A strain of Xylaria officinalis UJ3-2 and its application

Abstract

The present invention discloses a striped carbon horn fungus UJ3-2 and its application, and relates to the field of microbial technology. The strain is named striped carbon horn fungus (Xylaria grammica) UJ3-2, and is deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on July 24, 2024, with a deposit number of CGMCC No.41416. The metabolites of striped carbon horn fungus UJ3-2 described in the present invention have a significant inhibitory effect on Staphylococcus aureus, and can be used to prepare a new Staphylococcus aureus antibacterial agent.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a Xylaria officinalis strain UJ3-2 and an application thereof. Background Art

[0002] Endophytic fungi are fungal communities that live in plant tissues for a long time and coexist with host plants in a mutually beneficial manner. They have high biodiversity and versatility. They are widely found in various plants, including extreme environments such as polar regions, deserts, and oceans, and synthesize secondary metabolites through unique biosynthetic pathways. These fungi not only enhance the defense capabilities of plants against pathogens, insects, and herbivores, but also attract the attention of scholars because of their ability to produce biologically active compounds in the context of scarce medicinal resources. The co-evolution of endophytic fungi and plant hosts enables them to produce active compounds and even synthesize host components, thereby enhancing the accumulation of secondary metabolites in host plants.

[0003] Staphylococcus aureus, also known as golden staphylococcus, is a common Gram-positive bacterium that is widely present in air, water, dust and human and animal excrement. It can cause a variety of infections and diseases in humans and animals, including skin infections, pneumonia, infectious arthritis, endocarditis, toxic shock syndrome and sepsis.

[0004] Staphylococcus aureus biofilm is an important factor causing chronic and difficult-to-heal infections in humans and animals. Due to the formation and regulation of biofilm, bacteria in the biofilm can escape the attack of the body's immune system and the killing effect of antimicrobial drugs, leading to the spread of pathogens and prolonged infections. Therefore, finding drugs and methods that can inhibit or destroy biofilms is an effective way to solve Staphylococcus aureus infections.

[0005] Based on this, the present invention provides a strain of endophytic fungus of stinging nettle, Xylaria striata UJ3-2. A large number of studies have shown that the metabolites of Xylaria striata UJ3-2 have a significant inhibitory effect on the formation of Staphylococcus aureus biofilm, and increase the permeability of Staphylococcus aureus cell membrane, causing the contents to leak, the bacterial surface to become rough, ruptured and deformed, etc., thereby achieving the purpose of inhibiting Staphylococcus aureus. The present invention aims to provide a new strain resource for the preparation of Staphylococcus aureus antibacterial agent, and provide technical guidance for the preparation of a new Staphylococcus aureus inhibitor. Summary of the invention

[0006] The invention aims to provide a strain of Xylaria officinalis UJ3-2.

[0007] Another object of the present invention is to provide a strain of Xylaria officinalis UJ3-2 and its metabolites for use in the preparation of Staphylococcus aureus inhibitors.

[0008] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] The striped carbonaria UJ3-2 described in the present invention was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on July 24, 2024, with a deposit number of CGMCC No.41416.

[0010] The invention discloses an application of the Xylaria officinalis UJ3-2 and its metabolites in the preparation of antibacterial preparations.

[0011] Preferably, the Xylaria officinalis UJ3-2 and its metabolites described in the present invention are used in the preparation of a Staphylococcus aureus antibacterial preparation.

[0012] The metabolite of the invention is an extract of fermentation liquid of Xylaria officinalis UJ3-2.

[0013] The preparation method of the Xylaria officinalis UJ3-2 fermentation broth extract of the present invention is as follows:

[0014] S1: Inoculate the fungus into a conical flask filled with potato dextrose broth and culture in a constant temperature shaker for 15 days to obtain a fermentation solution;

[0015] S2: Take the above fermentation broth, centrifuge it, take the supernatant and filter it through a 0.22 μm filter membrane to obtain a sterile fermentation broth;

[0016] S3: extracting the above sterile fermentation liquid with an extraction solvent for 30 minutes each time, for a total of 3 times, and combining the extracts;

[0017] S4: Pour the extract into a rotary evaporator to concentrate under reduced pressure, and place it in a vacuum drying oven to dry.

