A highly stereoselective D-threonine aldolase mutant and its application

Abstract

The present invention discloses a highly stereoselective D-threonine aldolase mutant and its application. The mutant is obtained by directed evolution of wild-type D-threonine aldolase, including the mutation of asparagine at position 146 to any one of glycine, lysine, arginine, glutamate, and glutamine, and / or the mutation of arginine at position 147 to any one of phenylalanine and tyrosine, and / or the mutation of cysteine ​​at position 148 to phenylalanine, and / or the mutation of tyrosine at position 177 to any one of phenylalanine, histidine, and tryptophan, and / or the mutation of serine at position 312 to any one of alanine, leucine, and threonine. The D-threonine aldolase mutant provided by the present invention is effective in synthesizing D- sermon When methylsulfonylphenylserine is present, it has a higher C β Stereoselectivity and yield; the reaction conditions for applying the mutant are mild and easy to implement, and it has good application prospects in the field of pharmaceutical chemical industry.

Description

Technical Field

[0001] The present invention relates to a D-threonine aldolase, in particular to a D-threonine aldolase mutant with high stereoselectivity and application thereof, belonging to the technical fields of enzyme engineering and chemical engineering. Background Art

[0002] By forming carbon-carbon bonds (CC), aldehyde aldehyde enzymes as biocatalysts can extend the carbon skeleton to form larger molecules, and the enzymatic aldol addition reaction can produce many high-value compounds under green conditions, so it plays a key role in the organic matter cycle in nature. Threonine aldolase (TA), including D-threonine aldolase (DTA) and L-threonine aldolase, can catalyze the condensation of different types of aldehydes with amino acids to form β-hydroxy-α-amino acids with the assistance of pyridoxal phosphate, providing a multifunctional catalytic platform for various high-value compounds such as active pharmaceutical ingredients, antibiotics or agricultural chemical building blocks. β-Hydroxy-α-amino acids contain a chiral center (C α and C β ), while the TA reported so far simultaneously generates diastereoisomers threo-β-hydroxy-α-amino acid and erythro-β-hydroxy-α-amino acid, i.e., in C α Highly stereoselective, but generally cannot strictly control C β Stereoselectivity leads to a lower diastereomeric excess (DE) of the product. There are reports that the use of D-low-TA from A.xylosoxidans can achieve an increase in the yield of the catalytic reaction of 4-methylsulfonylbenzaldehyde, but there is no mention of C β Site-specific diastereoselectivity. Summary of the Invention

[0003] Purpose of the invention: The purpose of the present invention is to provide a D-threonine aldolase mutant having higher activity and higher stereoselectivity in the preparation of D-threonine p-methylsulfonylphenylserine and its application.

[0004] Technical solution: The first aspect of the present invention provides a highly stereoselective D-threonine aldolase mutant, wherein the amino acid sequence of the D-threonine aldolase mutant is obtained by mutation of the sequence shown in SEQ ID NO: 1, wherein the mutation includes: asparagine at position 146 is changed to any one of glycine, lysine, arginine, glutamate, and glutamine, and / or arginine at position 147 is mutated to any one of phenylalanine and tyrosine, and / or cysteine ​​at position 148 is mutated to phenylalanine, and / or tyrosine at position 177 is mutated to any one of phenylalanine, histidine, and tryptophan, and / or serine at position 312 is mutated to any one of alanine, leucine, and threonine.

[0005] Any one of S312A, Y177F / S312A, R147F / Y177F / S312A, C148F / R147F / Y177F / S312A, N146G / R147F / Y177F / S312A, and N146K / R147F / Y177F / S312A is preferred.

