BnPHE2.A05 gene SNP molecular marker and its application

Abstract

The present invention belongs to the technical field of molecular marker-assisted breeding, and particularly relates to the SNP molecular marker of the BnPHE2.A05 gene and its application. The SNP variation located on the BnPHE2.A05 gene of Brassica napus provided by the present invention is located at the 1125th base of the nucleotide sequence shown in SEQ ID NO. 10, which is closely related to the adaptability of Brassica napus to phosphorus deficiency stress. Moreover, different genotypes corresponding to this SNP variation in the natural population have a high consistency with the main root length phenotype of Brassica napus under phosphorus deficiency conditions. It can be developed into an SNP molecular marker for phosphorus deficiency stress resistance of Brassica napus, realizing efficient and accurate discrimination of Brassica napus with tolerance or sensitivity to phosphorus deficiency or low phosphorus environment at the genotype level, shortening the breeding period, providing important support for the breeding of phosphorus-efficient varieties of Brassica napus and germplasm innovation, and having important economic value.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular marker-assisted breeding, and particularly relates to SNP molecular markers of the BnPHE2.A05 gene and their applications. Background Art

[0002] Phosphorus (Pi) is one of the macronutrients essential for plant growth and development. It is not only a component of key macromolecules such as nucleic acids, proteins, and phospholipids, but also plays a role in important physiological and biochemical processes of plants in various ways, including photosynthesis, energy transfer, and signal transduction. Although phosphorus is abundant in the lithosphere, the form of phosphorus absorbed by plants is inorganic phosphate, and the proportion of inorganic phosphate in the soil is very low, it is difficult to dissolve in the soil, and the diffusion is very slow. Therefore, phosphorus deficiency has become a common situation in many agricultural lands. In order to maintain the demand of crops for a large amount of phosphorus, applying phosphate fertilizer has become an important means to increase crop yield. However, the utilization rate of phosphate fertilizer in crop production is only 15.07%. The applied phosphate fertilizer remains in the soil and is difficult to utilize, which not only increases the economic cost, but also causes environmental problems such as soil pollution and water eutrophication. Therefore, in order to increase the absorption and utilization efficiency of phosphorus by crops and reduce the application of phosphate fertilizer, screening for phosphorus-efficient germplasm resources has important theoretical and practical significance.

[0003] Traditional rapeseed breeding is mainly based on direct phenotypic selection, which has problems such as long screening cycle and low breeding efficiency. With the rapid development of molecular biology, molecular marker-assisted breeding technology has been widely used due to its advantages such as selection breeding is not limited by time and geographical factors and the selection process is accurate, rapid and efficient. In recent years, research on phosphorus deficiency stress in Brassica napus L. has also made some progress. For example, Shi et al. used the double haploid population BnaTNDH constructed by Ningyou No. 7 (phosphorus high efficiency) and Tapidor (phosphorus low efficiency) under low-phosphorus and normal-phosphorus conditions on agar to identify 30 quantitative trait loci (QTLs) affecting biomass, total root length, taproot length, lateral root number and lateral root density. Using a high-density linkage map based on SNPs, Zhang et al. detected a total of 131 QTLs affecting root system and biomass traits. Under low-phosphorus and normal-phosphorus conditions, Wang et al. (2017) used an association population consisting of 405 rapeseed varieties to identify 285 significant SNP loci that affect root traits, of which 9 SNPs co-localized with QTLs that control root traits located in the BnaTNDH population. In addition, based on the reported phosphorus utilization-related genes with clear functions in Arabidopsis, researchers have explored the functions of key genes such as the SPX family and the PHT family in rapeseed. Although some progress has been made in the study of the mechanism of phosphorus deficiency stress in rapeseed, most of it remains at the level of genetics and QTL positioning. There are relatively few reports on the cloning of key genes that respond to phosphorus deficiency and the molecular markers of the corresponding genes, which restricts the selection and genetic improvement of rapeseed variety resources with high resistance to phosphorus deficiency stress. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention has discovered a SNP variation located on the BnPHE2.A05 gene of Brassica napus, which is closely related to the adaptability of Brassica napus to phosphorus deficiency stress, and the different genotypes corresponding to the SNP variation in natural populations have high consistency with the taproot length phenotype of Brassica napus under phosphorus deficiency conditions, and can be developed into a SNP molecular marker for phosphorus deficiency stress resistance, so as to achieve efficient and accurate distinction of Brassica napus with tolerance or sensitivity to phosphorus deficiency or low-phosphorus environments at the genotype level, shorten the breeding period, provide important support for the breeding of Brassica napus phosphorus-efficient varieties and germplasm innovation, and have important economic value; therefore, the present invention provides a detection primer or a kit for detecting the SNP variation, and provides the application of the aforementioned detection primer or kit in the detection of Brassica napus phosphorus deficiency stress resistance and a corresponding detection method.

[0005] The present invention is specifically implemented through the following technical solutions:

[0006] The first aspect of the present invention provides an application of a detection primer or kit for detecting the SNP molecular marker of the BnPHE2.A05 gene in the detection of phosphorus deficiency stress resistance of Brassica napus. The SNP molecular marker is located at the 1125th base of the BnPHE2.A05 gene. The nucleotide sequence of the BnPHE2.A05 gene is as shown in SEQ ID NO.10, where W is selected from A or T. In Brassica napus with tolerance to phosphorus deficiency stress, the nucleotide of the SNP molecular marker is A, and in Brassica napus with sensitivity to phosphorus deficiency stress, the nucleotide of the SNP molecular marker is T.

[0007] The second aspect of the present invention provides a detection primer for detecting the SNP molecular marker of the BnPHE2.A05 gene. The detection primer includes an upstream primer 20582474-F, a downstream primer 20582474-R1, and a downstream primer 20582474-R2. The downstream primer 20582474-R1 and the downstream primer 20582474-R2 include an adapter sequence and a genotyping sequence. Among them, the nucleotide sequence of the upstream primer 20582474-F is CTAATGGACACTGATGGGC, the nucleotide sequence of the genotyping sequence of the downstream primer 20582474-R1 is TGAGTTTGATCTTTTGTTCTCA, and the nucleotide sequence of the genotyping sequence of the downstream primer 20582474-R2 is TGAGTTTGATCTTTTGTTCTCT.

