CrRNA, kit and method for detecting r882h mutation of dnmt3a gene

Abstract

The application discloses a kind of crRNA, kit and method for detecting DNMT3A gene R882H mutation, the nucleotide sequence of the crRNA is as shown in SEQ ID NO:3, the kit includes above-mentioned crRNA, and the sequence as shown in SEQ ID NO:4 forward primer and the sequence as shown in SEQ ID NO:5 reverse primer.Utilize the crRNA and PCR amplification primer designed in the application, the detection can be carried out to the marrow puncture of to-be-measured sample, can distinguish DNMT3A gene wild type and R882H mutant with high sensitivity, high specificity, and the detection method of the application is low in cost, simple to operate.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of molecular biology, and more particularly, the present application relates to a crRNA, a kit and a method for detecting DNMT3A gene R882H mutation. BACKGROUND

[0002] Acute myeloid leukemia (AML) is a kind of heterogeneous blood system malignant tumor which seriously endangers human health, and its incidence rate ranks first among adult leukemia in China. DNA methyltransferase 3A (DNMT3A) is located in 2q23 of human chromosome 2 short arm, and is one of the important methylation transferases, which is mainly responsible for de novo methylation of genomic DNA. The mutation of DNMT3A will cause abnormal methylation of DNA, and the abnormal methylation of DNA will affect the stability of chromosome structure and DNA replication, recombination and repair, thereby promoting the occurrence and rapid expansion of tumor malignant clone.

[0003] Studies have shown that DNMT3A mutant accounts for about 20% in adult AML patients, 60% of which are R882 site mutations, and the most common one is R882H mutation, which is an important molecular biology marker for stratified treatment and poor prognosis of patients. In addition, compared with AML patients with wild-type DNMT3A, DNMT3A gene mutant patients are often normal karyotype, therefore, detecting the mutation site of DNMT3A gene can be used as a prognostic indicator for identifying normal karyotype AML patients.

[0004] At present, in the detection method of DNMT3A gene R882H mutation, Sanger sequencing technology is a classical method, but its sensitivity is low, and false negative may occur when detecting low frequency mutation; fluorescence in situ hybridization (FISH) and gene chip technologies have complex operation; although NGS technology can qualitatively and quantitatively detect, it has long detection time, complex operation, high cost, and high data volume requirement for low frequency mutation.

[0005] Therefore, there is a need for a low-cost, simple-to-operate, high-sensitivity and high-specificity detection method for DNMT3A gene R882H mutation. SUMMARY

[0006] Therefore, there is a need for a low-cost, simple-to-operate, high-sensitivity and high-specificity detection method for DNMT3A gene R882H mutation.

[0007] The technical scheme for achieving the above object comprises the following.

[0008] In a first aspect of the present application, a crRNA for detecting a DNMT3A gene R882H mutation is provided, and the nucleotide sequence of the crRNA is shown in SEQ ID NO: 3.

[0009] In a second aspect of the present application, a kit for detecting a DNMT3A gene R882H mutation is provided, and the kit comprises the above crRNA and amplification primers, wherein the amplification primers comprise a forward primer with a sequence shown in SEQ ID NO: 4 and a reverse primer with a sequence shown in SEQ ID NO: 5.

[0010] In a third aspect of the present application, a method for detecting a DNMT3A gene R882H mutation is provided, and the method uses the above kit for detection, and comprises the following steps: performing PCR amplification on genomic DNA of a sample to be tested and genomic DNA of a healthy person using the amplification primers respectively, performing CRISPR / Cas12 enzyme cutting reaction on the PCR amplification products, and reading a fluorescence value.

[0011] In the present application, based on a PCR-CRISPR / Cas12a system, a crRNA for detecting a DNMT3A gene R882H mutation is designed, and 1 mismatched base is introduced at a specific position of the crRNA, and a PAM site of TTTV is introduced by introducing a mismatched base in a forward primer of a PCR amplification primer, so as to solve the problem of no PAM region at the target mutation site; under this concept, the crRNA and the PCR amplification primer designed in the present application are used to detect a sample to be tested, so as to distinguish a wild type of a DNMT3A gene and a R882H mutant type with high sensitivity (the minimum detection limit can reach 10 copies / μL) and high specificity (a 0.1% low-abundance mutant sample can be detected), and the detection method of the present application has low cost and simple operation. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 The fluorescence values of 7 crRNAs in Example 2 of the present application for detecting DNMT3A gene wild type fragments (WT), DNMT3A gene R882H mutant type fragments (MT) and nuclease-free water (NTC) are shown in Table 1.