[0006] The present invention utilizes the publicly available sequence and structural information of D-threonine aldolase, screens potential enzyme genes through non-redundant searches in databases such as NCBI, and screens them based on protein structural similarity, conserved site analysis, and host-source diversity. These genes are then functionally expressed and purified to obtain a pure enzyme. The preferred D-threonine aldolase (SEQ ID NO: 1, NCBI accession number WP_046479359.1) is derived from the marine bacterium Filomicrobium marinum and has broad substrate applicability, catalyzing the conversion of various aldehydes and α-amino acid substrates to corresponding β-hydroxy-α-amino acid compounds. The present invention amplifies the enzyme gene (SEQ ID NO: 2) and uses rational design and directed evolution to generate multiple threonine aldolase mutants with significantly improved diastereoselectivity for D-threonine methylsulfonylphenylserine.

[0007] In all discussions herein, the standard single-letter codes for amino acids are used, as well as standard substitution notation. For example, S312A means that the serine (S) at position 312 at the N-terminus is mutated to an alanine (A); Y177F / S312A means that the tyrosine (Y) at position 177 at the N-terminus is mutated to a phenylalanine (F), and the serine (S) at position 312 at the N-terminus is mutated to an alanine (A).

[0008] The second aspect of the present invention provides a nucleic acid molecule encoding the D-threonine aldolase mutant as described in the first aspect, wherein the nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO: 2.

[0009] The third aspect of the present invention provides an expression vector, which comprises the nucleotide sequence described in the second aspect, and the expression vector may be a PET series expression vector.

[0010] A fourth aspect of the present invention provides a recombinant cell and a method for constructing the same. The recombinant cell comprises the expression vector described in the third aspect, and the recombinant cell may be Escherichia coli. The method for constructing the recombinant cell comprises the following steps:

[0011] (1) constructing an expression vector: ligating the nucleic acid molecule described in the second aspect with a plasmid to obtain the expression vector described in the third aspect;

[0012] (2) Construction of recombinant cells: The constructed expression vector is transferred into competent cells, cultured and screened to obtain recombinant cells.

[0013] A fifth aspect of the present invention provides a product and its use, wherein the product comprises the D-threonine aldolase mutant described in the first aspect, or the nucleic acid molecule described in the second aspect, or the expression vector described in the third aspect, or the recombinant cell described in the fourth aspect. The product includes a catalyst.

[0014] The application includes the synthesis of D-thero-p-methylsulfonylphenylserine, such as catalyzing the synthesis of chiral D-thero-p-methylsulfonylphenylserine from aldehyde and glycine.

[0015] The reaction conditions include a temperature of 25-45° C. and a pH of 5.5-10.0 for 10-20 hours. The reaction conditions include adding an organic solvent in an amount not exceeding 20% ​​of the total volume. The organic solvent may be DMSO.

[0016] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The mutant provided by the present invention has a higher C β Stereoselectivity and yield; 2. The present invention provides a product for preparing D-thero-methylsulfonylphenylserine, said product comprising a high C β Stereoselective and high-yield D-threonine aldolase mutant or its encoding gene or corresponding expression vector or corresponding recombinant cell; 3. The present invention provides a construction of a D-threonine aldolase mutant and an application method thereof. The reaction conditions of the application are mild and easy to implement, and it has good application prospects in the field of pharmaceuticals and chemical industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a graph showing the yield and stereoselectivity of wild-type D-threonine aldolase and its mutants;

[0018] Figure 2The chemical equation for the synthesis of D-threonine aldolase from glycine and p-methylsulfonylbenzaldehyde is given below:

[0019] Figure 3 The graph shows the yield and stereoselectivity of the D-threonine aldolase mutant (C148F / R147F / Y177F / S312A) at different temperatures;

[0020] Figure 4 The graph shows the yield and stereoselectivity of D-threonine aldolase mutant (C148F / R147F / Y177F / S312A) at different pH values.

[0021] Figure 5 This is a liquid phase diagram of the synthesis of D-threonine aldolase mutant catalyzed by D-threonine aldolase mutant. DETAILED DESCRIPTION

[0022] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0023] The wild-type D-threonine aldolase and its mutants in the present invention are capable of catalyzing the synthesis of D-thero-methylsulfonylphenylserine (D-thero-MTPS) and D-erythro-methylsulfonylphenylserine (D-erythro-MTPS) using 4-methylsulfonylbenzaldehyde and glycine as substrates, pyridoxal phosphate (PLP) as a coenzyme, and MnCl2 as a metal element. The chemical formula is as follows: Figure 2 .

