SEQ IDNO.13)
[0074] ATGGCAAAAGTCTTGTTAGTTCTCCTGGTCAGCGCAGCTGCTGCCGTTGCTTTAGATGATGGACAATATCGACCTGGAAAGTATGGGGACGATGGTCGATACAGGCAGGCCCAAGAAGGACAATACTTTAGGCAAGGCACGGAAGGCATCTACAACGGAATATATGACGGGCGATACAATGGCCAATATGGCTCCTACAATCCTTTTGCGAATTTCGGAGCGTTAGCAGGACAAAATGGATTCTACGATCCACGATTTGCAAACCAGTACGTCTCTGGAGTAAATGCCCCCAGCCCCGGCTTCTACCAACCAACATTTGACGGCACATTAGGCTACTTTACGGATGGAATTACCATCCCTTCAGCGAGCGACGATAGATTCGCATTCTCCAAACCTGCCGCTAAGCCTGTCGTCCCGCCTGCACCTCTAACTGTGCCCAATGCTGCGCTTCCTGCACCTCCACTTCCGCCAAAAATTCCTGTTGTTCAACAAAACCCCTCCTTATACGCGAAGAGTGCCTACGCCAACAACTATGCATCCGCCTACAATAACTATTTCCGCATACTGAAACAGGATACCGAAGTAGGGCCCGAGGGGTACCACTACCTCTACGAAACCGAAAACCAAATCAAAGCCGAAGAATCGGGACACTTGCAACGATCCGCCGTCAGTAAAGAAGATGCGATTAGTGCAAATGGTTTCTTCGAATATATTGGGGACGATGGCTTGAAGTATCGAGTAGATTATCTCGCCGATGAGAATGGATTTCAACCGACTGGCGCCCACTTGCCAGTACCACCACCGATACCGGAAGCCATTGCTAAATCTCTGAATTATCTGAGAAGCGTTGGCAAAGCCTAA
[0075] >Larval cuticleprotein LCP-30-Contig11773 ofT.xiaojinensis(SEQ IDNO.14)
[0076] ATGTTGCGTGCTTCGTTATATTTATTAATATCACTTGTCATAACGGCAAGTGCCCAGGATGATGGAAAATATAAACCTGAAAAACGTTCAAACACAGGGGGCAATGACGGCCGATACCAACCCTCGAATGACGGCAAGTATATTCCCACTGGTGATGGAAAATACAACCTGACTTACGATGGCGGATTCGGCCCTTACACAGGCCTAAACGGAAGATACGAACATGACTATAAAGGGGGAGCAGGTGCCTACAAGGGAACTAACGATCCATACAAACACCAAAGTGATTCGAACAGTAACGACGGAAAGTACAAACACGTTGATGGTAACAGCGGGTTAGGTAACGGCCAGGGTTACGACAAGTATAAAGACGTTAAACAAGCCAACGTTTACTCACACAACAATTCTCCTAAAACAATAATTACTCCGCATCAAGGTGCTAGAAGTGGAAATAACAATGCGATCAATCTCAACTTAAATAAAAATGGTCTGTTCGGACAGAGTAATAGACAGAGAGACTATAAATACAATTTTATACCGGCAGAATCTGTTCAAAGTTCCATTTCCAAACTTGGATCGTCTACACAGAGGCCGTATTTATCAACCTCGCTATTGAAGGAAACCACAACGCAAAGACCTGTCACACCGACTTACCGCGCGTCCCCATCTACCAGCGTCAACGAACCAGAACCTGCAGAACCGCGAAGCAGATATAACAATGAAAACTACCGCATTATAAGGCAAGAGTCTGAACCAGTCGATGATGGGTTCCAGTACCTTTATGAGACGGAGAACGGAATTCTTGCTGAGGAGAAAGGGTCACTACAGAAGACAGACGAAGGCAAACTCGCTATGAGGGTGACAGGGTTTTACGAGTACGTGGGAGACGACGGGAAAACTTATCGTGTTGATTACACCGCTGATGAAAACGGTTTTCAACCAACAGGAGCTCATCTTGTTATATAA
[0077] >Larval cuticleprotein LCP-30-Contig11776 ofT.xiaojinensis(SEQ IDNO.15)
