A snp molecular marker related to pork production efficiency and growth rate of pigs and application thereof
By screening for the SNP locus rs336112059 on pig chromosome 15, the problem of low efficiency in traditional pig breeding was solved, enabling precise selection of pig meat production efficiency and growth rate, thereby improving breeding efficiency and economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-14
- Publication Date
- 2026-03-31
AI Technical Summary
Traditional pig breeding relies on phenotypic selection, which is inefficient and makes it difficult to quickly improve the meat production efficiency and growth rate of pigs. Existing SNP molecular marker technology is not widely used in breeding.
By cloning the gene sequence of the segment 126105514-126106224 on pig chromosome 15, the SNP locus rs336112059 was screened out, and primer pairs were designed for PCR amplification and sequencing. The association between rs336112059 and the pig meat production trait and growth rate was analyzed, and a genetic marker for the TT genotype as a favorable genotype was provided.
It enables precise selection of pig meat production efficiency and growth rate. Individuals with the TT genotype exhibit thin backfat, thick fat, large eye muscle area and depth, and shorten the age of reaching 100 kg body weight, thereby improving breeding efficiency and economic benefits.
Smart Images

Figure CN118813828B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to the use of an SNP molecular marker related to pig meat production efficiency and growth rate. The molecular marker is cloned from the 126105855th base of pig chromosome 15, which is located in the promoter region of the LOC106507223 gene. Background Technology
[0002] China is the world's largest producer and consumer of pork. [1] China's pig farming industry is not only a vital pillar of the agricultural economy but also has a profound impact on social welfare. However, the industry faces multiple challenges, including the inefficient use of genetic resources, lagging innovation in breeding technology, an imperfect disease prevention and control system, and increasing environmental pressure. Breeding technology, as the key to unlocking the genetic potential of pigs, is crucial for promoting the high-quality development of the industry. China's pig farming industry is undergoing a significant transformation from reliance on imports to independent innovation. With the help of technological innovation and policy guidance, breeders have conducted extensive research and practical exploration in areas such as improving lean meat percentage, high reproductive performance, accelerated growth rate, enhanced stress resistance, optimized feed conversion efficiency, and improved meat flavor, aiming to build an efficient, healthy, and sustainable modern breeding system.
[0003] Traditionally, pig breeding has relied on phenotypic selection, a method that is both time-consuming and inefficient. In recent years, advances in molecular genetics, particularly the application of SNP (Single Nucleotide Polymorphism) molecular marker breeding, have opened new avenues for pig breeding. [2] SNPs (Single Nucleotides) refer to genomic polymorphisms caused by variations such as insertions, deletions, and substitutions of single nucleotides. As a common form of genetic variation, SNPs can occur in both coding and non-coding regions of the genome and are considered a powerful tool for studying animal genetic characteristics. Particularly in long non-coding RNAs (lncRNAs), the discovery of SNPs is crucial for understanding gene expression regulation mechanisms. With the development of high-throughput sequencing technology, multiple databases such as lncRNASNP2, lincSNP, and LncVar have included a large number of non-coding region SNPs. [3-5] This reveals their roles in gene regulatory networks. For example, in gene regulatory regions, SNPs can alter the binding ability of transcription factors, thereby affecting gene expression levels. [6]Therefore, identifying SNP loci associated with key traits has become central to breeding strategies. Meat production traits, including daily weight gain, feed conversion ratio, carcass weight, dressing percentage, backfat thickness, lean meat ratio, and eye muscle area and depth, are all key areas of focus in breeding. By screening for these trait-related SNPs, breeders can accurately select individuals with superior genetic backgrounds, accelerating the development of high-quality breeds. Summary of the Invention
[0004] The purpose of this invention is to provide a SNP molecular marker related to pig meat production efficiency and growth rate, and to screen genetic markers associated with these traits. By cloning the gene sequence of the 126105514-126106224 segment of pig chromosome 15, and using direct sequencing to find SNP sites and genotyping, the association between these SNPs and pig meat production traits and growth rate is analyzed, thereby establishing new marker-assisted selection sites for these traits in pigs.
[0005] Another objective of this invention is to provide the application of the aforementioned SNP molecular marker in improving pig meat production efficiency and growth rate. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and a C>T base mutation exists at position 341 of this sequence, which alters backfat thickness, eye muscle area, eye muscle depth, and age-related traits in live pigs reaching 100 kg body weight. The TT genotype at this SNP locus is a favorable genotype for pig meat production efficiency and growth rate. This invention aims to discover and identify SNP loci associated with pig meat production and growth rate traits, thereby providing important guidance for pig genetic breeding.