[0008] Further, the nucleotide sequence of the adapter sequence of the downstream primer 20582474-R1 is GAAGGTGACCAAGTTCATGCT, and the nucleotide sequence of the adapter sequence of the downstream primer 20582474-R2 is GAAGGTCGGAGTCAACGGATT.

[0009] Further, the nucleotide sequence of the downstream primer 20582474-R1 is GAAGGTGACCAAGTTCATGCTTGAGTTTGATCTTTTGTTCTCA, and the nucleotide sequence of the downstream primer 20582474-R2 is GAAGGTCGGAGTCAACGGATTTGAGTTTGATCTTTTGTTCTCT.

[0010] Further, one end of the downstream primer 20582474-R1 and the downstream primer 20582474-R2 is connected with a fluorescent group, and the fluorescent groups of the downstream primer 20582474-R1 and the downstream primer 20582474-R2 are different.

[0011] The third aspect of the present invention provides a kit for detecting SNP molecular markers of the BnPHE2.A05 gene, and the kit includes the detection primers as described above.

[0012] Further, the molar ratio of the upstream primer 20582474-F, the downstream primer 20582474-R1, and the downstream primer 20582474-R2 is 5:2:2.

[0013] Further, the kit further includes PCR amplification reagents, and the PCR amplification reagents include Master Mix.

[0014] The fourth aspect of the present invention provides a method for detecting the resistance to phosphorus deficiency stress in Brassica napus, including the following steps:

[0015] Using the detection primers as described above, PCR is used to amplify the genomic DNA of Brassica napus, the fluorescence signal during amplification is detected, and the resistance type of the Brassica napus to be detected is judged according to the fluorescence signal;

[0016] Among them, one end of the downstream primer 20582474-R1 is connected to a first fluorescent group, and one end of the downstream primer 20582474-R2 is connected to a second fluorescent group; when only the fluorescence signal of the first fluorescent group is detected, it is determined that the Brassica napus is sensitive to phosphorus deficiency stress, and when only the fluorescence signal of the second fluorescent group is detected, it is determined that the Brassica napus is tolerant to phosphorus deficiency stress. When the fluorescence signals of the first fluorescent group and the second fluorescent group are detected simultaneously, it is determined that the Brassica napus is heterozygous.

[0017] Further, the PCR amplification system includes: 1 μL of DNA template, 5 μL of 2×Master Mix, 1.4 μL of primer mixture, and 2.6 μL of ddH 2 O, the primer mixture includes the upstream primer 20582474-F, the downstream primer 20582474-R1, and the downstream primer 20582474-R2, and the molar ratio of the upstream primer 20582474-F, the downstream primer 20582474-R1, and the downstream primer 20582474-R2 is 5:2:2.

[0018] Further, the PCR amplification program includes: pre-denaturation at 94°C for 15 min; adopting touchdown PCR, denaturation at 94°C for 20 s, annealing at 60°C for 1 min, decreasing from 60°C to 48°C at a rate of 1.2°C per cycle, and cycling 10 times; denaturation at 94°C for 20 s, extension at 50°C for 1 min, cycling 30 times; incubation at 37°C for 1 min, and collecting the fluorescence signal at the last 1 s.

[0019] The advantages and positive effects of the present invention are:

[0020] The SNP variation located on the BnPHE2.A05 gene of Brassica napus provided by the present invention is closely related to the resistance ability of Brassica napus to phosphorus deficiency stress. The phenotypic data of the primary root length of 418 core rapeseed germplasm resources under phosphorus-deficient culture conditions were statistically analyzed, and the corresponding plants were grouped according to the genotypes of the SNP variations. Statistical analysis found that there were obvious phenotypic differences among the plants grouped by different genotypes. A Brassica napus F2 population was constructed for verification, further confirming that the genotype of this SNP variation site was highly consistent with the adaptability of Brassica napus to phosphorus deficiency stress, and it could be developed into a molecular marker for assisted breeding. The present invention provides a new molecular marker for breeding Brassica napus varieties with high resistance to phosphorus deficiency stress that are genetically stable. By detecting the genotype of this molecular marker with the provided primers, it is possible to efficiently and accurately predict the adaptability of Brassica napus germplasm to phosphorus deficiency stress at the genotype level. Screening and identifying phosphorus deficiency-resistant germplasm resources is beneficial to greatly improving the selection efficiency and shortening the breeding cycle, providing important support for phosphorus-efficient breeding of Brassica napus and having important economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0022] Figure 1 It is the association analysis result diagram of different haplotypes of the BnPHE2.A05 gene and the phenotype of Brassica napus in the embodiment of the present invention. Among them, Figure A is the distribution diagram of allelic variations of the BnPHE2.A05 gene in 418 natural materials of Brassica napus; Figure B is the quantitative diagram of the ratio of the primary root length of Brassica napus seedlings under phosphorus deficiency and normal phosphorus culture for different haplotypes of the BnPHE2.A05 gene;

[0023] Figure 2 It is the genotyping result diagram of different SNP sites of the BnPHE2.A05 gene in the embodiment of the present invention. From top to bottom, they are the 20581517 (G / T), 20581556 (C / G), and 20582474 (T / A) variation sites;

[0024] Figure 3 It is the quantitative diagram of the ratio of the primary root length of Brassica napus seedlings under phosphorus deficiency and normal phosphorus culture for different genotypes after genotyping 418 natural populations using the 20582474 (T / A) variation site in the embodiment of the present invention;

[0025] Figure 4This is the genotyping result diagram of the Brassica napus F2 population using the 20582474(T / A) molecular marker locus in the embodiments of the present invention;

[0026] Figure 5 This is the main root length statistical chart of the Brassica napus F2 population with different genotypes in the embodiments of the present invention. Detailed implementation manners

[0027] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below in conjunction with embodiments. The equipment and reagents used in each embodiment and test example can be obtained from commercial channels without special instructions. The specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0028] Based on the information contained in this application, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for schematically illustrating specific aspects of the present invention. In fact, various changes that can be made by those skilled in the art or related fields to the embodiments of the present invention are all covered by the scope of the appended claims.

