An alumina nanomaterial, its preparation method and application
By preparing alumina nanomaterials and using their surface charge characteristics at different pH values to achieve efficient enrichment and separation of viruses, the problem of high cost and time-consuming virus enrichment in the prior art is solved, and is suitable for environmental monitoring, food safety detection and disease diagnosis and other fields.
Patent Information
- Application Number
- CN202410820358.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-24
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2044-06-24
AI Technical Summary
The existing virus enrichment technology has the problem of high cost, long time and poor effect, and it is difficult to effectively enrich low-concentration virus particles in the environment.
The polyethylene oxide-polypropylene oxide-polyethylene oxide triblock copolymer and aluminum salt were co-incubated with urea and heated reaction, and then calcined the alumina nanomaterial. The surface charge characteristics of the virus were used to achieve efficient enrichment and separation of viruses at different pH values.
It has achieved a simple and efficient virus enrichment process, with low cost, fast results acquisition speed and wide adaptability, and is suitable for environmental monitoring, food safety testing and disease diagnosis.
Smart Images

Figure CN118833836B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of virus enrichment and detection, and particularly relates to an alumina nanomaterial, a preparation method thereof, and an application thereof. Background Art
[0002] Various viruses existing in the environment pose a great threat to aquatic products, crops, and humans. However, viruses are scarce in the environment and the diameter of virus particles is small, which poses a great challenge to the detection of current viruses in the environment (Talanta, 2022, 242: 122989). Therefore, in current virus detection and diagnosis technologies, virus enrichment is a key step, which directly affects the sensitivity and accuracy of detection. The traditional virus enrichment mainly has the following methods: centrifugal ultrafiltration method, ultracentrifugation method, positively charged membrane method, negatively charged membrane method adsorption and elution method, flocculation precipitation method, etc. However, these enrichment methods have disadvantages such as high enrichment cost, long time consumption, and poor effect (Sci. Total Environ., 2022, 824: 153687). Therefore, it is urgent to develop new virus enrichment technologies to overcome the problem that it is difficult to effectively enrich low-concentration viruses in the environment with existing technologies. Summary of the Invention
[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an alumina nanomaterial, a preparation method thereof, and an application thereof.
[0004] To achieve the above purpose, the technical solution adopted by the present invention is as follows:
[0005] In the first aspect, the present invention provides an alumina nanomaterial, which is prepared by co-incubating a poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) triblock copolymer and an aluminum salt, adding urea and heating for reaction, and then calcining;
[0006] The morphology of the alumina nanomaterial includes at least one of rod-shaped, polyhedron, cube, and sheet-shaped;
[0007] The specific surface area of the alumina nanomaterial is 200m 2 / g -1 -400m 2 / g -1 ; the average pore diameter is 1 nm - 3 nm; preferably, the average pore diameter is any one or the range value of two of 1 nm, 1.5 nm, 2 nm, 2.5 nm, and 3 nm.
[0008] Furthermore, the diameter of the rod-shaped alumina nanomaterial is 5 nm - 1000 nm, preferably 200 nm - 1000 nm; the aspect ratio is 1 - 5, preferably 2.5 - 4;.
[0009] The diameter of the flaky alumina nanomaterial is 150 nm - 200 nm; preferably, the diameter is any one or both of the range values of 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, and 200 nm.
[0010] The nanomaterial of the present invention has a significantly high specific surface area and adjustable surface charge characteristics, and can effectively capture and enrich virus particles through electrostatic interaction. In an acidic, neutral, or weakly alkaline environment with a pH of 3 - 8.0, it exhibits a positive charge, and in an alkaline condition with a pH of 8.5 - 12, it exhibits a negative charge. This property enables the material to specifically interact with negatively charged virus particles in a suitable pH environment to achieve efficient enrichment of the virus; while in an alkaline condition, the material helps in the separation and elution of virus particles.
[0011] As a preferred embodiment of the alumina nanomaterial of the present invention, the concentration of the poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) triblock copolymer is 1 mM - 50 mM; the concentration of the aluminum salt is 100 mM - 800 mM; the concentration of the urea is 1 M - 5 M.
