Molecular marker associated with cold tolerance in arrow leek pea on chromosome 1 and application thereof

CN118792447BActive Publication Date: 2026-05-15LANZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
LANZHOU UNIV
Filing Date
2024-08-27
Publication Date
2026-05-15

AI Technical Summary

Technical Problem

因此,分子标记的开发和辅助选择育种在箭筈豌豆中逐步展开,但目前仍缺乏大量可靠的分子标记

Benefits of technology

[0023] (1) The inventors of this invention screened out a molecular marker Vs_Chr1_34169935 that is related to the cold resistance trait of arrow pea. This molecular marker is located on chromosome 1. Using the molecular marker Vs_Chr1_34169935 of this invention, the cold resistance trait of arrow pea can be quickly and accurately identified.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118792447B_ABST
    Figure CN118792447B_ABST
Patent Text Reader

Abstract

The application provides a molecular marker related to cold tolerance of arrowhead pea on chromosome 1 and application, and belongs to the technical field of biology. Through whole genome association analysis, an InDel site is located in the arrowhead pea and named as Vs_Chr1_34169935, and the nucleotide sequence of the insertion or deletion fragment is shown in the sequence table SEQ ID NO. 3. A primer pair for amplifying the molecular marker is shown in the nucleotide sequences of SEQ ID NO. 1-2. The molecular marker and the primer pair thereof can identify or assist in identifying the cold tolerance of the arrowhead pea. Meanwhile, the application also provides a method for rapidly identifying the cold tolerance of the arrowhead pea by using the molecular marker. The method is simple and fast, the identification result is accurate, and has a good popularization and application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an InDel molecular marker Vs_Chr1_34169935 related to the cold resistance of arrowhead pea and its application. Technical Background

[0002] Extreme climate is a significant factor influencing plant distribution. In northern my country, low-temperature stress significantly impacts crop life cycles. Therefore, breeding cold-resistant Vicia sativa L. germplasm is crucial for extending its growth cycle, increasing yield, and expanding its distribution range. Since Vicia sativa breeding started relatively late, research on the development and localization of molecular markers remains limited. Therefore, developing markers associated with cold resistance through genome-wide association analysis combined with molecular markers will help predict and screen cold-resistant germplasm, which is of great significance for constructing a selection-assisted breeding system, improving germplasm resources, and developing new varieties.

[0003] Genome-wide association study (GWAS) is a method that identifies genetic variations associated with specific traits by comparing genomic data from different individuals. It is closely linked to molecular markers, and their applications in genetic research and breeding are complementary. GWAS can identify molecular markers associated with target traits, which can then be used for subsequent selective breeding. By using these markers, breeders can more effectively screen for individuals with superior traits, thereby accelerating the breeding process. Therefore, the development of molecular markers and their application in assisted selection breeding have gradually progressed in arrowhead pea, but a large number of reliable molecular markers are still lacking. Summary of the Invention

[0004] One objective of this invention is to provide an InDel molecular marker associated with the cold-resistance trait of arrowhead pea.

[0005] The second objective of this invention is to provide a method for identifying the cold resistance trait of arrowhead pea.

[0006] A third objective of this invention is to provide the application of the InDel molecular markers related to the cold-resistant traits of arrowhead pea.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The molecular marker disclosed in this invention, which is related to the cold resistance trait of *Vaccaria spp.*, is located on chromosome 1 of *Vaccaria spp.*, and is named Vs_Chr1_34169935.

[0009] Primer pairs were used to amplify molecular markers associated with cold-resistance traits in *Vaccaria spp.* var. * ...

[0010] Vs_Chr1_34169935-F: CAACGCATAACCAGCATAAG;

[0011] Vs_Chr1_34169935-R: TATAGTGGAATGCATGAATATCACAT.

[0012] This invention also discloses the application of the above-mentioned molecular marker primer pairs in marker-assisted breeding of cold-resistant traits in *Viburnum sarmentosum*. In other words, the molecular markers of this invention can be used in future marker-assisted breeding. By extracting DNA from leaves during the seedling stage and detecting the presence of the molecular markers of this invention, the cold-resistantness of *Viburnum sarmentosum* materials can be identified. The detection can be performed using PCR, specifically using the above-mentioned molecular marker primer pairs, or it can be performed using sequencing methods.