[0078] ATGTTGAAAATTACAGCCCTCTGCATCCTGTGCTTTGCTGGTGCTTTAGCGCAAAGCGGAAACTATGGAAATTATCGCTCTGATAACAGAAACATCGCTGCCTATAAACCAAGAGTTGCGACAGTTAGCAGCAGTGGCCAGGACGGACGATATGTAGCCTCTGACGAAAGGTACAAAGGAAGTAACGATGGAAGATATACGGGTGGAAACGATGGCCGTTATGTCCCCGATGATAGCGGTAAATTTAATGGTGATCGAGGTTCTACCGGAGGTGCTTACAGTGGAGATAACGGCGGATACAATCCATACGTTGGATCCGGAAGCCGTTCCGGTGGATCTGGCGGCGGCGGGAGTGGCGGCGCATACTCTGGAAGCAAGTACGGAAGAGGAAGCAGCGATTCCGGTGCTTACAATAGCGGAGCATCCGGCTCCAGTAGTATTTTCGGAAAATCACCAGGATCGTCTGCCGGTAGTGGATTGATTACCAGTTCTGGACTTCGACCTACAACTGCAGCTAGCGTTAGTAAGTACGGTGTTGGTAGTAGCACAGCTGCTACCGGCCAAGGATTCACCGATGAATACAAATACGGTATCATCCGCAAAGAATTCGACGAGGAAGCTGACGGCTATCACTACCTTTACGAAACAGAAAATAAGATCCTTGCCGAGGAAGTTGGCAAAGTTGAAAAGATTGACAACGAACACGAAGGAGTTAGGTCGAAGGGTTTCTATGAATACGTCGGTCCTGATGGCGTGACTTATAGAGTTGACTACATTGCCGACGAAAATGGCTTCCAGCCATCTGGAGCGCATATTCCTGTCTTAATATCGTGA
[0079] >Probable chitinase 3-Contig08225 ofT.xiaojinensis(SEQ ID NO.16)
[0080]
[0081] >Probable chitinase 3-Contig10284 ofT.xiaojinensis(SEQ ID NO.17)
[0082]
[0083] >Probable chitinase 3-Contig11398 ofT.xiaojinensis(SEQ ID NO.18)
[0084] ATGAAAGTGTTCATTGTTCTCGCGGCTGTAGCCGTCATAGCAAACGGCCAATCTGCCTTCAACTGCCCCGCCAAGGACGGACAGTACGAGGATTCCCGTCAGTGTGACAAGTTCTACGAGTGCAAAGATGGTGCCGCCGTCACCAAGTACTGTCCTGACGGTCTGGTATTCGACCAACACATCAGGAAGATCAACAAGTGCGACCAGCCCTTCAACGTAGATTGCGAAGACAGGACCGAATTGCAGGCGCCGAAATCCAACGAGCTGTGCCCAAGACGCAACGGTTTCTTCGCTCACCCCGACCCTGCTGTGTGCAACATCTTCTACAATTGCATCGACGGTGACGCCATCGAAGTGAAGTGCACTGCTGGACTGCATTTCGATGAATACAGTGGTACCTGCGTCTGGCCTGACGCGGCTGGTAGGACAGGATGCAATGCTCAGGATAAAAAACTAAAGGATGGCTTTGAGTGTCCCAAGGACGCGCCCCTAGACCCCCAGGGTCAAGCCGTCGCCCACCCCAAGTTCCCCCACCCCACTGACTGCCAGCGGTTCTACGTCTGCCTCAATGGAGTCGAGCCCAGGGACCTCGGCTGTCAGGTCGGAGAAGTCTATAATGAGGAGACCCAGAAATGTGACGCTCCGGAGAACGTGCACGGATGTGAGGATTGGTACAAGGATTCTGAAGAAGCTCAAAGCCCCAAGAGGCCTTGA
[0085] >Probable chitinase 3-Contig05498 ofT.xiaojinensis(SEQ ID NO.19)
[0086]
[0087] >Probable chitinase 3-Contig05521 ofT.xiaojinensis(SEQ ID NO.20)
[0088]
[0089] >Cuticleprotein 18.6,isoform B-Contig09435 ofT.xiaojinensis(SEQ IDNO.21)