[0029] In order to better understand the present invention rather than limit the scope of the present invention, all numbers representing amounts, percentages, and other numerical values used in this application should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should at least be regarded as obtained according to the reported significant figures and by the conventional rounding method.

[0030] To make the above objectives, features and advantages of the present invention more obvious and understandable, the detailed implementation manners of the present invention will be described in detail below.

[0031] The present invention identifies the resistance or tolerance ability of 418 Brassica napus germplasm resources to phosphorus deficiency stress. Using the main root length of rapeseed seedlings under phosphorus deficiency stress as phenotypic data and combining with the sequencing data of 418 Brassica napus germplasm resources, genome-wide association analysis (GWAS) was carried out to screen the phosphorus deficiency response candidate gene BnPHE2.A05 and the SNP loci significantly associated with the main root length phenotype on this gene. Primers were designed for multiple SNP loci for verification, and it was found that the phenotypes of plants with different genotypes at the 20582474(T / A) variant locus in the reference genome were significantly different, reflecting different adaptabilities to the phosphorus-deficient environment, confirming that the genotype of the 20582474(T / A) variant locus is closely related to the resistance ability of Brassica napus to phosphorus deficiency stress and significantly affects the main root length of Brassica napus under phosphorus-deficient culture conditions. Further, using phosphorus deficiency stress-tolerant Brassica napus and phosphorus deficiency stress-sensitive Brassica napus and their F2 segregation populations constructed as parents, molecular marker authenticity and reliability verification were carried out, and the results showed that this SNP variant locus could divide different plants into three types: homozygous genotype AA, homozygous genotype TT, and heterozygous genotype AT. The adaptability to phosphorus deficiency stress among the three types was significantly different, with the main root length of rapeseed germplasm with the AA genotype in the phosphorus-deficient medium being significantly higher than that of rapeseed germplasm with the TT genotype, further confirming that the genotype of this SNP variant locus has a high consistency with the resistance of Brassica napus to phosphorus deficiency stress. Therefore, the 20582474(T / A) variant locus of the present invention can be independently developed into a molecular marker for assisted breeding, providing a new and reliable molecular marker for breeding rapeseed varieties with high adaptability to phosphorus deficiency stress with genetic stability and enriching the genetic resources for breeding phosphorus-efficient rapeseed germplasm. By detecting the genotype of this molecular marker, it is possible to efficiently and accurately predict the resistance or tolerance of Brassica napus germplasm to phosphorus deficiency stress at the genotype level. Specifically, when the SNP variant locus in the rapeseed germplasm to be tested is detected as the "AA" genotype, it can be judged as a phosphorus deficiency stress-tolerant variety, and when the SNP variant locus in the rapeseed germplasm to be tested is detected as the "TT" genotype, it can be judged as a phosphorus deficiency stress-sensitive variety. Using the molecular marker of the present invention for screening and identifying phosphorus deficiency highly resistant germplasm resources is not limited by environmental factors and breeding time, which is conducive to greatly improving the selection efficiency and shortening the breeding period, providing important support for phosphorus-efficient breeding of Brassica napus and having important economic value.

[0032] The above-mentioned 20582474(T / A) variant locus is located at the physical position of 20582474 bp on chromosome A05G of the Darmor.v4.1 reference genome, with an allelic genotype variation of T->A compared to the reference genome; specifically, it is located at the 1125th base in the coding region of the forward sequence of the BnPHE2.A05 gene (the sequence is shown in SEQ ID NO.10).

[0033] The BnPHE2.A05 protein is a type of protein kinase that can phosphorylate ribosomal protein subunit S6 and belongs to the threonine / serine kinase family. It mainly regulates ribosome biosynthesis and protein synthesis through the TOR (target of rapamycin) and PDK-1 (phosphoinositide-dependent kinase-1) signaling pathways. In rapeseed, the BnPHE2.A05 gene may be involved in regulating the distribution of phospholipids to phosphorus-free galactolipids in plants under phosphorus deficiency stress, and redistributing phosphorus in the body to maintain the most basic growth and development of plants under phosphorus-deficient conditions.

[0034] Based on the above findings, an embodiment of the present invention provides an application of a detection primer or kit for detecting SNP molecular markers of the BnPHE2.A05 gene in the detection of phosphorus deficiency stress resistance in Brassica napus; the SNP molecular marker is located at the 1125th base of the BnPHE2.A05 gene, and the nucleotide sequence of the BnPHE2.A05 gene is as shown in SEQ ID NO.10, where W is selected from A or T; in Brassica napus with tolerance to phosphorus deficiency stress, the nucleotide of the SNP molecular marker is A, and in Brassica napus sensitive to phosphorus deficiency stress, the nucleotide of the SNP molecular marker is T.

[0035] Based on the same inventive concept, another embodiment of the present invention provides a detection primer for detecting SNP molecular markers of the BnPHE2.A05 gene. The detection primer includes an upstream primer 20582474-F, a downstream primer 20582474-R1, and a downstream primer 20582474-R2. The nucleotide sequence of the upstream primer 20582474-F is "CTAATGGACACTGATGGGC", and the downstream primers 20582474-R1 and 20582474-R2 include an adapter sequence and a genotyping sequence. The nucleotide sequence of the genotyping sequence of the downstream primer 20582474-R1 is "TGAGTTTGATCTTTTGTTCTCA", and the nucleotide sequence of the genotyping sequence of the downstream primer 20582474-R2 is "TGAGTTTGATCTTTTGTTCTCT". The shaded part shows the genotyping site.