[0018] In the method for preparing the fermentation broth extract of Xylaria officinalis UJ3-2 of the present invention, the constant temperature shaking incubation conditions in step S1 are 28° C. and 120 r / min.

[0019] In the method for preparing the Xylaria officinalis UJ3-2 fermentation broth extract of the present invention, the centrifugation conditions in step S2 are 4° C. and 8000 r / min.

[0020] In the method for preparing the Xylaria officinalis UJ3-2 fermentation broth extract of the present invention, the extraction solvent in step S3 is ethyl acetate in an equal volume to the sterile fermentation broth.

[0021] Microbiological deposit information

[0022] Strain name: Xylaria grammica UJ3-2

[0023] Storage time: July 24, 2024

[0024] Depository: China National Microbiological Culture Collection Administration General Microbiology Center

[0025] Storage location: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0026] Deposit number: CGMCC No.41416

[0027] Beneficial effects of the present invention:

[0028] 1. The present invention provides a strain of Xylaria officinalis UJ3-2 and its metabolites which have a significant inhibitory effect on Staphylococcus aureus and can be used to prepare a new Staphylococcus aureus inhibitor.

[0029] 2. The inventors have conducted extensive investigations on the inhibitory effect and mechanism of the metabolites of Xylaria officinalis UJ3-2 on Staphylococcus aureus, and determined the minimum inhibitory concentration, minimum bactericidal concentration of the metabolites on Staphylococcus aureus, as well as the effects of the metabolites on the growth curve, biofilm growth and extracellular nucleic acid proteins of Staphylococcus aureus, and used PI staining and scanning electron microscopy to evaluate the effects of the metabolites on the integrity and overall morphology of the cell wall of Staphylococcus aureus. The results showed that the metabolites of UJ3-2 had a good in vitro antibacterial effect on Staphylococcus aureus, with MIC and MBC of 3.125 mg / L. The inhibition curve confirmed that 1 MIC of UJ3-2 metabolites could completely inhibit the growth of Staphylococcus aureus within 24 hours. With the increase of the concentration of UJ3-2 metabolites, the growth of Staphylococcus aureus biofilm was significantly inhibited, and nucleic acids and proteins were significantly leaked. PI fluorescence staining showed that different concentrations of treatment groups could destroy the integrity of the cell membrane of Staphylococcus aureus. Scanning electron microscopy observed that the surface of the treated Staphylococcus aureus became rough, the bacteria shrank and adhered, and it was dose-dependent. The above studies fully demonstrated that the metabolites of Xylaria officinalis UJ3-2 have a significant inhibitory effect on Staphylococcus aureus, and preliminarily explored its mechanism of action, which is mainly to increase the permeability of the cell membrane of Staphylococcus aureus, causing leakage of its contents, roughening the surface of the bacteria, rupturing and deforming, etc., thereby inhibiting Staphylococcus aureus, providing technical guidance for the preparation of new Staphylococcus aureus inhibitors. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 UJ3-2 colony

[0031] Figure 2 Phylogenetic tree based on ITS rDNA sequences

[0032] Figure 3Effects of the fermentation products of Xylaria officinalis UJ3-2 on the growth curve of Staphylococcus aureus

[0033] Figure 4 Effects of fermentation products of Xylaria officinalis UJ3-2 on biofilm formation of Staphylococcus aureus

[0034] Figure 5 Determination of extracellular nucleic acids and proteins of Staphylococcus aureus after treatment with fermentation products of Xylaria officinalis UJ3-2 (OD 260nm )

[0035] Figure 6 Determination of extracellular nucleic acids and proteins in Staphylococcus aureus after treatment with fermentation products of Xylaria officinalis UJ3-2 (OD 280nm )

[0036] Figure 7 Effects of different concentrations of Xylaria officinalis UJ3-2 fermentation products on the cell membrane integrity of Staphylococcus aureus (fluorescence micrographs)

[0037] Figure 8 Morphological changes of Staphylococcus aureus when the concentration of fermentation product of Xylaria officinalis UJ3-2 was 1 / 2 MIC DETAILED DESCRIPTION

[0038] The technical solution of the present invention is described in detail below in conjunction with specific embodiments. The following embodiments are only used for explanation and illustration, and do not constitute a limitation on the technical solution of the present invention.