[0024] The steps for preparing D-threonine aldolase mutants are as follows:

[0025] (1) Construction of recombinant vector pET22b-FmDTA:

[0026] The wild-type D-threonine aldolase gene from Filomicrobium marinum was synthesized by GenWeiZhi (Suzhou) and constructed in the pET22b vector. The vector was then transformed into E. coli DH5α. The recombinant E. coli DH5α / pET22b-FmDTA strain was inoculated into a 5 mL test tube filled with culture medium and cultured at 37°C with shaking at 220 rpm for 12 hours. After the incubation period, the cells were centrifuged at 12,000 rpm for 1 minute and harvested. The plasmid was extracted from the E. coli DH5α / pET22b-FmDTA using a high-purity plasmid miniprep kit and used as a template for iterative mutagenesis to construct mutants of the plasmid pET22b-FmDTA.

[0027] (2) Construction of recombinant E. coli BL21(DE3) / pET22b-FmDTA cells:

[0028] Gene mutations were generated using whole-plasmid PCR to identify the target mutant gene. After PCR amplification, the amplified product was examined by 0.9% agarose gel electrophoresis, revealing a single band approximately 6000 bp in size. The amplified product was purified using a DNA purification kit. The purified gene fragment was digested with DpnI to remove the template and then recombined using a recombinase. The recombinant product was transformed into E. coli DH5α competent cells, plated on LB solid medium supplemented with 100 μg / mL ampicillin, and incubated at 37°C for 12 hours. Single colonies were then transferred to LB liquid culture. Successful transformants were identified by PCR, and the correct mutation site was verified by sequencing. After verification, a portion of the cells was added with sterile glycerol to a final concentration of 25%, numbered, and stored at -80°C until further use. A portion of the cells was extracted using a plasmid extraction kit, and the recombinant plasmids were stored at -20°C. The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) as the expression host to construct the recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-FmDTA.

[0029] Using R147F as an example, the required primers were specifically designed. Other mutants were designed using this principle and single-point iterative mutations were performed. The PCR system is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0030] R147F upstream primer:

[0031] CATTGGCGGCAAT TTC TGCGGCGTGGAGCCGGGCGATCCGGCGGTG

[0032] R147F downstream primer:

[0033] CTCCACGCCGCA GAA ATTGCCGCCAATGTTAATTTCCACCAGCAC

[0034] Table 1 PCR reaction system

[0035] Ingredients volume 10×BufferforKOD-Plus- 2.5 μL 2mM dNTP 2.5 μL <![CDATA[25mMMgSO4]]> 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75μL 10 pmol / μL Reverse Primer 0.75μL DNA template <100ng KOD-Plus- 1 μL <![CDATA[ddH2O]]> up to 25 μL

[0036] Table 2 PCR reaction conditions

[0037]

[0038] (3) Cultivation of D-threonine aldolase mutants and preparation of pure enzyme solution:

[0039] The successfully constructed recombinant mutant expression strain E. coli BL21 (DE3) / pET22b-FmDTA was spread onto a plate containing kanamycin at a final concentration of 100 μg / mL. A single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured overnight at 37°C and 200 rpm / min. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance. When the OD600 reached about 0.6, IPTG was added at a final concentration of 0.5 mM and induced at 18°C ​​for about 14 h.

[0040] After centrifugation, the cells were resuspended in buffer and disrupted by ultrasonication in an ice bath (2-second on-time, 5-second interval, 30-minute on-time). The supernatant was collected and filtered through a 0.22 μm aqueous filter as a sample, which was then purified using a nickel column. The molar absorptivity of the protein, ε, was calculated based on the amino acid sequence of FmDTA. The protein concentration was calculated by measuring the absorbance of the purified protein using the A280 method.