[0013] This invention also discloses the application of the above-mentioned molecular markers in identifying the cold resistance of *Vicia sativa*, especially in screening and identifying the level of cold resistance of *Vicia sativa*. Specifically, the specific steps for identifying whether *Vicia sativa* has a high cold resistance trait are as follows:

[0014] (1) Using the DNA of the tested germplasm as a template for PCR amplification, PCR amplification was performed using the primer pair corresponding to the molecular marker Vs_Chr1_34169935. The PCR amplification reaction system is shown in Table 1:

[0015] Table 1 PCR amplification reaction system

[0016] reagents Volume added (μL) Genomic DNA 0.5 2×PCR Mix 5 upstream primer 0.5 Downstream primer 0.5 Sterile distilled water 3.5 Total volume 10

[0017] Pre-denaturation at 94℃ for 4 min; denaturation at 94℃ for 30 s, annealing at 48℃ for 30 s, extension at 72℃ for 6 s, 35 cycles; extension at 72℃ for 10 min; store at 4℃.

[0018] (2) Detection of PCR products by agarose gel electrophoresis: Take 5 μL of PCR products and judge the cold resistance of arrowhead pea based on the band results.

[0019] PCR amplification was performed using primers Vs_Chr1_34169935-F and Vs_Chr1_34169935-R. If the PCR amplification product contained only one characteristic band of 192 bp as shown in SEQ ID NO.4, then *Vaccaria salsa* was a cold-hardy type; if the PCR amplification product contained only one characteristic band of 128 bp as shown in SEQ ID NO.5, then *Vaccaria salsa* was a cold-hardy type.

[0020] In addition, this invention also protects a kit for identifying the cold resistance of *Vallisneria natans*, the kit containing primer pairs Vs_Chr1_34169935-F and Vs_Chr1_34169935-R. Other components of the kit are conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTPs, and Taq DNA polymerase. This invention does not impose any special restrictions on the concentration of the primer pairs; primer concentrations well-known in the art can be used. This invention also does not impose any special restrictions on the source of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; common PCR amplification reagents well-known in the art can be used.

[0021] The kit of this invention can rapidly identify the cold-hardy trait of *Viburnum sarmentosum* and its related genotypes. The specific method follows the steps for identifying whether *Viburnum sarmentosum* has high cold hardiness. Electrophoresis is performed on the PCR amplification products. If the PCR amplification product shows only one characteristic band of 192 bp as shown in SEQ ID NO.4, then the *Viburnum sarmentosum* is not cold-hardy; if the PCR amplification product shows only one characteristic band of 128 bp as shown in SEQ ID NO.5, then the *Viburnum sarmentosum* is cold-hardy.

[0022] The present invention has the following advantages:

[0023] (1) The inventors of this invention screened out a molecular marker Vs_Chr1_34169935 that is related to the cold resistance trait of arrow pea. This molecular marker is located on chromosome 1. Using the molecular marker Vs_Chr1_34169935 of this invention, the cold resistance trait of arrow pea can be quickly and accurately identified.

[0024] (2) Using markers related to cold resistance traits for screening is beneficial for molecular marker-assisted selection breeding. The method is simple and feasible, which can improve efficiency and save costs.

[0025] (3) The molecular markers of the present invention have the characteristics of convenient detection, stable amplification products and high specificity, and can be applied in a simple, rapid and high-throughput manner to the breeding practice and material identification of the high cold resistance trait of arrow pea. Attached Figure Description

[0026] Figure 1 The genome-wide association analysis results for the cold-hardy trait of arrowhead pea are obtained from the Manhattan plot based on EMMAX software analysis. The green dots indicate the InDel positions associated in this invention.

[0027] Figure 2This is a box plot showing the distribution of the cold hardiness trait corresponding to the genotype at locus Vs_Chr1_34169935 in the *Vallisneria natans* population in Example 1 of this invention. 0 / 0 indicates that the genotype at locus Vs_Chr1_34169935 is homozygous for the cold-hardy trait, and 1 / 1 indicates that the genotype at locus Vs_Chr1_34169935 is homozygous for the cold-hardy trait. The dots represent extreme values ​​of the data, and Wilcox tests were used to assess the differences.