[0036] The present invention is based on the Kompetitive Allele-Specific PCR (KASP) technology, and detection primers for detecting the above SNP molecular markers are designed. The detection primers include three primer sequences: an upstream universal primer 20582474-F and two downstream genotyping primers 20582474-R1 and 20582474-R2. The downstream primers include a linker sequence and a genotyping sequence. The linker sequence is used to connect a fluorescent group, and the two downstream primers are respectively connected with different fluorescent groups. The genotyping sequence consists of a universal sequence and a genotyping site. The genotyping sequences of the upstream primer and the downstream primers are used to specifically amplify the target gene, and the genotyping site located at the end is used to specifically match different alleles of the SNP molecular marker. Thus, the genotype of the SNP can be distinguished according to the color signal of the detected fluorescent group, and then it can be quickly determined whether the tested Brassica napus has the advantageous haplotype of the BnPHE2.A05 gene and its phenotype under phosphorus-deficient conditions.

[0037] Taking 20582474-R1 with the first fluorescent group and 20582474-R2 with the second fluorescent agent group as an example, when only the fluorescent signal of the first fluorescent group is detected, the genotype of the SNP site is TT, and it is determined that the tested Brassica napus is a phosphorus-deficient stress-sensitive variety. When only the fluorescent signal of the second fluorescent group is detected, the genotype of the SNP site is AA, and it is determined that the tested Brassica napus is a phosphorus-deficient stress-tolerant variety. When the fluorescent signals of both the first fluorescent group and the second fluorescent group are detected simultaneously, the genotype of the SNP site is AT heterozygous, and the phenotype is between phosphorus-deficient stress sensitivity and tolerance.

[0038] The linker sequence on the downstream primer is usually adaptively selected according to the type of the fluorescent group. For example, the linker sequence of the FAM fluorescent group is GAAGGTGACCAAGTTCATGCT, and the linker sequence of the HEX fluorescent group is GAAGGTCGGAGTCAACGGATT.

[0039] In a preferred embodiment, the nucleotide sequences of the detection primers are as follows. The underlined part is the linker sequence, and the shaded part is the genotyping site:

[0040] 20582474-F: CTAATGGACACTGATGGGC (see SEQ ID NO.7);

[0041] 20582474-R1: GAAGGTGACCAAGTTCATGCT TGAGTTTGATCTTTTGTTCTCA (see SEQ ID NO.8);

[0042] 20582474-R2: GAAGGTCGGAGTCAACGGATTTGAGTTTGATCTTTTGTTCTCT (see SEQ ID NO.9).

[0043] Another embodiment of the present invention provides a kit for detecting SNP molecular markers of the BnPHE2.A05 gene, and the kit includes the detection primers as described above.

[0044] The advantages of the kit over the prior art are the same as those of the detection primers over the prior art as described above, and will not be elaborated here.

[0045] Optionally, the molar ratio of the upstream primer 20582474-F, the downstream primer 20582474-R1, and the downstream primer 20582474-R2 is 5:2:2.

[0046] Optionally, the kit further includes PCR amplification reagents. The present invention has no special limitation on the source of the PCR amplification reagents, and conventional commercially available products in the art can be used.

[0047] In a typical embodiment, the PCR amplification reagents include Master Mix (reagent manufacturer: Wuhan Jingtai Biotechnology Co., Ltd., product number: E001-3).

[0048] The present invention has no special limitation on the total amount of the PCR amplification reagents and the dosage of the primers in the kit, and they can be set according to the conventional requirements of the kit.

[0049] Based on the same inventive concept as above, another embodiment of the present invention provides a method for detecting the resistance of Brassica napus to phosphorus deficiency stress, including the following steps:

[0050] Using the detection primers as described above (shown in SEQ ID NO.7-9), PCR amplification is performed on the genomic DNA of Brassica napus, the fluorescence signal during amplification is detected, and the resistance type of the Brassica napus to be detected is judged according to the fluorescence signal;

[0051] Among them, one end of the downstream primer 20582474-R1 is connected to a first fluorescent group, and one end of the downstream primer 20582474-R2 is connected to a second fluorescent group; when only the fluorescent signal of the first fluorescent group is detected, the Brassica napus does not have the dominant haplotype of the BnPHE2.A05 gene, that is, the allele at the 20582474(T / A) locus is T, and it is determined as a phosphorus deficiency stress-sensitive variety. When only the fluorescent signal of the second fluorescent group is detected, the Brassica napus has the dominant haplotype of the BnPHE2.A05 gene, that is, the allele at the 20582474(T / A) locus is A, and it is determined as a phosphorus deficiency stress-tolerant variety. When the fluorescent signals of the first fluorescent group and the second fluorescent group are detected simultaneously, it is determined that the Brassica napus shows a heterozygous type, and its phenotype is between the sensitive type and the tolerant type.

[0052] The present invention only requires two steps of ordinary PCR amplification and fluorescent signal detection to efficiently distinguish the resistance ability of the Brassica napus to be tested to phosphorus deficiency stress at the genotype level, and has the advantages of low cost, high throughput, and good accuracy.

[0053] The present invention does not specifically limit the method for extracting the genomic DNA of the Brassica napus to be tested, and any commonly used genomic DNA extraction method or genomic DNA extraction kit in the art can be used, such as the CTAB extraction method.

[0054] Optionally, taking the PCR amplification system as 10 μL, it includes: 1 μL of DNA template, 5 μL of 2×Master Mix, 1.4 μL of primer mixture, and 2.6 μL of ddH 2 O. The primer mixture includes the upstream primer 20582474-F, the downstream primer 20582474-R1, and the downstream primer 20582474-R2, and the molar ratio of the upstream primer 20582474-F, the downstream primer 20582474-R1, and the downstream primer 20582474-R2 is 5:2:2.

[0055] The PCR amplification program includes: pre-denaturation at 94 °C for 15 min; adopting the touchdown PCR method, denaturation at 94 °C for 20 s, annealing at 60 °C for 1 min, and decreasing from 60 °C to 48 °C at a rate of 1.2 °C per cycle for 10 cycles; denaturation at 94 °C for 20 s, extension at 50 °C for 1 min for 30 cycles; incubation at 37 °C for 1 min, and collecting the fluorescent signal in the last 1 s.