[0039] Example 1

[0040] Xylaria grammica UJ3-2, named Xylaria grammica UJ3-2, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on July 24, 2024, with the deposit number CGMCC No.41416.

[0041] Example 2

[0042] Extraction of fermentation products of Xylaria officinalis UJ3-2:

[0043] Inoculate striped carbonaria UJ3-2 into a conical flask filled with potato glucose broth, and culture in a constant temperature shaker for 15 days (28℃, 120r / min) to obtain fermented bacterial liquid for use. Take the above fermented liquid and centrifuge (4℃, 8 000r / min) for 10 minutes, then keep the supernatant, and filter it through a 0.22μm filter membrane in a clean bench to obtain sterile fermented liquid. Extract the sterile fermented liquid with an equal volume of ethyl acetate, 30 minutes each time, for a total of 3 times, and pour the combined extracts into a rotary evaporator to reduce pressure and concentrate, and then put it into a vacuum drying oven for drying to obtain the fermentation metabolites of striped carbonaria UJ3-2.

[0044] Example 3

[0045] Determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the fermentation product of Xylaria officinalis UJ3-2 against Staphylococcus aureus:

[0046] Using the two-fold dilution method, 100 μL of culture medium was pre-added to wells 2 to 8 in a 96-well plate. 200 μL of endophytic fungus UJ3-2 fermentation product was added to well 1, and 100 μL of sample solution was pipetted from it to well 2, and the same dilution was performed in turn to well 8. 10 μL of 1×10 5 CFU / mL bacterial solution. An equal amount of culture medium, Staphylococcus aureus bacterial solution and normal saline were added to well No. 9 as the control group. Only culture medium was added to well No. 10 as the blank control. After the addition of samples, culture was carried out at 37°C for 24 hours. Check whether the solution is turbid by the naked eye to determine the MIC. Each group has 3 replicates. According to the results of the MIC test, 10 μL of the solution in each well was aspirated for plating, cultured at 37°C for 24 hours, and the growth of colonies on the agar plate was observed. The lowest concentration of the UJ3-2 fermentation product solution with no colony growth was taken as the MBC of the UJ3-2 fermentation product of Xylella fastidiosa.

[0047] Example 4

[0048] A Staphylococcus aureus antibacterial agent comprising Xylaria officinalis UJ3-2 and its metabolites.

[0049] In order to further verify the reliability of the present invention and screen out the best solution, the inventor conducted a series of experiments, as follows:

[0050] 1. Materials and methods

[0051] 1.1 Sources

[0052] Stinging nettle, collected from the campus of Guizhou Agricultural Vocational College in September 2023.

[0053] 1.2 Instruments and reagents

[0054] 1.2.1 Main instruments

[0055] Rotary evaporator, vacuum drying oven, constant mixing incubator, super workbench, fluorescence microscope, PCR instrument, electrophoresis instrument, gel imaging system, scanning electron microscope.

[0056] 1.2.2 Main reagents

[0057] Staphylococcus aureus strain: deposit number CMCC (B) 26003, Shanghai Luwei Technology Co., Ltd.; hydrolyzed casein peptone (MH) broth medium: Qingdao Haibo Technology Co., Ltd.; PDA, TSB medium: Qingdao Haibo Technology Co., Ltd.; propidium iodide: Solebol; anhydrous ethanol, ethyl acetate: Aladdin;