[0090] ATGATCGGCAAAATCATCGCCTTCTCCGCCTTGGTGGCTGCGGCCCAATCAGGCTATGCACCCGTCGTAGCCCATGCGGGATACGGACTCGGACACGGCGCGGCTGTCTCCTCCCAAAGCATCGTCCGTCATGATGGTCACGGCTACGGCGGATATGGTGGAGCCGGTGCCGGATACGGTGGATACGCTGGAGCCGGTCTCGGCTACGGTGGATACGCTGGAGCCGGTCATGGCTACGGTGGATACGCTGGAGCCGGTCTCGGCTACGCCGGTGTCGCCCACGGATACGCCGCTCCCGTCGTCCACGCCGCCCCCGTAGTCCACGCCGCTCCAATCGCCTACGCTACCCCAGTTGCCTACGCCGGCCACGCTGATGAATACAGTCACCCCAAATACGATTTCGCATACTCCGTGTCGGACCCGCACACCGGCGACAGCAAGAGCCAGCACGAGTCCCGCGACGGAGACGCCGTCCACGGCTCCTACTCCCTGGTGCAGCCCGATGGCTCCGTGCGCAAGGTCGACTACTCTGCCGATGATCACAGCGGTTTCAACGCCGTGGTGCACACATCCGCTCCCCTCCACCATGTCGCCCCCGCCCACCACCACTATTGA
[0091] >Cuticleprotein 18.6,isoform B-Contig09433 ofT.xiaojinensis(SEQ IDNO.22)
[0092] ATGTTCAGCAAAATCTTAGTTCTCACCGCCCTAGTGGCAGCTACCTACGGACACGGCCACGCCATCTCCTCCCAAAGCTACGTACTCCACGGCGGTCATGGGCATGGCGGCTACGGTGGGGCCGGAATCAATGGAGCCGGTGACGGCTTCGGTGGTGAAGGTCATGACTTCGGTGGTGCCGGTCACGGCTTCGGTGGTGCCGGTGACGGCTTCGCTGGAGCTGGTAACGGCTTCGGTGGGGGCGATCACGGCTTCGGTGGTGCCGGTAAGGGTTACGGTGGTGCCGGTGACGGCTTTGCTGGTGTCGGCAACGGCTTCGGCGGAGGTGATCTCGGCTTTGGTGGAGCCGGTCACGGCTACACGGCCGCTGTAGTCCATGCCGCTCCCGTAGTCCACGCTGCCCCAGCTCATCATGTTGAGGAAATTCACCATCATCCCAAATACGACTTCGCCTACTCGGTTGCGGACCCCCACACAGGAGATAAGAAAAGCCAACACGAGTCCCGCGATGGAGACGTCGTCCACGGCTACTACTCCCTGGTTCAACCTGATGGCTCCGTGCGCAAGGTCGATTACACCGCGGATAAACACCACGGCTTCAACGCGGTGGTGCACACGTCGGCTCCTCTCCACCACATAGTTCCAGAACATCACGCCGCTCCGGCTCACCATCATTACTGA
[0093] >Cuticleprotein 18.6,isoform B-Contig09434 ofT.xiaojinensis(SEQ IDNO.23)
[0094] ATGTTCAGTAAAATCTTTGCTCTTTCCGCCTTGGTGGCTGCGGCCCAGGCCGGATACGCACCTATCGGATACGGACACGGACATGGCGCCGCCGTCTCTTCCCAGAGCATCGTCCGCCACGACGGCCACGGCTACGGAGGATACGCTGGAGCCGGTCACGGCTACGGAGGATACGGTGAAGCCGATCTCGGCTACGCCGGTCTCGCCCACGGTTACGCCGCTCCCCTCGCCCATGCTTATGCCGCTCCCATCGTCCACGCCGCTCCAGTCGCCTACGCCGCCCCAGTAGCCTACGCCGCCCATGGTGACGAATATAGCCACCCCAAATACGATTTCGCATACTCCGTGTCTGACCCGCACACCGGCGACAGCAAGAGCCAGCACGAGTCCCGCGACGGAGACGCCGTCCACGGCTCCTACTCCCTGGTGCAGCCTGATGGCTCCGTGCGCAAGGTCGACTACTCCGCTGATGACCACAGCGGTTTCAACGCCGTGGTGCACACATCCGCTCCCCTCCACCACGTCGCTCCCGCCCACCACCATTACTGA
[0095] >Cuticleprotein 18.6,isoform B-Contig07345 ofT.xiaojinensis(SEQ IDNO.24)