[0041] Example 1D - Yield of Threonine Aldolase Mutants and C β Comparison of stereoselectivity

[0042] Preparation of D-threonine aldolase mutants: Y177F / S312A, R147F / Y177F / S312A, N146R / R147F / Y177F / S312A, N146K / R147F / Y177F / S312A, N146G / R147F / Y177F / S312A, C148F / R147F / Y177F / S312A, N146G / R147F / Y177F / S312A, C148F / R147F / Y177F / S312A.

[0043] Whole cells or pure enzyme solution were used as catalysts. Reaction system: 20 μM protein or whole cell solution with OD=20, 0.1 M p-methylsulfonylbenzaldehyde, 1 M glycine, 100 μM pyridoxal phosphate, 100 μM MnCl2, 10% DMSO, reaction buffer was 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH=8. The reaction temperature was controlled at 35°C in a water bath, with magnetic stirring, and the reaction was carried out for 16 hours. The concentration and de value (C value) of the product D-thero p-methylsulfonylphenylserine were detected by liquid chromatography. β Stereoselectivity). The results are shown in Table 3, Table 4, Figure 1 and Figure 5 .

[0044] Table 3 D-threonine aldolase and its mutants catalyze the synthesis of D-threonine p-methylsulfonylphenylserine

[0045] catalyst Catalyst type Catalyst concentration Substrate concentration (mM) Yield de WT Whole cell OD=20 100 30％ 25％ Y177F / S312A Whole cell OD=20 100 71％ 56％ R147F / Y177F / S312A Whole cell OD=20 100 38％ 69％ N146R / R147F / Y177F / S312A Whole cell OD=20 100 61％ 75％ N146K / R147F / Y177F / S312A Whole cell OD=20 100 61％ 76％ N146G / R147F / Y177F / S312A Whole cell OD=20 100 98％ 77％ C148F / R147F / Y177F / S312A Whole cell OD=20 100 71％ 81％ N146G / R147F / Y177F / S312A protein 20 μM 100 98％ 87％ C148F / R147F / Y177F / S312A protein 20 μM 100 98％ 84％

[0046] Table 4 D-threonine aldolase and its mutants catalyze the synthesis of D-threonine p-methylsulfonylphenylserine

[0047]

[0048]

[0049] Example 2 Optimal Temperature of D-threonine Aldolase Mutant Catalyzing the Synthesis of D-threonine p-Methylsulfonylphenylserine Whole cells of the D-threonine aldolase mutant C148F / R147F / Y177F / S312A were used as catalysts.

[0050] The reaction system consisted of a whole-cell bacterial suspension (OD = 40), 0.1 M p-methylsulfonylbenzaldehyde, 1 M glycine, 100 μM pyridoxal phosphate, 100 μM MnCl2, and 10% DMSO in a reaction buffer of 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH = 8. The reaction temperature was controlled at 25°C, 30°C, 35°C, 40°C, and 45°C in a water bath with magnetic stirring. The reaction was continued for 16 hours, and the concentration and desaturation value of the product, D-thero-p-methylsulfonylphenylserine, were determined by liquid chromatography.

[0051] See the results Figure 3 Different temperatures significantly affected the catalytic activity of FmDTA, with its activity exhibiting a positive trend with temperature. The optimal catalytic effect was observed at 35°C, while enzyme activity was relatively low at temperatures below or above this temperature.

[0052] Example 3 Optimal pH for the synthesis of D-threonine aldolase mutants catalyzing D-threonine p-methylsulfonylphenylserine

[0053] Whole cells of the D-threonine aldolase mutant C148F / R147F / Y177F / S312A were used as catalysts.