[0058] 1.3 Isolation, purification and identification of strains

[0059] 1.3.1 Isolation and purification of strains

[0060] Rinse the surface of nettle root, stem and leaf tissue with tap water, dry the surface moisture with sterile filter paper, and transfer to a sterilized bottle for surface sterilization. After rinsing with sterile water twice, rinse with 95% ethanol for 1 minute, rinse with sterile water once, rinse with 2.5% sodium hypochlorite for 2 minutes, rinse with 95% ethanol for 1 minute, and rinse with sterile water 4 to 6 times. To verify whether the disinfection is thorough, apply the sterile water after the last rinse on the separation medium as a blank control, culture and observe at 28°C. No bacteria grow, indicating that the surface disinfection is thorough. Place the disinfected tissue on sterile filter paper to absorb moisture, use sterile scissors to cut the roots obliquely into 1cm small segments, the stem segments obliquely cut into small discs, and the leaves into small leaf pieces of about 0.5cm×0.5cm, and inoculate them on 3 solid culture media respectively, and culture in a constant temperature incubator at 28°C. After the colonies grow, pick colonies of different morphologies to new plates, and continuously subculture until the colonies have a single morphology.

[0061] 1.3.2 Morphological identification of strains

[0062] UJ3-2 was inoculated onto PDA plates and cultured at 28°C for 7 days. The shape (round, irregular, etc.), size, edge characteristics (neat, fuzzy, radial, etc.), color, texture, and growth rate of the colonies were observed and recorded. The identification was performed according to the Fungal Identification Manual published by Wei Jingchao.

[0063] 1.3.3 Molecular biological identification of strains

[0064] The ITS sequence of endophytic fungi from stinging nettle was used to identify the isolated endophytic fungi. The ITS sequence of the internal transcribed spacer region was amplified using universal primers for fungi:

[0065] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'

[0066] ITS4: 5'-TCCTCCGCTTATTGATATGC-3'

[0067] The ITS sequencing results were stored in GeneBank, and the DNA sequence with the highest similarity was found using BLSAT on the NCBI website. The software Mega11 was used together with the sequencing results to draw an evolutionary tree using the neighbor-joining method (NJ) to identify the genus classification of each endophytic fungus strain.

[0068] 1.4 Preparation of fermentation products of Xylaria officinalis UJ3-2

[0069] Inoculate the isolated striped carbonaria UJ3-2 into a conical flask filled with potato glucose broth, and culture it in a constant temperature shaker for 15 days (28°C, 120r / min) to obtain the fermented bacterial liquid for use. Take the above fermented liquid and centrifuge it (4°C, 8000r / min) for 10 minutes, then keep the supernatant, and filter it through a 0.22μm filter membrane in a clean bench to obtain a sterile fermented liquid. Extract the sterile fermented liquid with an equal volume of ethyl acetate, 30 minutes each time, for a total of 3 times, and pour the combined extracts into a rotary evaporator to reduce pressure and concentrate, then put it into a vacuum drying oven for drying to obtain the fermentation metabolites of striped carbonaria UJ3-2.

[0070] 1.5 Determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the fermentation product of Xylaria officinalis UJ3-2 against Staphylococcus aureus

[0071] Using the two-fold dilution method, 100 μL of culture medium was pre-added to wells 2 to 8 in a 96-well plate. 200 μL of UJ3-2 fermentation product solution was added to well 1, and 100 μL of sample solution was pipetted from it to well 2, and the same dilution was performed in turn to well 8. 10 μL of 1×10 5 CFU / mL bacterial solution. An equal amount of culture medium, Staphylococcus aureus bacterial solution and saline were added to well No. 9 as the control group. Only culture medium was added to well No. 10 as the blank control. After the addition of samples, culture was carried out at 37°C for 24 hours. Check whether the solution is turbid by the naked eye to determine the MIC. Each group has 3 replicates. According to the MIC test results, 10 μL of the solution in each well was aspirated for plating, cultured at 37°C for 24 hours, and the growth of colonies on the agar plate was observed. The lowest extract solution concentration with no colony growth was taken as the MBC of the fermentation product of Xylaria officinalis UJ3-2.

[0072] 1.6 Effect of Xylaria officinalis UJ3-2 fermentation products on the growth curve of Staphylococcus aureus

[0073] 100 μL (1-2×10 7CFU / mL) to a 96-well cell culture plate, and then add 100 μL of the extract at concentrations of 0.25MIC, 0.5MIC, 1.0MIC, 2MIC to the above wells, so that the final mass concentration of the extract is 0.125MIC, 0.25MIC, 0.5MIC, 1.0MIC, and the culture medium is used instead of the extract as a control, with 4 wells at each concentration. The 96-well cell culture plate was cultured at 35°C for 16 hours, and the OD was measured every 2 hours. 600nm The growth curve was drawn with time as the horizontal axis and optical density as the vertical axis.