[0012] Preferably, the concentration of the poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) triblock copolymer is 5 mM - 20 mM; the concentration of the aluminum salt is 200 mM - 600 mM; the concentration of the urea is 2 M - 4 M.
[0013] Further, the concentration of the poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) triblock copolymer is any one or both of the range values of 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, 15 mM, 16 mM, 17 mM, 18 mM, 19 mM, and 20 mM.
[0014] The concentration of the aluminum salt is any one or both of the range values of 200 mM, 300 mM, 400 mM, 500 mM, and 600 mM.
[0015] The concentration of the urea is any one or both of the range values of 2 M, 3 M, and 4 M.
[0016] As a preferred embodiment of the alumina nanomaterial of the present invention, the aluminum salt includes at least one of aluminum chloride, aluminum sulfate, aluminum nitrate, aluminum sulfide, and aluminum silicate.
[0017] In a second aspect, the present invention provides a method for preparing the alumina nanomaterial, comprising the following steps:
[0018] (1) Dissolve the poly (ethylene oxide)-poly (propylene oxide)-poly (ethylene oxide) triblock copolymer and the aluminum salt in water, and incubate for 1 h - 48 h (preferably 12 h - 24 h);
[0019] (2) Add the urea, and heat for reaction for 1 h - 72 h (preferably 5 h - 10 h);
[0020] (3) Calcinate for 1 h - 72 h (preferably 2.5 h - 5 h); and it is ready.
[0021] The preparation method of the alumina nanomaterial provided by the present invention is simple, efficient and low-cost, facilitating large-scale production and ensuring the consistency of material properties.
[0022] As a preferred embodiment of the preparation method of the alumina nanomaterial of the present invention, in step (1), the incubation temperature is 20°C - 60°C; in step (2), the heating temperature is 20°C - 200°C (preferably 60°C - 100°C); in step (3), the calcination temperature is 100°C - 800°C (preferably 150°C - 200°C).
[0023] In the third aspect, the present invention provides a virus enrichment material, comprising the alumina nanomaterial described above.
[0024] In the fourth aspect, the present invention provides a virus enrichment method, comprising the following steps:
[0025] (1) Adjust the pH of the water sample to 4 - 8; add the alumina nanomaterial described above for treatment, and centrifuge to collect the precipitate;
[0026] (2) Add an eluent to the precipitate, adjust the pH to 8.5 - 12, and centrifuge to collect the virus; and it is ready.
[0027] The virus enrichment technology based on the alumina nanomaterial of the present invention demonstrates wide adaptability and practicality due to its simplicity of operation, high enrichment ability, low-cost equipment and reagent requirements, as well as fast processing time and rapid result acquisition speed, making it have potential application value in many key fields such as environmental monitoring, food safety detection and disease diagnosis.
[0028] As a preferred embodiment of the virus enrichment method of the present invention, in step (1), the final concentration of the alumina nanomaterial is 1 μg / mL - 800 μg / mL; the treatment time is 1 min - 60 min; the centrifugal force for centrifugation is 1000 g - 12000 g, and the time is 1 min - 10 min;
[0029] As a preferred embodiment of the virus enrichment method of the present invention, in step (2), the elution time is 1 min - 60 min; the centrifugal force for centrifugation is 1000 g - 12000 g, and the time is 1 min - 10 min.
[0030] Preferably, in step (1), the alumina nanomaterial is first dissolved in water or DPBS to prepare an enrichment material with a final concentration of 1 mg / mL - 60 mg / mL, and then the water sample is added. The pH of the water body sample is detected using a pH meter or pH test paper, and the pH of the water sample is adjusted to 4 - 8 using hydrochloric acid and sodium hydroxide.
[0031] Preferably, in step (2), after centrifuging to collect the virus, its nucleic acid is extracted, and quantitative PCR is performed to determine the content. The quantitative PCR uses reverse transcription quantitative PCR or digital PCR.
[0032] The eluent includes one or more of a buffer solution with a changed pH value, a high ionic strength solution with a salt concentration greater than or equal to 1 M, or a solution containing specific chemical components such as EDTA.
[0033] In the fifth aspect, the present invention applies the alumina nanomaterial, the preparation method, the virus enrichment material, and the virus enrichment method in environmental and food virus enrichment.