[0096] ATGTTCAGCAAAATCTTAGCTATTACCGCCTTGGTGGCTGCGGCCAACGCAGTCTACCCTCCCATCGTAGCACACGCCGGACATGGACAGGGATACGGCGCTGCCGTCTCCTCCCAGAGCGTCGTCCACCACGGTGGCTACGCTGGTGTCGGCCACGGACTCGCCGCTCCTCTTGCCCACGGTTACCCCGCTCCCCTGGCCCACGGTTACGCCGCTCCCCTGGCTCACGGTTACGCCGCTCCTCTGGGTCACGGTTACGCCGCTCCCATTTCCCATGCCGCTTCCGTCGTCCACGCCGCTCCTCTTACCCACGCTTACGCCGCTCCCGTCGTCCACGCCGCTCCGGCAGTCCACGCCTATGCTGCCCCAGTAGCCGTTGAGGCATACAGCCATCCCAAGTACGACTACGCCTACTCCGTGTCGGACCCGCACACCGGCGACAGCAAGAGCCAGCACGAGTCCCGCGACGGAGACGCCGTCCACGGCTCCTACTCCCTGGTGCAGCCTGATGGCTCCGTACGCAAGGTCGACTACTCCGCCGATGACCACAGCGGTTTCAACGCCGTGGTACACACATCCGCTCCCCTCCACCACGTCGCCCCCGCCCACCATCATTATTGA
[0097] >Cuticleprotein 18.6,isoform B-Contig07346 ofT.xiaojinensis(SEQ IDNO.25)
[0098] ATGTTCAGCAAAATCCTAGCTCTAACCGCCTTGGTGGCCGCAGCTCACGCGGGCTACGCCCCTATCGTAGTACACGCCGGGTACGGACTCGGACTCGGACACGGTGCCGCCGTCTCTTCCCAGAGCATCGTCAACTACCGTGGTCTCGGCTACGCTGGTGTTGGCCATGGCTACGCCGCACCCCTCGCCCACGGATACGCTGCACCCCTCTCGCAGGGCTACGCCGCTCCCCTCGCCCACGTATACGCTGCTCCCCTCGCCCACGCTTATGCCGCTCCCATCGCCCACGCTGCTTCCGTCGTTCACGCCGCTCCTCTAGTCCACGCCGGACCAGTTGCCCACGGTTACGCCGCCCCAGTAGCCGTTGCTGCCGACACATATGCTCACCCCAAATACGACTACGCATACTCCGTGTCGGACCCGCACACCGGCGACAGCAAGAGCCAGCACGAGTCCCGCGATGGAGACGCCGTCCACGGCTCCTACTCCCTGGTGCAGCCTGATGGCTCCGTGCGCAAGGTCGACTACTCCGCCGATGATCACAGCGGTTTCAACGCTGTGGTGCACACATCTGCTCCCCTCCATCACGTCGCTCCTGCCTACCACCATTACTGA
[0099] >Cuticleprotein 18.6,isoform B-Contig07348 ofT.xiaojinensis(SEQ IDNO.26)
[0100] ATGCGTGCGAGACTGCCAAATTGTATCAGTAAGCGACAACCCGTTGAATCAAATAAAATGTTCGGCAAAATCTTTGCTCTCTCCGCCTTGGTAGCCGCGGCCCAATCAGGTTACGCACCCATCGTAGCCAACGCGGGATACGGACACGGACTCGGTGCTGCCATCTCCTCCCAGAGTATCGTTCGCCACGACGGCCACGGCTACGGTGGATACGCTGGGGCCGGTTACGGCTATGGTGGATACGCTGGAGCCGACATCGGCTACGCCGGTGTCGCCCACGGATACGCCGCTCCCGTAGCCCAAGCTTACGCCGCTCCCGTCGTCCACGCCGCTCCAATCGCCTACGCAGCCCCAGTAGCCTACGCCGCCCACGCTGATGAATACAGCCACCCCAAATACGACTTCGCTTACTCCGTATCGGACCCGCACACCGGCGACAGCAAGAGCCAGCACGAGTCCCGCGACGGAGACGCCGTCCATGGCTCCTACTCTCTGGTGCAGCCTGATGGCTCCGTACGCAAGGTCGACTACTCCGCTGACGATCACAGCGGTTTCAACGCCGTGGTGCACACATCCGCTCCCCTCCATCACGTCGCTCCCGCTCACCACCATTATTGA
[0101] >Cuticleprotein 18.6,isoform B-Contig09398ofT.xiaojinensis(SEQ IDNO.27)