[0074] 1.7 Effects of Xylaria officinalis UJ3-2 fermentation products on the biofilm growth of Staphylococcus aureus

[0075] When determining the inhibitory effect of the fermentation product of Xylaria officinalis UJ3-2 on the biofilm of Staphylococcus aureus, 2.97 mL of TSB medium was added to the surface-treated 12-well plate and 30 μL of Staphylococcus aureus suspension (10 7 CFU / mL), and then the fermentation product of striped carbonaria UJ3-2 was added thereto so that the final concentrations were 0.125MIC, 0.25MIC, 0.5MIC, and 1.0MIC, respectively, and the fermentation product of striped carbonaria UJ3-2 was not added as the control group. The 12-well plate was cultured at 37°C for 24h, 48h, and 72h, respectively. After the culture was completed, the excess bacterial solution was aspirated and the well plate was washed with PBS to remove free bacteria. Then 50μL of methanol was added to the well plate for fixation for 30min. After fixation, the methanol was discarded and the well plate was rinsed with PBS, and then 500μL of 0.5% (w / v) crystal violet solution was added to stain the biofilm for 15min. After staining, the excess crystal violet solution was discarded and washed with PBS. After drying, 300μL of 70% ethanol was added, and the OD was measured after the crystal violet in the well plate was fully dissolved. 600nm The absorbance at .

[0076] 1.8 Determination of extracellular nucleic acids and proteins in Staphylococcus aureus after treatment with the fermentation product of Xylaria officinalis UJ3-2

[0077] Wash the Staphylococcus aureus culture in the logarithmic growth phase with sterile PBS, resuspend and divide into 4 tubes. Add UJ3-2 fermentation product to the resuspended solution to make the final concentrations of 0.125MIC, 0.25MIC, 0.5MIC, and 1.0MIC, respectively, and set up a negative control with sterile PBS. Incubate in a 37℃ water bath for 12h, take 200μL samples at 0h, 2h, 4h, 6h, 8h, 10h, and 12h, centrifuge at 4000r / min for 5min, and take the supernatant to measure OD 260nm and OOD 280nm The value of .

[0078] 1.9 Effects of Xylaria officinalis UJ3-2 fermentation products on the cell membrane integrity of Staphylococcus aureus

[0079] The propidium iodide (PI) staining method was used. 500 μL of Staphylococcus aureus suspension was taken into a 2 mL centrifuge tube, and then 500 μL of fermentation product solutions with concentrations of 0.5 MIC, 1 MIC and 2 MIC were added to the above centrifuge tubes, so that the final mass concentrations of the fermentation product solutions were 0.25 MIC, 0.5 MIC and 1 MIC, respectively. Sterile deionized water was used instead of the extract as a control, and 3 tubes were used for each concentration, and cultured at 28 ° C for 4 hours. The cultured bacterial solution was centrifuged at 5000 r / min and 4 ° C for 10 minutes, and the supernatant was discarded. The obtained bacteria were resuspended and washed twice with PBS, centrifuged and the supernatant was discarded, resuspended in PBS, PI dye (final mass concentration was 10 μg / mL), incubated at 4 ° C in the dark for 30 minutes, resuspended and washed twice with PBS, centrifuged, the supernatant was discarded, resuspended in PBS, and 10 μL of the bacterial suspension was observed under a fluorescence microscope. The excitation wavelength was 535 nm and the emission wavelength was 615 nm.

[0080] 1.10 Observation of the morphology of Staphylococcus aureus after treatment with the fermentation product of Xylaria officinalis UJ3-2

[0081] Wash and resuspend the Staphylococcus aureus cultured to the logarithmic growth phase with sterile PBS. Add the fermentation product of Xylaria officinalis UJ3-2 to a final concentration of 1 / 2MIC, and set up a negative control with sterile PBS. Incubate in a 37℃ water bath for 4h, centrifuge at 4000r / min for 5min, discard the supernatant, and wash twice with sterile PBS. Resuspend with electron microscopy fixative, fix the bacteria at room temperature, and store at 4℃. Observe the bacterial morphology with a scanning electron microscope and take pictures.