[0034] As a preferred embodiment of the application of the present invention, the environment includes aquaculture water bodies, livestock and poultry farm sewage, natural water bodies, rural and urban domestic sewage; the natural water bodies include river, lake, and sea water bodies.
[0035] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0036] Due to its porous nanostructure on the surface, the alumina nanomaterial of the present invention has a high specific surface area and can adsorb viruses well. It shows a positive charge under acidic or neutral conditions and a negative charge under alkaline conditions, and has acid-base stability and can be reused. Due to its good biocompatibility, the integrity of the virus can be maintained during the enrichment process. The preparation method of the alumina nanomaterial of the present invention is simple, efficient, and low-cost, facilitating large-scale production and ensuring the consistency of material performance. The virus enrichment method of the present invention features simplicity in operation, high enrichment ability, low-cost equipment and reagent requirements, as well as fast processing time and rapid result acquisition speed, demonstrating broad adaptability and practicality and having high application value in multiple key fields such as environmental monitoring, food safety detection, and disease diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 It is a schematic diagram of enrichment based on alumina nanomaterials;
[0038] Figure 2 It is the electron microscope image of alumina nanomaterials;
[0039] Figure 3 It is the electron microscope image of alumina nanomaterials;
[0040] Figure 4 It is the electron microscope image of alumina nanomaterials;
[0041] Figure 5 It is the enrichment and detection of megalocytivirus based on alumina nanomaterials;
[0042] Figure 6 It is the enrichment and detection of ranavirus based on alumina nanomaterials;
[0043] Figure 7 It is the enrichment and detection of rhabdovirus based on alumina nanomaterials;
[0044] Figure 8 It is the enrichment and detection of ranavirus in the environment based on alumina nanomaterials. Detailed implementation manners
[0045] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0046] Unless otherwise specified, the test methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can all be obtained from commercial channels. The P123 is a triblock copolymer of polyethylene oxide - polypropylene oxide - polyethylene oxide, purchased from Shanghai Macklin Biochemical Co., Ltd.; DPBS (Dulbecco’s Phosphate Buffered Saline), purchased from Wuhan Sevier Biotechnology Co., Ltd.; the nucleic acid extraction kit is FastPure Viral DNA / RNA Mini Kit, purchased from Nanjing Novozymes Biotech Co., Ltd.; the megalocytivirus is infectious spleen and kidney necrosis virus ISKNV, the ranavirus is siniperca chuatsi ranavirus SCRIV, and the rhabdovirus is siniperca chuatsi rhabdovirus SCRV, all of which are isolated, identified and preserved by the inventor team laboratory of Pearl River Fisheries Research Institute, Chinese Academy of Fishery Sciences. For references, see "Establishment of a triple PCR detection method for infectious spleen and kidney necrosis virus, siniperca chuatsi ranavirus and siniperca chuatsi rhabdovirus".
[0047] Example 1: Preparation of nano-alumina materials
[0048] Dissolve P123 with a final concentration of 8 mM and anhydrous aluminum chloride with a final concentration of 500 mM in deionized water, with a total volume of 20 mL. Incubate at 40 °C for 12 h, then add urea with a final concentration of 2 M, and further carry out a heating reaction at 100 °C for 10 h. Finally, calcine at 200 °C for 5 h, and finally collect the sample to prepare alumina nanomaterials.
[0049] Example 2: Preparation of Alumina Nanomaterials
[0050] Dissolve P123 with a final concentration of 8 mM and anhydrous aluminum chloride with a final concentration of 500 mM in deionized water, with a total volume of 20 mL. Incubate at 40 °C for 12 h, then add urea with a final concentration of 2 M, and further carry out a heating reaction at 100 °C for 5 h. Finally, calcine at 200 °C for 5 h, and finally collect the sample to prepare alumina nanomaterials.
[0051] Example 3: Preparation of Alumina Nanomaterials
[0052] Dissolve P123 with a final concentration of 8 mM and anhydrous aluminum chloride with a final concentration of 500 mM in deionized water, with a total volume of 20 mL. Incubate at 40 °C for 12 h, then add urea with a final concentration of 2 M, and further carry out a heating reaction at 100 °C for 5 h. Finally, calcine at 150 °C for 2.5 h, and finally collect the sample to prepare alumina nanomaterials.