[0056] The present invention will be further described below in conjunction with specific embodiments. For the experimental methods without specific conditions noted in the following embodiments, they are usually carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory, or usually according to the conditions recommended by the manufacturer.

[0057] Germplasm resources: The 418 Brassica napus L. germplasm resources of the present invention are from the "National Medium-Term Genebank of Oil Crop Germplasm Resources", a national public welfare and basic research sharing platform. This medium-term genebank is managed and operated by the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences. The Brassica napus germplasm resources used in the present invention can also be obtained by signing the "Agreement on the Utilization of Rapeseed Germplasm Resources" with the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences and filling out the "Registration Form for the Utilization of Rapeseed Germplasm Resources".

[0058] Information on relevant germplasm resource varieties and their sequencing data are recorded in the article "Hu J, Chen B, Zhao J, et al., Genomic selection and genetic architecture of agronomic traits during modern rapeseed breeding. Nature Genetics [J]. 2022 May; 54(5): 694 - 704. doi: 10.1038 / s41588 - 022 - 01055 - 6."

[0059] Reference genome: The Brassica napus Darmor.v4.1 genome is used as the reference genome. The Brassica napus Darmor.v4.1 genome data can be freely obtained from the Brassica napus multi - omics information resource library BnIR (database access link: https: / / yanglab.hzau.edu.cn / BnIR). Brassica napus Darmor.v4.1 genome access link: https: / / yanglab.hzau.edu.cn / static / bnir / assets / / genomic_sequence / BnIRData / AACC.Brassica_napus / Darmor / v4.1 / Brassica_napus.Darmor.v4.1.genome.fa.gz.

[0060] 1. Screening of candidate gene BnPHE2.A05 based on genome - wide association analysis

[0061] Using 418 publicly available Brassica napus sequencing data (the original sequencing data is released in the SRA (Sequence Read Archive) repository in NCBI, project number PRJNA416679, and in the GSA (Genome Sequence Archive) database of the BIG Data Center, project number CRA005979), combined with the phenotypic data of 418 core rapeseed germplasm resources under different phosphorus content treatments, genome-wide association analysis was carried out to screen for the candidate gene BnPHE2.A05 closely associated with phosphorus stress response and the natural variations located at this locus, and it was found that there were multiple SNP variations at the BnPHE2.A05 locus significantly correlated with the adaptive phenotypes of Brassica napus seedlings to phosphorus deficiency stress. The analysis steps are as follows:

[0062] (1) Identification of root phenotypes of rapeseed seedlings under phosphorus deficiency stress

[0063] Phosphorus element plays an important role in plant growth. Especially in promoting root development, phosphorus can promote the branching and cell division of plant roots, promote root hair growth, increase the absorption area of plant roots, and thus improve the nutrient absorption ability of plants; phosphorus can also affect the number and length of plant root hairs, as well as the rate of ion absorption by roots. Therefore, in this invention, the root length under different phosphorus content treatments is used as the response index of Brassica napus to phosphorus element. The difference in root length reflects to a certain extent the strategy differences of different rapeseeds in adapting to low-phosphorus environments. The external manifestation of rapeseed resources tolerant to low phosphorus or phosphorus deficiency stress on plants is that the main root length under low phosphorus or phosphorus deficiency conditions does not significantly shorten compared with normal conditions, that is, it can still maintain a certain main root length under low phosphorus conditions; while the external manifestation of rapeseed resources sensitive to low phosphorus or phosphorus deficiency stress on plants is that the main root length under low phosphorus or phosphorus deficiency conditions significantly shortens compared with normal conditions.

[0064] Phenotypic identification of 418 Brassica napus germplasm resources was carried out under phosphorus deficiency stress and normal phosphorus conditions. The methods for planting and treating the materials include the following steps:

[0065] a) Sterilization: Put 100 mL of 84 disinfectant and 4.5 mL of concentrated hydrochloric acid in a sealed desiccator. Take 24 seeds of each material and put them into a 2 mL centrifuge tube. Open the tube cap and put it into the desiccator for sterilization for 2 h;

[0066] b) Pretreatment: Add sterile ultrapure water and place it in a 4 °C refrigerator overnight for imbibition;

[0067] c) Phosphorus treatment: Take 12 seeds each and place them into 4 mL of 1 / 2 MS liquid medium containing phosphorus (phosphorus concentration is 0.625 mM) and 4 mL of phosphorus-deficient (phosphorus concentration is 0 mM) medium respectively. Incubate them with shaking in a constant temperature light incubator at 20 °C for 12 d. The phosphorus concentration is adjusted with potassium dihydrogen phosphate;

[0068] d) Phenotypic data statistics: Measure the hypocotyl length and root length of the germinated seeds, excluding the ungerminated and contaminated seeds. A total of about 400 material data are obtained. Calculate the ratio of primary root length -P / +P under phosphorus-containing (+P) and phosphorus-deficient (-P) conditions based on the above data.

[0069] (2) Conduct a genome-wide association study by combining genotype data with phenotypic data

[0070] Use TASSEL ver 4.0 software to combine genotype data with phenotypic data of rapeseed seedling root traits under normal phosphorus level and phosphorus-deficient stress treatment, and conduct a genome-wide association study (GWAS). Adopt the principal component analysis matrix (PCA, P) and kinship matrix (kinship, K) models. Use the qqman package of R software to draw the Manhattan plot for the results of the association analysis, and select the most suitable association analysis model (P+K) according to the results of the QQ plot (quantile - quantile plot). The threshold for SNP loci significantly associated with the ratio of primary root length -P / +P is -log10(1 / 2422839) = 6.4, where 2422839 is the total number of SNP markers in the population; at the same time, to avoid missing some minor-effect loci, SNP loci with 4 < -log10(p) < 6.4 are defined as potentially associated loci. Use the LDheatmap package of R software to identify the quantitative trait locus (QTL) segments associated with the primary root length -P / +P, and extract the genes and their base sequences on the QTL segments from the Brassica napus genome database (http: / / www.genoscope.cns.fr / brassicanapus / ). Further retrieve the homologous genes of the genes on this segment in the Arabidopsis thaliana genome (https: / / www.arabidopsis.org / ), and conduct identification and analysis on all genes on the associated QTL segments according to the functional annotation information of Arabidopsis thaliana genes to obtain the candidate gene BnPHE2.A05 related to low phosphorus response. The SNP locus variation information on the BnPHE2.A05 gene is summarized in Table 1.