[0013] Figure 2 The fluorescence value ratios of 7 crRNAs in Example 2 of the present application for detecting DNMT3A gene wild type fragments (WT) and DNMT3A gene R882H mutant type fragments (MT) are shown in Table 2.

[0014] Figure 3Results for sensitivity and specificity of the detection method in Example 3 of the present application.

[0015] Figure 4 Results for detection of clinical samples in Example 4 of the present application. DETAILED DESCRIPTION

[0016] In order to facilitate the understanding of the present application, the present application will be described more fully below. The present application can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided so that the disclosure of the present application can be more thoroughly and completely understood.

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terminology used in the description of the present application is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. As used in the description of the present application, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0018] The experimental methods in the following examples, unless otherwise specified, are generally carried out according to conventional conditions, such as those described in Green and Sambrook et al., Molecular Cloning: A Laboratory Manual, 2013, or according to the conditions recommended by the manufacturer. The various common chemical reagents used in the examples are commercially available.

[0019] CRISPR (clustered regularly interspaced short palindromic repeats, CRISPR) / Cas (CRISPR-associated proteins, Cas) is a bacterial adaptive immune system that has been widely used in gene editing and nucleic acid detection. CRISPR / Cas12 directs double-stranded DNA cleavage by a single RuvC catalytic domain guided by RNA, where Cas12 has a target DNA-primed non-specific transcleavage activity against single-stranded DNA, which has been used to develop a rapid, accurate and sensitive nucleic acid detection method based on its continuous signal amplification and single-base resolution capability. The detection method of the present application based on the PCR-CRISPR / Cas12a system detects the DNMT3A gene R882H mutation by designing crRNA and amplification primers for the DNMT3A gene R882H mutation, which has the characteristics of low cost, simple operation, high sensitivity (the minimum detection limit reaches 10 copies / μL), and strong specificity.

[0020] In some embodiments of the present application, a crRNA for detecting the R882H mutation of the DNMT3A gene is disclosed, and the nucleotide sequence of the crRNA is shown in SEQ ID NO: 3.

[0021] In some embodiments of the present application, a kit for detecting the R882H mutation of the DNMT3A gene is disclosed, and the kit comprises the above-mentioned crRNA, and an amplification primer, wherein the amplification primer comprises a forward primer with a sequence shown in SEQ ID NO: 4 and a reverse primer with a sequence shown in SEQ ID NO: 5.

[0022] In some embodiments, the kit further comprises a fluorescent probe, wherein the nucleotide sequence of the fluorescent probe is 5-15 random bases, the 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end of the fluorescent probe is labeled with a quenching group.

[0023] In some embodiments, the fluorescent group is FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE or Texas Red, and the quenching group is TAMRA, DABCYL, MGB, BHQ-1, BHQ-2 or BHQ-3.

[0024] In some embodiments of the present application, a method for detecting the R882H mutation of the DNMT3A gene is disclosed, and the method uses the above-mentioned kit, and comprises the following steps: performing PCR amplification on the genomic DNA of the bone marrow puncture of the sample to be tested and the genomic DNA of a healthy person respectively using the amplification primer, performing CRISPR / Cas12 enzyme cutting reaction on the PCR amplification product, and then reading the fluorescence value.

[0025] In some embodiments, the reaction system of the PCR amplification comprises: MasterMix 25 μL, forward primer and reverse primer with a final concentration of 0.4-0.6 μM, 5-20 μL template, and nuclease-free water added to 50 μL.

[0026] In some embodiments, the reaction program of the PCR amplification is: pre-denaturation for 30 s; denaturation for 10 s, annealing for 10 s, extension for 10 s, and cycling for 35 times.

[0027] In some embodiments, the reaction system of the CRISPR / Cas12 enzyme cutting reaction comprises: NEBuffer 2 μL, Cas12a with a final concentration of 0.05 μM-0.2 μM, crRNA with a final concentration of 0.05 μM-0.2 μM, 15-25 U Recombination RNase inhibitor, fluorescent probe 0.25 μM-1 μM, 2 μL-10 μL PCR amplification product, and nuclease-free water added to 20 μL.

[0028] In some embodiments, the reaction temperature of the CRISPR / Cas12 enzyme cleavage reaction is 37℃±2℃, and the reaction time is 10-30 min.