[0006] This invention is achieved through the following technical solution:
[0007] A SNP molecular marker associated with porcine meat production efficiency and growth rate is disclosed. The SNP site corresponds to the gene sequence of segment 126105514-126106224 on porcine chromosome 15, with a fragment length of 730 bp. Its nucleotide sequence is shown in the attached sequence listing SEQ ID NO.1. BLAST alignment on the NCBI website revealed a nucleotide polymorphism (SNP) site within this amplified fragment, specifically as follows: Figure 3 As shown. The mutation at this SNP site is specifically located at base 126105855 on chromosome 15, where the base changes from C to T. According to the naming rules of the Ensembl database, this mutation site is named rs336112059.
[0008] The experimental materials included American Large White, French Large White, and Danish Large White pigs. Whole-genome DNA was extracted from the blood of these pigs, and primer pairs were designed based on the pig genome sequence (NC_010457.5) published in the NCBI database. The primer pair sequences are as follows:
[0009] Forward primer (SEQ ID NO.2): 5'-CTGCACCCATTAGCATATCAC-3',
[0010] Reverse primer (SEQ ID NO.3): 5'-GCTGGCTTCATCTTCATTCC-3'.
[0011] The primer pairs described above can be used to detect and genotype SNP sites in the gene region of chromosome 15, segment 126105514-126106224.
[0012] After PCR amplification using the aforementioned primer pairs, purification of the PCR product, cloning and sequencing, and sequence alignment analysis, a genetic marker associated with porcine meat production traits and growth rate was identified. The nucleotide sequence of this genetic marker is shown in SEQ ID NO.1 below, with the mutation site located at position 341 of the sequence.
[0013] SEQ ID NO.1:
[0014] CTGCACCCATTAGCATATCACCAATGTTTTTAGTGAGTCCCCAACCCACTGT
[0015] ATTAGTGTTGGGTATGTATGTATGTGTCTCTGCCCCTCATTTTATTTTATTTAA
[0016] TTTTTGTCTGCGCCCACAGCATGCAAAGTTCCCAGGCCAGGGATTGAAACT
[0017] GTCATAGCAGCAGTGACTTCATGGGATCCTTAACCCACTGCATCACCAGGG
[0018] AACTCCTGCCCCTCATTTTTTTTTTTTTTTTTTTTTGGTCTTTTTATGCCACAC
[0019] CTGCAGCATATGGAAGTTCCCAGGTTAGGGGTTGAATTGGAATTGCAGCTGCTGGCCTATGCCACAGCCATAGCAACAR(C / T)GGGATCTGAGCGGCATCTGT GACCTATACCACAGCTCGTGGCAACACCGGATACTTAACCCACTGATCGAGGCCAGGGATGAAACTTGAATCCTCATGGATCCTAGTCGGATTCATTTCCGCTGAGCCACAATGGAAACTCCGCCTCTCATTTTAATATGTACTTTCTGAGGCTGATTTTTCATAATTCTGGGTGATCACTTCT GCCCTTTCTTTCAGAGCACAGAATTTATGTGCAAACTATTGAGCTAGATGCTGCCTTGGGTGTAATAATCGATAAAGACATAGAAATACATAGAAGCATATGTTTAGCTTCGTTTGCCTGTCCAGCTCTAAATAATTTTGGCTTTTCCAATAATTTGTCTTGCTTGGAATGAAGATGAAGCCAGC
[0020] A method for screening genetic markers associated with pig meat production traits and growth rate, the method comprising the following steps:
[0021] Genomic DNA was extracted from the blood of American, French, and Danish Large White pigs. Primers were designed based on the genomic sequence from -341 to 389 upstream of this locus. The porcine genomic DNA was amplified by PCR using these primers, and the nucleotide sequence from -341 to 389 upstream of this locus (see SEQ ID NO. 1 for details) was obtained by direct sequencing. This sequence contains one SNP site. This mutation site can be used as a genetic marker for association analysis of meat production and growth rate traits in American, French, and Danish Large White pigs.
[0022] This invention provides a genotyping method for detecting SNP sites in the above sequence.
[0023] This invention further provides an application of direct sequencing to determine the association between individuals with different genotypes and meat yield and growth rate traits, including the following steps:
[0024] To determine the correlation between SNPs in the region 126105514-126106224 of porcine chromosome 15 and phenotypic differences in pigs, American, French, and Danish Large White pigs were selected as experimental materials. Polymorphisms were detected using direct sequencing, and the correlation between polymorphic sites and porcine meat production efficiency and growth rate was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values.