[0102] ATGATTGGTACAGTTTTGGTAATTGCTTTCGGCGCGCTGGTCAGTCAGTTGACAGAGGCGGTTCCTGTTCACGGACATCCGTATGGCGTTGATTATTATGATCATCCCAAGTACTCATTCAACTACGGCGTGGCGGACCACACGACGGGGGATGTCAAATCTCAGCATGAAACGAGGGATGGGGGAGTCGTAAAAGGACAATATTCCTTGGTAGAACCAGACGGATCGGTACGTACGGTAGACTACGTGGCGGATCCCATTCATGGATTCAACGCCGTGGTTTCCAAAACTGGACCCAGCCTCCACCACGCGCCCATCGTCGCCAAGCCCGTGGCTGTACCGGTGCCCGTGCTGAAGCCGGTGTACACCAGCATCCACAAACCTATCGTGTATGCAGCACCCACGCCTTTAGTTTACACGAAGGCTGGGCATTACGACGGCCACCTGCAATACAATGACTACGACGCCGGATACGGACAATTTCAAGGCGGACATAATCACTACTACTAG。
Claims
1. A gene that can regulate the transformation of Cordyceps sinensis from blastospores to hyphae, characterized in that: Its Flightin The nucleotide sequence of the gene is shown in SEQ ID NO.
8.
2. The siRNA for knocking down the gene expression according to claim 1, characterized in that The sequence of the siRNA is Flightin -1: TAATACGACTCACTATAGGG GCAAATGATGTGAAAACCTC, Flightin -2: GAGGTTTCACATCATTTGC CCCTATAGTGAGTCGTATTA, Flightin -3: TAATACGACTCACTATAGGGGAGGTTTCACATCATTTGC and Flightin -4: GCAAATGATGTGAAACCTC CCCTATAGTGAGTCGTATTA, the English letters represent the copy number of the gene, and the Arabic numerals represent the sense upper strand -1, sense lower strand -2, antisense upper strand -3, and antisense lower strand -4 of the siRNA in each copy of the gene.
3. Use of siRNA that reduces the expression level of the gene according to claim 1 in promoting the transformation of Cordyceps sinensis from blastospores to hyphae.
4. Use of siRNA that reduces the expression level of the gene according to claim 1 in the preparation of a preparation for promoting the rigidification of bat moth larvae carrying Cordyceps sinensis.
5. A method for promoting the rigidification of bat moth larvae, characterized in that: The siRNA of the gene according to claim 1 is introduced into the bat moth larvae carrying Cordyceps sinensis to promote the rigidification of the bat moth larvae.
6. The method according to claim 5, characterized in that The siRNA is the siRNA according to claim 2.
7. The method according to claim 5, characterized in that The cordyceps sinensis fungus is Ophiocordyceps sinensis ; The bat moth larvae are in their 6th instar.