[0054] Reaction system: whole cell bacterial liquid with OD=40, 0.1 M p-methylsulfonylbenzaldehyde, 1 M glycine, 100 μM pyridoxal phosphate, 100 μM MnCl2, 10% DMSO, and the reaction buffers are buffers of different pH values, namely: 50 mM disodium hydrogen phosphate-citric acid buffer at pH=5, 50 mM disodium hydrogen phosphate-citric acid buffer at pH=6, 50 mM sodium phosphate buffer at pH=6.5, 50 mM sodium phosphate buffer at pH=7, 50 mM dipotassium hydrogen phosphate-dipotassium hydrogen phosphate buffer at pH=7.5, 50 mM dipotassium hydrogen phosphate-potassium hydrogen phosphate buffer at pH=8, and 50 mM HEPES at pH=8.5. 50mM Tris-HCl buffer with pH=9, 50mM Tris-HCl buffer with pH=9.5, and 50mM boric acid buffer with pH=10 were used, the reaction temperature was controlled at 35°C in a water bath, magnetic stirring was applied, the reaction was carried out for 16 hours, and the concentration and de value of the product D-thero-methylsulfonylphenylserine were detected by liquid chromatography.

[0055] See the results Figure 4 The optimal enzyme activity for FmDTA is at pH 8.5. In acidic buffers (pH 5.0-6.5), FmDTA's cleavage activity is relatively limited, but reaches its maximum as the pH increases to 8.5. Conversely, as the buffer becomes more alkaline, the activity gradually decreases.

[0056] Example 4D - Kinetic Parameters of Threonine Aldolase Mutants

[0057] The specific activity of the D-threonine aldolase mutant C148F / R147F / Y177F / S312A was determined in the presence of different concentrations of p-methylsulfonylbenzaldehyde. A double reciprocal curve was drawn based on the reciprocal of the specific activity and substrate concentration, and the kinetic parameters were calculated. The results were Km of 5.176 mM, Kcat of 340 S, and kinetic parameters of 5.176 mM and 340 S, respectively. -1 .

Claims

1. A highly stereoselective D-threonine aldolase mutant, characterized in that: The amino acid sequence of the D-threonine aldolase mutant is obtained by mutation of the sequence shown in SEQ ID NO: 1, wherein the mutation includes: asparagine at position 146 is mutated to any one of glycine, lysine, arginine, glutamic acid, and glutamine, and / or arginine at position 147 is mutated to any one of phenylalanine and tyrosine, and / or cysteine ​​at position 148 is mutated to phenylalanine, and / or tyrosine at position 177 is mutated to any one of phenylalanine, histidine, and tryptophan, and / or serine at position 312 is mutated to any one of alanine, leucine, and threonine; The mutant is any one of Y177F / S312A, R147F / Y177F / S312A, N146R / R147F / Y177F / S312A, N146K / R147F / Y177F / S312A, N146G / R147F / Y177F / S312A, and C148F / R147F / Y177F / S312A.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the D-threonine aldolase mutant according to claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that The nucleotide sequence of the nucleic acid molecule is obtained by base mutation of the sequence shown in SEQ ID NO:

2.

4. An expression vector, characterized in that The expression vector comprises the nucleotide sequence of claim 3.

5. A recombinant cell, characterized in that The recombinant cell comprises the expression vector according to claim 4.

6. A method for constructing the recombinant cell according to claim 5, characterized in that: The steps include: (1) Constructing an expression vector: ligating the nucleic acid molecule of claim 2 with a plasmid to obtain the expression vector of claim 4; (2) Constructing recombinant cells: The constructed expression vector is transferred into competent cells, and the recombinant cells according to claim 5 are obtained by culture and screening.

7. A product, characterized in that The product comprises the D-threonine aldolase mutant according to claim 1, or the nucleic acid molecule according to any one of claims 2 to 3, or the expression vector according to claim 4, or the recombinant cell according to claim 5.

8. A product according to claim 7 in the synthesis of D-threo-p-methylsulfonylphenylserine (D- thero Application of p-methylsulfonylphenylserine).

9. The use according to claim 8, characterized in that The applied reaction conditions include reacting for 10 to 20 hours at a temperature of 25 to 45° C. and a pH of 5.5 to 10.0.

Images