[0071] Table 1 SNP locus variation information on the BnPHE2.A05 gene

[0072]

[0073] Note: The meanings of each column category in the table are as follows. Type: Mutation type; Pos: Physical position on the genome; Dis to ATG: Physical distance from the start codon; Ref: Reference genotype; Alt: Variant genotype. H1 - H4 are four different haplotype types at this locus.

[0074] According to the linkage of SNP locus variations on the BnPHE2.A05 gene, the gene structure of BnPHE2.A05 can be divided into 4 haplotypes (Hap), named H1, H2, H3, and H4 respectively. And 418 tested Brassica napus varieties were divided into five groups. Using the ratio of main root length - P / +P as the phenotypic value, a one - way ANOVA test for groups was conducted. The relevant results are shown in Figure 1 , where Figure A shows the distribution sites of allelic variations of the BnPHE2.A05 gene, and Figure B shows the ratio of main root length of Brassica napus seedlings with different haplotypes of the BnPHE2.A05 gene under phosphorus - deficient and normal phosphorus cultivation. It can be seen from the figure that Brassica napus with different haplotypes shows different root lengths in the phosphorus - deficient medium, indicating that under phosphorus - limited conditions, different haplotype rapeseeds show differences in root length and have different phosphorus - deficiency response abilities. And the rare allelic variation (haplotype H2) of BnPHE2.A05 can significantly improve the adaptability of Brassica napus seedlings to phosphorus - deficiency stress and maintain a longer main root length under phosphorus - deficient conditions, which is beneficial to enhancing the resistance of rapeseed to low - phosphorus conditions.

[0075] Among the 418 materials, there are 8 materials with the dominant haplotype H2, and their names are as follows: W0584, W0626, W0664, W0672, W0722, W0875, W0953, W1521.

[0076] 2. Development of molecular markers based on SNP variations on the dominant haplotype H2

[0077] Based on the above analysis, there are 34 SNP site differences between the dominant haplotype 2 (H2) and the other four haplotypes at the BnPHE2.A05 locus. Primers were designed according to these sites to verify the genotyping effect. Primers for some sites could not be used due to reasons such as mismatching and high GC content. Competitive allele - specific PCR (KASP) primers were designed for the available sites, and these sites are as follows: 20581517 (G / T), 20581556 (C / G), and 20582474 (T / A). Three non - dominant haplotype materials (W0692, W0942, W0954) and three dominant haplotype materials (W0953, W1521, W0722) were selected for PCR amplification.

[0078] The KASP amplification primer sequences for the 20581517 (G / T) locus are as follows:

[0079] 20581517-F1: FAM- GAAGGTGACCAAGTTCATGCT ACGTCGCTTTCGACGAGCCG (see SEQ ID NO.1);

[0080] 20581517-F2: HEX- GAAGGTCGGAGTCAACGGATT ACGTCGCTTTCGACGAGCCT (see SEQ ID NO.2);

[0081] 20581517-R: GTGATCAGAGAGGGTCCAACCAAGG (see SEQ ID NO.3);

[0082] The KASP amplification primer sequences for the 20581556 (C / G) locus are as follows:

[0083] 20581556-F1: FAM- GAAGGTGACCAAGTTCATGCT CACTCCTTGGTTGGACCC (see SEQ ID NO.4);

[0084] 20581556-F2: HEX- GAAGGTCGGAGTCAACGGATT CACTCCTTGGTTGGACCG (see SEQ ID NO.5);

[0085] 20581556-R: CTTCTTCGAGGCATTCCAC (see SEQ ID NO.6);

[0086] The KASP amplification primer sequences for the 20582474 (T / A) locus are as follows:

[0087] 20582474-F: CTAATGGACACTGATGGGC (see SEQ ID NO.7);

[0088] 20582474-R1: FAM- GAAGGTGACCAAGTTCATGCT TGAGTTTGATCTTTTGTTCTCA (see SEQ ID NO.8);

[0089] 20582474-R2: HEX- GAAGGTCGGAGTCAACGGATT TGAGTTTGATCTTTTGTTCTCT (see SEQ ID NO.9);

[0090] In the above primer sequences, F represents the upstream primer, R represents the downstream primer, the underlined part is the fluorescent linker sequence, the fluorescent group is connected upstream of the fluorescent linker sequence, FAM represents the FAM fluorescent group, and HEX represents the HEX fluorescent group.

[0091] The PCR amplification system is calculated based on 10 μL and contains: 1 μL of DNA template, 5 μL of 2× Master Mix (reagent manufacturer: Wuhan Jingtai Biotechnology Co., Ltd., product number: E001-3), 1.4 μL of primer mixture (mix containing forward and reverse primers), and 2.6 μL of ddH 2 O. In the primer mixture, the molar ratio of the forward and reverse primers at the 20581517 (G / T) and 20581556 (C / G) sites is F1:F2:R = 2:2:5, including 12 μL of F1 primer (10 μM), 12 μL of F2 primer (10 μM), 30 μL of R primer (10 μM), and 46 μL of ddH 2 O; the molar ratio of the forward and reverse primers at the 20582474 (T / A) site is F:R1:R2 = 5:2:2, including 30 μL of F primer (10 μM), 12 μL of R1 primer (10 μM), 12 μL of R2 primer (10 μM), and 46 μL of ddH 2 O.

[0092] The PCR amplification program includes: 94°C for 15 min; adopting touchdown PCR, 94°C for 20 s, 60°C for 1 min, decreasing from 60°C at a rate of 1.2°C per cycle to 48°C, with 10 cycles; 94°C for 20 s, 50°C for 1 min, with 30 cycles; 37°C for 1 min, and collecting fluorescence signals at the last 1 s.