[0082] 1.11 Analysis of components of fermentation products of Xylaria officinalis UJ3-2

[0083] Chromatographic separation: Thermo Vanquish (Thermo Fisher Scientific, USA) ultra-high performance liquid chromatography system, using ACQUITY HSS T3 (2.1×100 mm, 1.8 μm) (Waters, Milford, MA, USA) chromatographic column, flow rate of 0.3 mL / min, column temperature of 40°C, injection volume of 2 μL. Positive ion mode, mobile phase of 0.1% formic acid acetonitrile (B2) and 0.1% formic acid water (A2), gradient elution program: 0-1 min, 10% B2; 1-5 min, 10%-98% B2; 5-6.5 min, 98% B2; 6.5-6.6 min, 98%-10% B2; 6.6-8 min, 10% B2. In negative ion mode, the mobile phases were acetonitrile (B3) and 5 mM ammonium formate water (A3), and the gradient elution program was: 0-1 min, 10% B3; 1-5 min, 10%-98% B3; 5-6.5 min, 98% B3; 6.5-6.6 min, 98%-10% B3; 6.6-8 min, 10% B3.

[0084] Mass spectrometry acquisition: Thermo Q Exactive Focus mass spectrometer (Thermo Fisher Scientific, USA), electrospray ion source (ESI), positive and negative ion modes were used to collect data. The positive ion spray voltage was 3.50 kV, the negative ion spray voltage was -2.50 kV, the sheath gas was 40 arb, and the auxiliary gas was 10 arb. The capillary temperature was 325 °C, the first-level full scan was performed at a resolution of 70000, the first-level ion scan range was m / z 100-1000, and HCD was used for secondary fragmentation, the collision energy was 30 eV, the second-level resolution was 17500, and the first 3 ions of the acquisition signal were fragmented, and dynamic exclusion was used to remove unnecessary MS / MS information.

[0085] 1.12 Data Analysis

[0086] Office 2016 software was used for drawing, and SPSS Statistics 20.0 (IBM Corp, USA) was used for ANOVA analysis or t-test of the data. The experiment was repeated 3 times, and the average value of the measurement results was taken. The data were expressed as mean ± standard error.

[0087] 2. Results and Discussion

[0088] 2.1 Identification of strains

[0089] 2.1.1 Morphological identification of strains

[0090] After 7 days of inoculation of strain UJ3-2 on PDA, the colonies were compact in appearance, with a color that was initially white and gradually turned dark gray. The surface was slightly rough and dull, with clear edges that spread in a circular pattern and a dense texture. The growth rate was moderate, and the colony diameter could reach several centimeters. The hyphae were slender, complexly branched, colorless and transparent. No obvious secretions were produced. Figure 1 .

[0091] 2.1.2 Molecular biological identification of strains

[0092] After extracting fungal genomic DNA, the ITS sequence was amplified and the amplified PCR product was sent for sequencing. Figure 2 , with a homology of 100% with Xylaria grammica, and was identified as Xylaria grammica. At the same time, the sequencing data was uploaded to the NCBI database for comparison, and the regional sequence with sequence number PP957465.1 was obtained as follows:

[0093] CCTGCGGAGGGATCATTAAAGAGTTATTACAACTCCCAAACCCATGTGAA

[0094] CTTACCTTCTGTTGCCTCGGCAGGTCGCGACCTACCCTGTGAGGCCCTACC

[0095] CTGTAGGGCCCTAACCTGGTAGTCGCGGGTACGCCTGCCGGTGGCCCATGA

[0096] AACTCTGTTTATTCTTGTTATTCTGAATCTATAACTAAATAAGTTAAAACTT

[0097] TCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATG

[0098] CGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACG

[0099] CACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTT

[0100] CAACCCTTAAGCCTCTGTTGCTTAGCGTTGGGAGCCTACAGCCTTCTGTAG

[0101] CTCCCCAAAGTTAGTGGCGGAGTCGGTTTACACTCTAGACGTAGTAAATTT

[0102] TATCTCGTCTGCAGTTAGGCCGGTCCCTCGCCGTAAAACCCCCCAATTTTT

[0103] AAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC

[0104] 2.2 Determination of MIC and MBC of the fermentation product of Xylaria officinalis UJ3-2 against Staphylococcus aureus