[0029] In some embodiments, the method further comprises the step of analyzing the fluorescence value, and when the fluorescence value of the sample to be tested is significantly different from the fluorescence value of the healthy person sample, it is determined that the DNMT3A gene of the sample to be tested has the R882H mutation.

[0030] In the following examples, the probes and primers were synthesized by Shanghai Jeery Bioengineering Co., Ltd.

[0031] The present application will be described in detail below in conjunction with the accompanying drawings and specific examples.

[0032] Example 1: Method for detecting R882H mutation of DNMT3A gene

[0033] 1. Design crRNA, PCR amplification primers, and single-stranded DNA fluorescent probe FQ-ssDNA reporter

[0034] According to the R882H mutation site of the DNMT3A gene, a sequence of 18 nt complementary to the mutant type is designed, and a crRNA is constructed, and the sequence is shown as SEQ ID NO: 3. Synthesis of crRNA.

[0035] Since Cas12 recognizes the target sequence and requires a specific PAM region (Protospacer adjacent motif, a fixed short sequence near the crRNA target binding region, TTTV), PCR amplification primers are designed by introducing T through primers, and the sequence is shown in Table 1.

[0036] Table 1: Primer sequences

[0037] Forward primer F CCACTATACTGACGTTTCCAACATGAGC (SEQ ID NO: 4) Reverse primer R ATGTCCCTTACACACACGCAA (SEQ ID NO: 5)

[0038] The nucleotide sequence of the fluorescent probe is 12 random bases, i.e. NNNNNNNNNNNN, and the 5' end of the probe is labeled with a fluorescent group FAM, and the 3' end is labeled with a quenching group BHQ-1.

[0039] 2. PCR pre-amplification

[0040] The genomic DNA of the sample to be tested and the genomic DNA of the healthy person were used as templates for PCR pre-amplification.

[0041] 50 μL PCR pre-amplification system includes: Q5 High-Fidelity 2X Master Mix 25 μL, forward primer and reverse primer with a final concentration of 0.4-0.6 μM, 20 μL template and nuclease-free water. PCR pre-amplification procedure: pre-denaturation 30 s; denaturation 10 s, annealing 10 s, extension 10 s, cycle 35 times.

[0042] 3. CRISPR fluorescence detection reaction

[0043] Take the PCR pre-amplification product for CRISPR / Cas12 enzyme cutting, mix the CRISPR / Cas12 enzyme cutting system, and immediately incubate at 37°C after short centrifugation, and use QuantStudio 5 to read the fluorescence value, compare the fluorescence value of the sample to be tested and the healthy sample (negative control sample), if the fluorescence value is significantly different (p≤0.05) compared with the fluorescence value of the healthy sample, then the DNMT3A gene of the sample to be tested has R882H mutation.

[0044] Among them, 20 μL of CRISPR / Cas12 enzyme cutting system includes: NEBuffer2.1 (10X) 2 μL, final concentration of 0.1 μM Lba Cas12a (Cpf1), final concentration of 0.2 μM crRNA, 20 U Recombination RNase inhibitor (RRI), FQ-ssDNA reporter 0.5 μM, 5 μL PCR amplification product and nuclease-free water.

[0045] Example 2 Screening of high-specificity crRNA

[0046] In order to improve the specificity of crRNA, 1 mismatch base was artificially introduced at different positions of crRNA, and 7 crRNAs were designed, in which crRNA1 was the original crRNA, and crRNA2-7 was the crRNA with 1 mismatch base artificially introduced. The specific sequences are shown in Table 2.

[0047] Table 2 crRNA sequence

[0048]

[0049] Note: Bold base A represents the mutation site, and italic bold base represents the artificially introduced mismatch base.

[0050] 1. Synthesis of plasmid containing DNMT3A gene wild type fragment and plasmid containing DNMT3A gene R882H mutant fragment

[0051] According to the NCBI search DNMT3A gene sequence, determine the site of mutation, by shengwotech biotechnology co., LTD. Synthesized containing DNMT3A gene wild type (WT) fragment (SEQ ID NO: 1) of plasmid (pUC57) and containing DNMT3A gene R882H mutant (MT) fragment (SEQ ID NO: 2) of plasmid (pUC57), wherein, WT and MT gene fragment sequence is as follows respectively:

[0052] SEQ ID NO: 1

[0053] GCTGTGTGGTTAGACGGCTTCCGGGCAGCCTGGTCTGGCCAGCACTCACC

[0054] CTGCCCTCTCTGCCTTTTCTCCCCCAGGGTATTTGGTTTCCCAGTCCACTAT

[0055] ACTGACGTCTCCAACATGAGCCGCTTGGCGAGGCAGAGACTGCTGGGCCG

[0056] GTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAGTA

[0057] TTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAA

[0058] GTTAAACAAACAAACAAAAAACACAAAACATAATAAAACACCAAGAACA

[0059] TGAGGATGGAGAGAAGTATCAGCACCCAGAAGAGAAAAAGGAATTTAAA

[0060] ACAAAAACCACAGAGGCGGAAATACCGGAGGGCTTTGCCTTGCGAAAAGSEQ ID NO: 2

[0061] GCTGTGTGGTTAGACGGCTTCCGGGCAGCCTGGTCTGGCCAGCACTCACC

[0062] CTGCCCTCTCTGCCTTTTCTCCCCCAGGGTATTTGGTTTCCCAGTCCACTAT

[0063] ACTGACGTCTCCAACATGAGCCACTTGGCGAGGCAGAGACTGCTGGGCCG

[0064] GTCATGGAGCGTGCCAGTCATCCGCCACCTCTTCGCTCCGCTGAAGGAGTA

[0065] TTTTGCGTGTGTGTAAGGGACATGGGGGCAAACTGAGGTAGCGACACAAA

[0066] GTTAAACAAACAAACAAAAAACACAAACATAATAAAACACCAGAACA

[0067] TGAGGATGGAGAGAAGTATCAGCACCCAGAAGAGAAAAAGGAATTTAAA

[0068] ACAAAAACCACAGAGGCGGAAATACCGGAGGGCTTTGCCTTGCGAAAAG

[0069] 2. Using plasmids containing the wild-type (WT) fragment of the DNMT3A gene, plasmids containing the R882H mutant (MT) fragment of the DNMT3A gene, and nuclease-free water (NTC) as test samples (templates), the method in Example 1 was used to test each crRNA and compare the sensitivity and specificity of different crRNAs.

[0070] Fluorescence results as follows Figure 1 As shown. From Figure 1 It can be seen that the WT signals of crRNA5 and crRNA6 are relatively low, that is, the specificity of crRNA5 and crRNA6 is worse than that of other crRNAs. However, within 20 to 30 minutes, the MT signal of crRNA6 is significantly lower than that of crRNA5.

[0071] When the incubation time was 20 min, the ratio of MT to WT fluorescence values ​​of different crRNAs was compared (Fluorence). MT / Fluorence WT The result is as follows Figure 2 As shown, MT and WT in crRNA5 have the largest difference in fluorescence value.

[0072] comprehensive Figure 1 and Figure 2 The results showed that crRNA5 (SEQ ID NO:3) had significantly better specificity and sensitivity.

[0073] Example 3 Sensitivity and specificity of the method for detecting R882H mutation of DNMT3A gene of the application

[0074] The linearized plasmid sample containing the R882H mutant fragment of DNMT3A gene was gradient diluted to 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 copies / μL, 1 copy / μL. In addition, the linearized plasmid containing the R882H mutant fragment of DNMT3A gene was mixed with healthy human genomic DNA (30 ng / μL, used to simulate clinical samples) to prepare samples with mutation frequencies of 100%, 10%, 1%, 0.1%, 0.01%, and 0% (i.e., all healthy human genomes) in turn.

[0075] 20 μL of each of the above samples was taken as a template, added to the PCR reaction system (same as in Example 1), and subjected to amplification. After amplification, 5 μL of the amplification product was added to the CRISPR / Cas12 enzyme cutting system (same as in Example 1) to perform CRISPR / Cas12 enzyme cutting reaction. The fluorescence results were read by QuantStudio 5, and the results are shown in Figure 3 .

[0076] Figure 3 The results show that the method of Example 1 of the application can detect R882H mutation of DNMT3A gene, and can achieve a sensitivity of 10 copies / μL (A in Figure 3 ) and detect a low-abundance mutant sample with a mutation frequency of 0.1% (B in Figure 3 ) from a wild-type sample when the reaction time is 20 min.