[0025] Compared with the prior art, the present invention has the following advantages and effects:
[0026] This invention studies and identifies a molecular marker affecting pig meat production efficiency and growth rate located at nucleotide 126105855 on chromosome 15. Specifically, the R at position 341 of this SNP molecular marker represents an allelic substitution, leading to polymorphism at this position: in the trait of live backfat thickness at 100 kg body weight, individuals with the TT genotype at this SNP locus have thinner live backfat thickness; in the trait of eye muscle area at 100 kg body weight, individuals with the TT genotype at this SNP locus have larger eye muscle area; and in the trait of eye muscle depth at 100 kg body weight, individuals with the TT genotype at this SNP locus have larger eye muscle depth. The TT genotype at this SNP locus is a favorable genotype for pig meat production efficiency. In the trait of age at 100 kg body weight, the TT genotype at this SNP locus results in a shorter age at 100 kg body weight, and the TT genotype at this SNP locus is a favorable genotype for pig growth rate. The present invention aims to discover and identify SNP loci associated with meat production traits and growth rate in pigs, thereby providing important guidance for pig genetic breeding. Attached Figure Description
[0027] Figure 1 This invention describes the cloning detection results of the 126105514-126106224 segment of porcine chromosome 15; the agarose gel concentration is 1%; wherein: lanes 1-2: PCR amplification products, lane M: DL2000 Maker;
[0028] Figure 2 Nucleotide sequence of segment 126105514-126106224 of porcine chromosome 15; the mutation site marked in red in the sequence shown is the specific site that causes polymorphism in this segment;
[0029] Figure 3 The sequencing map of the genetic marker sequence C>T of this invention. Detailed Implementation
[0030] Example 1: Obtaining DNA fragments from region 126105514-126106224 of porcine chromosome 15 and establishing a method for SNP detection.
[0031] Primer pairs were designed based on the genome sequence of the 126105514-126106224 segment of pig chromosome 15. The specific sequences are as follows:
[0032] Forward primer (SEQ ID NO.2): 5'-CTGCACCCATTAGCATATCAC-3',
[0033] Reverse primer (SEQ ID NO.3): 5'-GCTGGCTTCATCTTCATTCC-3'.
[0034] The above primer pairs were used to perform PCR amplification on the genomic DNA of different experimental pig groups.
[0035] The PCR reaction system is shown in Table 1.
[0036] Table 1 PCR reaction system
[0037]
[0038]
[0039] The PCR reaction conditions are shown in Table 2.
[0040] Table 2 PCR reaction conditions
[0041]
[0042] After purification and cloning, the obtained PCR product was sent to Wuhan Aoke Biotechnology Co., Ltd. for sequencing. BLAST alignment analysis revealed a C / T mutation at position 341 of the sequence.
[0043] Example 2: Correlation analysis and application of the genetic markers of the present invention with meat production efficiency and growth rate of different pig breeds.
[0044] To determine the correlation between SNPs in the region 126105514-126106224 of porcine chromosome 15 and phenotypic differences in pigs, this experiment selected American Large White (586 pigs), French Large White (515 pigs), and Danish Large White (581 pigs) as experimental materials. Polymorphisms were detected using direct sequencing, and the correlation between polymorphic sites and pig meat production efficiency and growth rate was analyzed. A mixed linear model in SAS statistical software was used to analyze the association between genotype and phenotypic values. The analysis model is as follows: Y ijkl =u+G i +F j +S k +B l +ε ijklm In the formula, Y ijklG represents the observed trait value; u represents the overall trait mean; G represents the observed trait value. i This is a genotype effect; F j S k B l For fixed effects, ε represents pedigree, sex, and batch effects. ijklm The error is random, assumed to follow the pattern N(0, σ). 2 )distributed.
[0045] Polymorphism detection was performed on the rs336112059 locus in the 126105514-126106224 region of pig chromosome 15, and three genotypes were detected in all of the above populations. The genotype frequencies and their distribution are shown in Table 3.
[0046] Table 3 Genotype and allele frequencies of the polymorphic site rs336112059
[0047]
[0048]
[0049] Table 3 shows that the C allele frequency of the polymorphic site rs336112059 is higher than the T allele frequency in American and French Large White pig populations, while the C allele frequency is lower than the T allele frequency in Danish Landrace pig populations. The Hardy-Weinberg equilibrium test results indicate that in French Large White (χ²) pigs... 2 =1.80, P=0.18>0.05) The genotype distribution of the polymorphic site rs336112059 conforms to the state of genetic equilibrium.
[0050] Table 4. Association analysis of polymorphic locus rs336112059 with meat production efficiency and growth rate.