[0105] For Staphylococcus aureus, when the concentration of the fermentation product of striped carbonaria UJ3-2 was 1.563 mg / mL, the liquid culture medium was turbid, indicating that there was obvious growth of Staphylococcus aureus, but the culture solution with a mass concentration of 3.125 mg / mL was clear, indicating that the strain had no obvious growth, so the MIC of the fermentation product of striped carbonaria UJ3-2 for the indicator bacteria can be determined to be 3.125 mg / mL. The results are shown in Tables 1 and 2. It can be seen from Table 2 that the MBC of the fermentation product of UJ3-2 for the indicator bacteria can be determined to be 3.125 mg / mL.

[0106] Table 1 MIC of the fermentation products of endophyte UJ3-2 against Staphylococcus aureus

[0107]

[0108] Table 2 MBC of the fermentation products of endophyte UJ3-2 against Staphylococcus aureus

[0109]

[0110] Note: “-” indicates antibacterial activity, and “+” indicates bacterial growth.

[0111] 2.3 Effect of Xylaria officinalis UJ3-2 fermentation products on the growth curve of Staphylococcus aureus

[0112] Depend on Figure 3 It can be seen that the strain in the control group grew rapidly within 12 hours, and the OD 600nm The growth of the strains added with different concentrations of fermentation product solutions was significantly inhibited, and the OD value at the same time was significantly lower than that of the control group. When the concentration of the added fermentation product solution reached 1.0MIC, the growth of the strain was basically completely inhibited, and its OD value within 24 hours was 600nmThere was no significant change. This indicates that when the concentration of the fermentation product of Xylaria officinalis UJ3-2 reaches 1.0 MIC, it can also effectively inhibit the growth and reproduction of Staphylococcus aureus strains in liquid culture.

[0113] 2.4 Effects of Xylaria officinalis UJ3-2 fermentation products on the biofilm growth of Staphylococcus aureus

[0114] Depend on Figure 4 It can be seen that after adding fermentation products to the culture medium, the amount of biofilm decreased significantly. For biofilms grown to the same period, the amount of biofilm gradually decreased with the increase of fermentation product concentration. Compared with the control group, the absorbance values ​​of biofilms grown for 24 hours decreased by 30.7% and 91.5% under low and high concentrations of fermentation products, respectively. After the biofilm grew for 72 hours, the absorbance of biofilms treated with low and high concentrations of fermentation products decreased by 4.01% and 89.6%. It can be seen from the figure that when the same concentration of fermentation products is used for treatment, the amount of biofilm grown for 48 hours is larger than that of biofilm grown for 24 hours, but there is no obvious trend of change in the amount of biofilm grown for 72 hours compared with 48 hours.

[0115] 2.5 Determination of extracellular nucleic acids and proteins of Staphylococcus aureus after treatment with fermentation products of Xylaria officinalis UJ3-2.

[0116] Depend on Figure 5 , Figure 6 It can be seen that the extracellular nucleic acid and protein concentrations of Staphylococcus aureus in the 1MIC group and 1 / 2MIC group were significantly higher than those in the control group (P<0.05). Studies have shown that the fermentation products of Xylaria officinalis UJ3-2 can destroy the cell membrane structure of Staphylococcus aureus and cause the intracellular nucleic acid and protein to leak out.