[0077] Example 4 Detection of clinical samples by the detection method of the application

[0078] In this example, bone marrow puncture samples from 5 AML patients (positive for detection of R882H mutation of DNMT3A gene in their bone marrow puncture samples) and 5 healthy people (negative for detection of R882H mutation of DNMT3A gene in their bone marrow puncture samples) from Yantai University Yuhuangding Hospital (the results of second-generation sequencing are shown in Table 3) were taken. Genomic DNA was extracted from each of the samples, and the concentration was detected. Then, 300 ng of the genomic DNA was taken as a template, and the method of Example 1 was used for detection. The fluorescence results were read by QuantStudio 5, and the results are shown in Figure 4 .

[0079] Table 3 Results of second-generation sequencing of clinical samples

[0080] Number Mutation rate (next generation sequencing) Number Mutation rate (next generation sequencing) Sample 1 1.60％ Sample 6 0 Sample 2 2.60％ Sample 7 0 Sample 3 3.10％ Sample 8 0 Sample 4 5％ Sample 9 0 Sample 5 23.00％ Sample 10 0

[0081] Figure 4 The results show that when the reaction time is 20 min, 5 negative samples (samples 6-10) do not produce obvious fluorescence signals after being cut by CRISPR / Cas12, and 5 positive samples (samples 1-5) produce fluorescence signals, and the fluorescence values are significantly different (p<0.05) compared with 5 negative samples (samples 6-10). The results are consistent with the results of second-generation sequencing (Table 3).

[0082] Each technical feature of the above-described embodiments can be combined arbitrarily. In order to make the description simple, each technical feature in the above-described embodiments is not described in all possible combinations, but as long as the combinations of the technical features do not exist, they should be considered as the scope of the description.

[0083] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as a limitation on the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of the patent of the present application should be subject to the appended claims.

Claims

1. A kit for detecting a DNMT3A gene R882H mutation, characterized in that, The kit comprises a crRNA with a nucleotide sequence as shown in SEQ ID NO: 3, amplification primers comprising a forward primer with a sequence as shown in SEQ ID NO: 4 and a reverse primer with a sequence as shown in SEQ ID NO: 5, and a fluorescent probe with a nucleotide sequence of 5-15 random bases; The method for detecting the R882H mutation of the DNMT3A gene comprises the following steps: performing PCR amplification on the genomic DNA of a bone marrow puncture sample and the genomic DNA of a healthy person using the amplification primers, respectively, then performing CRISPR / Cas12 enzyme cutting reaction on the PCR amplification products, and finally reading the fluorescence value; when the fluorescence value of the sample to be tested is significantly different from that of the healthy person, it is determined that the DNMT3A gene of the sample to be tested has the R882H mutation. 2.The kit for detecting R882H mutation of DNMT3A gene according to claim 1, characterized in that, The 5' end of the fluorescent probe is labeled with a fluorescent group, and the 3' end of the fluorescent probe is labeled with a quenching group. 3.The kit for detecting R882H mutation of DNMT3A gene according to claim 2, characterized in that, The fluorescent group is FAM, VIC, HEX, TRT, Cy3, Cy5, ROX, JOE or Texas Red, and the quenching group is TAMRA, DABCYL, MGB, BHQ-1, BHQ-2 or BHQ-3. 4.The kit for detecting R882H mutation of DNMT3A gene according to claim 1, characterized in that, The reaction system of the PCR amplification comprises: Master Mix 25 μL, forward primer and reverse primer with a final concentration of 0.4-0.6 μM, 5-20 μL template, and nuclease-free water added to 50 μL. 5.The kit for detecting R882H mutation of DNMT3A gene according to claim 4, characterized in that, The reaction program of the PCR amplification is: pre-denaturation for 30 s; denaturation for 10 s, annealing for 10 s, extension for 10 s, and cycling for 35 times. 6.The kit for detecting R882H mutation of DNMT3A gene according to claim 1, characterized in that, The reaction system of the CRISPR / Cas12 enzyme cutting reaction comprises: NEBuffer 2 μL, Cas12a with a final concentration of 0.05 μM-0.2 μM, crRNA with a final concentration of 0.05 μM-0.2 μM, 15-25 U Recombination RNase inhibitor, 0.25 μM-1 μM fluorescent probe, 2 μL-10 μL PCR amplification product, and nuclease-free water added to 20 μL. 7.The kit for detecting R882H mutation of DNMT3A gene according to claim 6, characterized in that, The reaction temperature of the CRISPR / Cas12 enzyme cutting reaction is 37℃±2℃, and the reaction time is 10-30 min.

Images