[0051]
[0052] Note: The above values are the least squares mean ± standard error; within each pig breed, the same letter in the same column indicates no significant difference (P>0.05), and when the letters are different, lowercase letters indicate significant differences (P<0.05), uppercase letters indicate extremely significant differences (P<0.01), and unlabeled letters indicate no significant differences (P>0.05). The numbers in parentheses indicate the number of pigs.
[0053] The association analysis results in Table 4 showed that the polymorphic locus rs336112059 was significantly correlated with the backfat thickness at 100 kg body weight in American Large White, French Large White, and Danish Large White pigs (P<0.05). Specifically, the backfat thickness of individuals with the TT genotype was significantly lower than that of individuals with the CC genotype (P<0.05). Regarding the eye muscle area at 100 kg body weight, the eye muscle area of individuals with the TT genotype was significantly greater than that of individuals with the CC genotype in both American and French Large White pigs (P<0.01) (P<0.05). Regarding the eye muscle depth trait, the eye muscle depth of Danish Large White pigs with the TT genotype was significantly greater than that of those with the CC genotype (P<0.05). In terms of the age at 100kg body weight, the age at 100kg body weight was significantly lower in both French and Danish Large White pigs with the TT genotype than in those with the CC genotype (P<0.01) (P<0.05). From the perspective of genetic improvement and breeding, the TT genotype has a significant advantage in reducing backfat thickness at 100kg body weight, increasing eye muscle area and depth at 100kg body weight, and shortening the age at 100kg body weight. Therefore, in pig genetic breeding, CC-type breeding pigs can be gradually phased out, while TT-type breeding pigs can be retained to increase the frequency of the T allele at this locus generation by generation. This can reduce backfat thickness, increase eye muscle area and depth to improve meat production efficiency and lean meat percentage, and shorten the age at 100kg body weight to improve growth rate. Based on the above results, this invention hypothesizes that the polymorphic locus rs336112059 can serve as a potential genetic marker to increase pig meat production efficiency and growth rate. Utilizing this marker, more precise breeding of pigs can be carried out, accelerating the progress of pig genetic improvement and thus effectively improving the economic benefits of pig breeding.
[0054] Main References
[0055] [1] Liang Zhigang. Current development status and future prospects of the pig breeding industry [J]. New Agriculture, 2023, (19): 43-45.
[0056] [2] Duan Yixin, Zhang Linyun, Zhao Yongju. Methods for estimating the heritability of SNPs, influencing factors and their application in livestock and poultry breeding [J]. Journal of Animal Husbandry and Veterinary Medicine, 2024, 55(05): 1854-1865.
[0057] [3] Freimer NB,Sabatti C.Human genetics:variants in commondiseases.Nature.2007,445:828-830.
[0058] [4]Chen X,Hao Y,Cui Y,Fan Z,He S,Luo J,Chen R.LncVar:a database ofgenetic variation associated with long non-coding genes.Bioinformatics.2017,33:112-118.
[0059] [5]Miao YR,Liu W,Zhang Q,Guo AY.lncRNASNP2:an updated database offunctional SNPs and mutations in human and mouse lncRNAs.Nucleic AcidsRes.2018,46:D276-D280.
[0060] [6]Lv W,Peng Y,Hu J,et al.Functional SNPs in SYISL promotersignificantly affect muscle fiber density and muscle traits in pigs.AnimGenet.2024;55(1):66-78。
Claims
1. Use of a SNP molecular marker in improving pork efficiency and growth rate improvement in pigs, characterized in that, The pig is a Large White of American line, a Large White of Danish line and a Large White of French line; the nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, wherein R in the sequence is C or T; the related traits of the meat production efficiency are live backfat thickness, eye muscle area, eye muscle depth and age at 100 kg weight; in the live backfat thickness trait at 100 kg weight, the live backfat thickness of the individual with TT genotype at the SNP site of the Large White of American line, the Large White of Danish line and the Large White of French line is thinner; in the eye muscle area trait at 100 kg weight, the eye muscle area of the individual with TT genotype at the SNP site of the Large White of American line and the Large White of French line is larger; in the eye muscle depth trait at 100 kg weight, the eye muscle depth of the individual with TT genotype at the SNP site of the Large White of Danish line is larger; in the age at 100 kg weight trait, the age at 100 kg weight of the individual with TT genotype at the SNP site of the Large White of French line and the Large White of Danish line is shortened.
2. Use according to claim 1, characterized in that, The sequence of the primer pair for detecting the SNP molecular marker is shown as SEQ ID NO. 2 and SEQ ID NO. 3.
Citation Information
Patent Citations
SNP molecular marker located at chromosome 16 of pig and related to lean meat percentage and eye muscle area of pig and application
CN110117665A
Genetic marker associated with growth and fattening traits of pigs and application
CN113088576A