[0093] The genotyping results of different SNP sites on the BnPHE2.A05 gene are as Figure 2 shown, where the horizontal and vertical coordinates are different fluorescence channels, and different colors of fluorescence reflect different allelic variations. Taking the 20582474 (T / A) site as an example, when only FAM green fluorescence is detected, the genotype of this site is "TT"; when only HEX red fluorescence is detected, the genotype of this site is "AA"; when both green and red fluorescence are detected, the genotype of this site is the heterozygous "AT" genotype. It was found that the two sites 20581517 (G / T) and 20581556 (C / G) could not well divide different phenotypic plants into corresponding population clusters, while the primer genotyping effect of 20582474 (T / A) was good, and two phenotypic Brassica napus could be distinguished according to the "TT" and "AA" genotypes of this site.

[0094] In addition, the genotypes of W0692, W0942, and W0954 at the physical position of 20582474 bp are TT, and the phenotypes are phosphorus deficiency sensitivity. In the phosphorus-deficient medium, their tolerance is poor, the growth of the main root after seed germination is restricted, and the root length is short; the genotypes of W0953, W1521, and W0722 at the physical position of 20582474 bp are AA, showing high adaptability to phosphorus deficiency conditions. In the phosphorus-deficient medium, there is no obvious change in their root length compared with the normal medium, and the consistency between the actual phenotype and the genotype prediction results is shown at the 20582474(T / A) SNP locus.

[0095] Furthermore, 418 natural populations were grouped according to the different genotypes of the 20582474(T / A) variation site, and the main root length - P / +P ratio was statistically analyzed. The results are shown in Figure 3 . It can be seen that the differences in the main root length ratios of different genotypes after genotyping 418 natural populations using the 20582474(T / A) variation site are obvious under phosphorus deficiency and normal phosphorus cultivation, and there is a high correlation between the genotype and the phenotype. The main root length ratio of the population with the genotype AA is significantly higher than that of the population with the genotype TT.

[0096] Therefore, the 20582474(T / A) variation site on the BnPHE2.A05 gene in the present invention can be used as an independent test factor and developed into a molecular marker for the adaptability of Brassica napus to phosphorus deficiency conditions, and can be used in fields such as the auxiliary screening of germplasm resources highly resistant to phosphorus deficiency stress and the cultivation of new germplasm resources.

[0097] In this example, a functional SNP molecular marker was developed for the SNP locus 20582474(T / A) on the BnPHE2.A05 gene. There are three allelic genotypes at this locus: AA, TT, and AT. Among them, the "AA" genotype is the phosphorus deficiency tolerance genotype, the "TT" genotype is the phosphorus deficiency sensitivity genotype, and the "AT" genotype is between the tolerant and sensitive materials. The 20582474(T / A) molecular marker is located at the physical position of 20582474 bp on chromosome A05G of the Darmor.v4.1 reference genome, and there is an allelic genotype variation of T->A compared with the reference genome Darmor.v4.1. More specifically, the nucleotide sequence of the BnPHE2.A05 gene is as follows. The SNP locus 20582474(T / A) in this example is specifically located at the 1125th base "W" (shown in bold and shaded) of the BnPHE2.A05 gene (the sequence shown in SEQ ID NO.10), where W = A or T. The sequence of the BnPHE2.A05 gene (including introns and exons) is as follows:

[0098]

[0099] 3. Group Validation of SNP Molecular Markers

[0100] Population construction: The phosphorus-deficient tolerant Brassica napus plant W1521 with the superior haplotype H2 and the phosphorus-sensitive Brassica napus plant W942 with the non-superior haplotype identified were hybridized. After harvesting F1, the F1 was planted and bagged for self-crossing to harvest the F2 population. Approximately 1000 seeds of the F2 population were harvested from each F1 plant, and 94 plants were randomly selected for genotype and phenotype verification.

[0101] Genotype identification: The genomic DNA of 94 F2 populations was extracted and amplified using the KASP amplification primer at the 20582474 (T / A) locus. According to the fluorescence signal detection results, the genotypes of the 94 plants were typed, and the typing results were verified by sequencing with high accuracy.

[0102] Figure 4 The genotyping result diagram of 94 F2 Brassica napus in the present invention is shown. Among them, GenotypeⅠ is the AA genotype, Genotype II is the AT genotype, and GenotypeⅢ is the TT genotype. The 94 F2 populations were divided into 24 plants with the "AA" genotype, 50 plants with the "AT" genotype, and 20 plants with the "TT" genotype according to the "AA" genotype, and the ratio is approximately 1:2:1, which conforms to the genetic segregation ratio of the F2 population.

[0103] Phenotype identification: According to the genotyping results, the primary root length of each group of populations was measured under phosphorus-deficient conditions. The F2 plants, as well as the seeds of the male and female parents, were sown on 1 / 2MS solid medium without phosphorus (0 mM Pi) and cultured in a constant temperature light incubator at 20 °C for 7 days, and then the primary root length was measured.

[0104] The statistical data results of the primary root length are shown in Figure 5 , where the abscissa is different genotypes, GenotypeⅠ is the AA genotype, Genotype II is the AT genotype, GenotypeⅢ is the TT genotype, and the ordinate is the primary root length (unit: cm). The results show that there are significant differences in the primary root length among the three genotype populations. Root length is an important indicator of plant root development, and the difference in root length reflects the difference in the ability of different genotype rapeseeds to adapt to low-phosphorus or phosphorus-deficient environments. GenotypeⅠ is the superior genotype, and the corresponding plants grow well in the phosphorus-deficient medium, which is consistent with the root length phenotype data. Only a very small number of plants with unstable phenotypes are related to the relatively late seed germination and do not affect the accuracy of the population results.

[0105] The above results indicate that using the 20582474 (T / A) molecular marker genotype to distinguish the phenotypic traits of Brassica napus in response to phosphorus deficiency stress has high accuracy in the population sample, and there is a high consistency between the genotype and the phenotype. Moreover, the design of the KASP molecular marker can effectively distinguish the tolerance and adaptability of Brassica napus to low phosphorus and phosphorus deficiency environments from the genotype level without being affected by the environment and external factors.