[0117] 2.6 Effects of Xylaria officinalis UJ3-2 fermentation products on the cell membrane integrity of Staphylococcus aureus

[0118] Propidium iodide, as a membrane-impermeable fluorescent dye, has a unique mechanism of action. When the integrity of the cell membrane is damaged, it can pass through the cell membrane, bind to the genetic material, and emit red fluorescence. Therefore, the integrity of the cell membrane can be reflected by detecting PI fluorescence under a fluorescence microscope. The results are as follows Figure 7 As shown in the figure, after PI staining, there was basically no observable fluorescence in the control group, and the Staphylococcus aureus group treated with 0.5MIC metabolites for 4 hours emitted sporadic red fluorescence, and as the concentration of the extract increased, the red fluorescence gradually increased. When the mass concentration was 2MIC, a large amount of red fluorescence was observed, indicating that after the extract treatment, the cell membrane of Staphylococcus aureus was destroyed, causing a large amount of PI to enter the cell and bind to the genetic material, emitting red fluorescence. Figure 7In the figure, A is the negative control (A1 bright field, A2 dark field); B is the 1 / 4MIC treatment group (B1 bright field, B2 dark field); C is the 1 / 2MIC treatment group (C1 bright field, C2 dark field); D is the 1MIC treatment group (D1 bright field, D2 dark field).

[0119] 2.7 Morphological observation of Staphylococcus aureus after treatment with the fermentation product of Xylaria officinalis UJ3-2

[0120] The results of scanning electron microscopy showed that compared with the control group, Staphylococcus aureus treated with the fermentation product of Xylaria officinalis UJ3-2 showed bacterial morphological deformation, blurred edges, and rough surface. This indicates that the fermentation product of Xylaria officinalis UJ3-2 can affect the overall morphology of Staphylococcus aureus and change the surface structure of bacteria. Figure 8 , A and B are normal controls; C and D are treatment groups.

[0121] 2.8 Analysis of components of fermentation products of Xylaria officinalis UJ3-2

[0122] UPLC-MS / MS analysis of the fermentation products of Xylaria officinalis UJ3-2 revealed that the fermentation products mainly include low molecular weight phenolic compounds, alkaloids, flavonoids, organic acids, amino acids, sugars, lipids, sugar alcohols, etc. Among them, 6-oxocineole (17.92%), (S)-2-Acetolactate (9.91%), 3-Methyl-cis, cis-muconate (4.36%) and 8-oxogeranial (3.17%) have the highest content. Among them, compounds such as Solasodine, alpha-Curcumene, Bornylisovalerate, and 4-Hydroxybenzaldehyde have antibacterial activity, Aesculetin has anti-inflammatory and anti-tumor activity, and 8-oxogeranial is the substrate for the basic chemical structure (cyclopentadiene ring scaffold) of the synthesis of cyclopentadiene compounds. The results are shown in Table 3.

[0123] Table 3 Main components of UJ3-2 fermentation products

[0124]

[0125]

[0126] Although the present invention has been described in detail above by means of general description, specific implementation methods and experiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A strain of Xylaria grammica UJ3-2, which was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on July 24, 2024, with the deposit number CGMCC No.41416.

2. A use of Xylaria grammica UJ3-2 as claimed in claim 1, characterized in that: The invention discloses an application of the ethyl acetate extract of Xylaria grammica UJ3-2 fermentation liquid in the preparation of Staphylococcus aureus inhibitor.

3. The use according to claim 2, characterized in that: The preparation method of the ethyl acetate extract of the Xylaria grammica UJ3-2 fermentation broth is as follows: S1: Inoculate the fungus into a conical flask filled with potato dextrose broth and culture in a constant temperature shaker for 15 days to obtain a fermentation solution; S2: Take the above fermentation broth, centrifuge it, take the supernatant and filter it through a 0.22 μm filter membrane to obtain a sterile fermentation broth; S3: extracting the above sterile fermentation broth with an equal volume of ethyl acetate, 30 min each time, for a total of 3 times, and combining the extracts; S4: Pour the extract into a rotary evaporator to concentrate under reduced pressure, and place it in a vacuum drying oven to dry.

4. The use according to claim 3, characterized in that: In the method for preparing the ethyl acetate extract of Xylaria grammica UJ3-2 fermentation broth, the constant temperature shaking incubation conditions in step S1 are 28° C. and 120 r / min.

5. The use according to claim 3, characterized in that: In the method for preparing the ethyl acetate extract of Xylaria grammica UJ3-2 fermentation broth, the centrifugation conditions in step S2 are 4° C. and 8000 r / min.

Images