[0028] Figure 3 This is a partial sequence alignment result between cold-resistant and non-cold-resistant materials in the region associated with cold-resistant traits.

[0029] Figure 4 Electrophoresis images of molecular markers amplified from 11 *Vaccinium bracteatum* germplasm resources, using agarose gels with a concentration of 2.5%.

[0030] In the diagram, M represents a DNA marker. Detailed Implementation

[0031] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, unless otherwise specified, the specific experimental methods involved in the following embodiments are conventional methods or implemented according to the conditions recommended in the manufacturer's instructions.

[0032] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, the reagents and materials used can be purchased commercially.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0034] Example 1: Development of molecular markers associated with cold hardiness in arrowhead pea.

[0035] This invention determined the cold tolerance traits of *Vicia sativa* at the initial flowering stage. After measuring the ion permeability of the *Vicia sativa* population under low-temperature stress (-20℃, 1 h; 4℃, 12 h), a *InDel* locus was located in *Vicia sativa* through genome-wide association study (GWAS). Figure 1The green locus, named Vs_Chr1_34169935, is located at locus 34169935 on chromosome 1 of the *Vaccinium bracteatum* reference genome. The first allele is genotype 0 / 0, and the second allele is genotype 1 / 1. A box plot showing the distribution of cold hardiness traits corresponding to the genotypes at locus Vs_Chr1_34169935 in the population is shown. Figure 2 This indicates that the cold hardiness of *Vicia sativa* genotype 0 / 0 is significantly lower than that of *Vicia sativa* genotype 1 / 1. At locus 34169935 on chromosome 1 of *Vicia sativa*, the insertion / deletion fragment is TAATTAGATATCTTCATTCTCAAATTTGTCAAAAAGTACTTATTCTTAAATAATAATAACAATA (shown in SEQ ID NO. 3). Figure 3 The insertion of the fragment shown in SEQ ID NO.3 affects the cold resistance of arrow-shaped peas. Arrow-shaped peas with the fragment shown in SEQ ID NO.3 inserted are cold-resistant arrow-shaped peas; arrow-shaped peas without the fragment shown in SEQ ID NO.3 are cold-resistant arrow-shaped peas.

[0036] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using Snapgene software:

[0037] Vs_Chr1_34169935-F: CAACGCATAACCAGCATAAG (shown in SEQ ID NO.1);

[0038] Vs_Chr1_34169935-R: TATAGTGGAATGCATGAATATCACAT (as shown in SEQ ID NO.2).

[0039] Then, the primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous non-hardy arrowhead pea sample had only a 192bp characteristic band, while the PCR product of the homozygous hardy arrowhead pea sample had a 128bp characteristic band.

[0040] Example 2: Accuracy verification of the molecular markers described in this invention

[0041] Table 2. Ion permeability of 215 germplasm materials and their corresponding genotypes at the Vs_Chr1_34169935 locus.

[0042]

[0043]

[0044]

[0045] 1) Using the genomic DNA of the arrowhead pea to be identified as a template, PCR amplification was performed using the primer pair to obtain the PCR product;

[0046] The PCR amplification reaction system is as follows: template DNA 10–192 ng, 10 μM forward primer 0.5 μL, 10 μM reverse primer 0.5 μL, 2×Taq PCR Master Mix 5 μL, and deionized water to a final volume of 10 μL. The preferred PCR amplification reaction program is: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 30 s, 48℃ annealing for 30 s, 72℃ extension for 6 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃. Separation is performed by electrophoresis on a 2.5% agarose gel. After loading, the samples are electrophoresed at 125V, 400mA DC for 25 min, and the PCR banding patterns of each sample are then read.

[0047] 2) Determine the cold resistance of arrowhead peas based on the size of the PCR products:

[0048] When the fragment shown in SEQ ID NO.3 is inserted into the PCR product of the *Vaccaria spp.* to be identified, the band length of the PCR product is 192 bp (SEQ ID NO.4), then the *Vaccaria spp.* to be identified is a cold-intolerant *Vaccaria spp.*

[0049] The sequence of SEQ ID NO.4 is as follows:

[0050]

[0051] When the PCR product of the *Vaccaria serrata* to be identified is missing the fragment shown in SEQ ID NO.3, and the band length of the PCR product is 128 bp (SEQ ID NO.5), then the *Vaccaria serrata* to be identified is a cold-resistant *Vaccaria serrata*.