[0106] The above is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An application of a detection primer or a kit for detecting a SNP molecular marker of the BnPHE2.A05 gene in the detection of phosphorus deficiency stress resistance in Brassica napus, characterized in that: The SNP molecular marker is located at the 1125th base of the BnPHE2.A05 gene, and the nucleotide sequence of the BnPHE2.A05 gene is shown in SEQ ID NO.10, wherein W is selected from A or T; In the Brassica napus plant with tolerance to phosphorus deficiency stress, the nucleotide of the SNP molecular marker is A, and in the Brassica napus plant with sensitivity to phosphorus deficiency stress, the nucleotide of the SNP molecular marker is T.

2. The use of the detection primer or kit for detecting the SNP molecular marker of the BnPHE2.A05 gene according to claim 1 in the detection of phosphorus deficiency stress resistance in Brassica napus, characterized in that: The detection primers include an upstream primer 20582474-F, a downstream primer 20582474-R1 and a downstream primer 20582474-R2, wherein the downstream primer 20582474-R1 and the downstream primer 20582474-R2 include a linker sequence and a typing sequence; Among them, the nucleotide sequence of the upstream primer 20582474-F is CTAATGGACACTGATGGGC, the nucleotide sequence of the typing sequence of the downstream primer 20582474-R1 is TGAGTTTGATCTTTTGTTCTCA, and the nucleotide sequence of the typing sequence of the downstream primer 20582474-R2 is TGAGTTTGATCTTTTGTTCTCT.

3. The use of the detection primer or kit for detecting the SNP molecular marker of the BnPHE2.A05 gene according to claim 2 in the detection of phosphorus deficiency stress resistance in Brassica napus, characterized in that: The nucleotide sequence of the downstream primer 20582474-R1 is GAAGGTGACCAAGTTCATGCTTGAGTTTGATCTTTTGTTCTCA, and the nucleotide sequence of the downstream primer 20582474-R2 is GAAGGTCGGAGTCAACGGATTTGAGTTTGATCTTTTGTTCTCT.

4. Use of the detection primer or kit for detecting the SNP molecular marker of the BnPHE2.A05 gene according to claim 2 or 3 in the detection of phosphorus deficiency stress resistance in Brassica napus, characterized in that: One end of the downstream primer 20582474-R1 and the downstream primer 20582474-R2 are connected to a fluorescent group, and the fluorescent groups of the downstream primer 20582474-R1 and the downstream primer 20582474-R2 are different.

5. A detection primer for detecting the SNP molecular marker of the BnPHE2.A05 gene, characterized in that: The detection primers include an upstream primer 20582474-F, a downstream primer 20582474-R1 and a downstream primer 20582474-R2, wherein the downstream primer 20582474-R1 and the downstream primer 20582474-R2 include a linker sequence and a typing sequence; Among them, the nucleotide sequence of the upstream primer 20582474-F is CTAATGGACACTGATGGGC, the nucleotide sequence of the typing sequence of the downstream primer 20582474-R1 is TGAGTTTGATCTTTTGTTCTCA, and the nucleotide sequence of the typing sequence of the downstream primer 20582474-R2 is TGAGTTTGATCTTTTGTTCTCT.

6. The detection primer for detecting the SNP molecular marker of the BnPHE2.A05 gene according to claim 5, characterized in that: The nucleotide sequence of the downstream primer 20582474-R1 is GAAGGTGACCAAGTTCATGCTTGAGTTTGATCTTTTGTTCTCA, and the nucleotide sequence of the downstream primer 20582474-R2 is GAAGGTCGGAGTCAACGGATTTGAGTTTGATCTTTTGTTCTCT.

7. A kit for detecting SNP molecular markers of BnPHE2.A05 gene, characterized in that: The kit comprises the detection primer according to any one of claims 5-6.

8. The kit for detecting the SNP molecular marker of the BnPHE2.A05 gene according to claim 7, characterized in that: The molar ratio of the upstream primer 20582474-F, the downstream primer 20582474-R1 and the downstream primer 20582474-R2 is 5:2:

2.

9. A method for detecting resistance to phosphorus deficiency stress in Brassica napus, characterized in that: The following steps are involved: Using the detection primers as described in any one of claims 5 to 6, amplifying the genomic DNA of Brassica napus by PCR, detecting the fluorescent signal during amplification, and determining the resistance type of the Brassica napus to be detected according to the fluorescent signal; Among them, one end of the downstream primer 20582474-R1 is connected to the first fluorescent group, and one end of the downstream primer 20582474-R2 is connected to the second fluorescent group; when only the fluorescent signal of the first fluorescent group is detected, the Brassica napus is judged to be sensitive to phosphorus deficiency stress, when only the fluorescent signal of the second fluorescent group is detected, the Brassica napus is judged to be tolerant to phosphorus deficiency stress, and when the fluorescent signals of the first fluorescent group and the second fluorescent group are detected at the same time, the Brassica napus is judged to be a heterozygous type.

10. The method for detecting phosphorus deficiency stress resistance of Brassica napus according to claim 9, characterized in that: The PCR amplification system comprises: 1 μL DNA template, 5 μL 2×Master Mix, 1.4 μL primer mixture and 2.6 μL ddH2O; the primer mixture comprises upstream primer 20582474-F, downstream primer 20582474-R1 and downstream primer 20582474-R2, and the molar ratio of the upstream primer 20582474-F, the downstream primer 20582474-R1 and the downstream primer 20582474-R2 is 5:2:2; The PCR amplification procedure included: pre-deformation at 94°C for 15 min; touchdown PCR, denaturation at 94°C for 20 s, annealing at 60°C for 1 min, and decreasing from 60°C to 48°C at a rate of 1.2°C per cycle, for 10 cycles; denaturation at 94°C for 20 s, extension at 50°C for 1 min, for 30 cycles; insulation at 37°C for 1 min, and collecting fluorescence signals for the last 1 s.

Images