[0052] The sequence of SEQ ID NO.5 is as follows:

[0053]

[0054] Furthermore, Table 2 shows that among the 215 *Viburnum cuspidatum* germplasm accessions identified in this study, 199 accessions had a genotype of 0 / 0 at the Vs_Chr1_34169935 locus, and their average ion permeability was 0.683, classifying them as cold-hardy *Viburnum cuspidatum*. The remaining 16 accessions had a genotype of 1 / 1 at the Vs_Chr1_34169935 locus, and their average plant ion permeability was 0.439, classifying them as cold-hardy *Viburnum cuspidatum*. Analysis of variance showed a significant difference in ion permeability between the cold-hardy and cold-hardy *Viburnum cuspidatum* types (P < 0.05).

[0055] Select 11 germplasm samples (according to...) Figure 4 The PI numbers, from left to right, are: 'PI 185041', 'PI183723', 'PI 393867', 'PI 340158', 'PI 173160', 'PI 220890', 'PI 284380', 'PI284077', 'PI 290741', 'PI 284406', 'PI 179549'. PCR testing was performed, and the results corresponded consistently with the genotype at the Vs_Chr1_34169935 locus and the actual ion permeability measurements. Figure 4 Therefore, the InDel molecular marker of the present invention can effectively identify the cold resistance of arrowhead pea and can be used for the prediction and screening of arrowhead pea materials with strong cold resistance.

[0056] The embodiments described above are merely preferred embodiments of the present invention and are only used to explain the present invention. They are not intended to limit the scope of the present invention. For those skilled in the art, other implementation methods can be easily made by substitution or modification based on the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. The molecular marker Vs_Chr1_34169935 associated with cold resistance in *Vaccaria buergeriana*, characterized by, The nucleotide sequence of the molecular marker Vs_Chr1_34169935 is shown in SEQ ID NO.4 and SEQ ID NO.

5. This molecular marker is an insertion / deletion of the fragment shown in SEQ ID NO.3 on chromosome 1 of the *Vaccinium bracteatum* reference genome. The primer pair sequence for amplifying the molecular marker Vs_Chr1_34169935 is as follows: Vs_Chr1_34169935-F: CAACGCATAACCAGCATAAG; Vs_Chr1_34169935-R: TATAGTGGAATGCATGAATATCACAT.

2. The application of the primer pair for detecting the molecular marker Vs_Chr1_34169935 described in claim 1 in the auxiliary identification of the cold resistance of *Vaccaria buergeriana*.

3. A method for auxiliary identification of cold resistance traits in arrowhead pea, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and detect the PCR amplification product by electrophoresis; (3) The determination is based on the electrophoresis band results of step (2), and the specific criteria are as follows: PCR amplification was performed using primers Vs_Chr1_34169935-F and Vs_Chr1_34169935-R. If the PCR amplification product contained only one characteristic band of 192 bp as shown in SEQ ID NO.4, then *Vaccaria salsa* was a low-cold-resistant type; if the PCR amplification product contained only one characteristic band of 128 bp as shown in SEQ ID NO.5, then *Vaccaria salsa* was a high-cold-resistant type.

4. The application of a reagent kit in assisting in the identification of cold-resistant genotypes in *Vigna arvense*, characterized in that... The kit contains the primer pair described in claim 1, and the method for auxiliary identification of the cold-resistant genotype of *Vallis fulva* using the kit is as follows: (1) Extract genomic DNA from the target *Vitis hyacinthus* pea; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the primer pair of the molecular marker described in claim 1, and detect the PCR amplification product by electrophoresis; (3) Based on the electrophoresis results of the PCR amplification products, if the PCR amplification products have only one characteristic band of 192 bp as shown in SEQ ID NO.4, then the arrowhead pea is a low cold-resistant genotype; if the PCR amplification products have only one characteristic band of 128 bp as shown in SEQ ID NO.4, then the arrowhead pea is a high cold-resistant genotype.