[0053] Comparative Example 1: Preparation of Alumina Nanomaterials
[0054] The difference between the comparative example and Example 1 is only that P123 with a final concentration of 0.8 mM is used to prepare alumina nanomaterials.
[0055] Comparative Example 2: Preparation of Alumina Nanomaterials
[0056] The difference between the comparative example and Example 1 is only that P123 with a final concentration of 100 mM is used to prepare alumina nanomaterials.
[0057] Comparative Example 3: Preparation of Alumina Nanomaterials
[0058] The difference between the comparative example and Example 1 is only that an aluminum salt with a final concentration of 50 mM is used to prepare alumina nanomaterials.
[0059] Comparative Example 4: Preparation of Alumina Nanomaterials
[0060] The difference between the comparative example and Example 1 is only that an aluminum salt with a final concentration of 1000 mM is used to prepare alumina nanomaterials.
[0061] Comparative Example 5: Preparation of Alumina Nanomaterials
[0062] The difference between the comparative example and Example 1 is only that an alumina nanomaterial is prepared using a final concentration of 100 mM urea.
[0063] Comparative Example 6: Preparation of Nano-Alumina Material
[0064] The difference between the comparative example and Example 1 is only that an alumina nanomaterial is prepared using a final concentration of 10 M urea.
[0065] Test Example 1: Electron Microscopy Characterization of Alumina Nanomaterials
[0066] The alumina nanomaterials prepared in Examples 1-3 and Comparative Examples 1-6 were characterized, and a small amount of the nanomaterials was observed under an electron microscope to examine the size and morphology of the alumina nanomaterials.
[0067] The electron micrograph of the alumina nanomaterial of Example 1 is as Figure 2 shown. The results showed that a kind of porous alumina nanorods was successfully synthesized, with a length of about 1000 nm, an aspect ratio of about 2.5, and a specific surface area of about 200 m 2 / g -1 , porous, and an average pore diameter of about 2 nm.
[0068] The electron micrograph of the alumina nanomaterial of Example 2 is as Figure 3 shown. The results showed that a kind of porous alumina nanorods was successfully synthesized, with a length of about 200 nm, an aspect ratio of about 4, and a specific surface area of about 300 m 2 / g -1 , porous, and an average pore diameter of about 2 nm.
[0069] The electron micrograph of the alumina nanomaterial of Example 3 is as Figure 4 shown. The results showed that a kind of porous alumina nanosheets was successfully synthesized, with a diameter of about 180 nm and a specific surface area of about 400 m 2 / g -1 , porous, and an average pore diameter of about 2 nm.
[0070] The alumina nanomaterial of Comparative Example 1 was characterized. Since the concentration of P123 was too low, a porous nanomaterial could not be formed.
[0071] The alumina nanomaterial of Comparative Example 2 was characterized. Since the concentration of P123 was too high, a nanomaterial could not be formed.
[0072] The alumina nanomaterial of Comparative Example 3 was characterized. Since the concentration of the aluminum salt was too low, a nanomaterial could not be formed.
[0073] The alumina nanomaterial of Comparative Example 4 was characterized. Since the concentration of the aluminum salt was too high, the reaction product was in a blocky shape and a nanomaterial could not be formed.
[0074] The alumina nanomaterials of Comparative Example 5 were characterized. Since the urea concentration was too low, nanomaterials could not be formed.
[0075] The alumina nanomaterials of Comparative Example 6 were characterized. Since the urea concentration was too high, the reaction product was in a blocky shape and nanomaterials could not be formed.
[0076] Test Example 2: Enrichment and detection of megalocytivirus
[0077] Based on the alumina nanomaterials prepared in Example 1, the enrichment and detection of megalocytivirus were carried out as follows:
[0078] (1) The alumina nanomaterials prepared in Example 1 were respectively dissolved in DPBS to prepare 20 mg / mL alumina nanomaterials; the pH value was 7.2;
[0079] (2) Megalocytivirus was respectively added to the control group (containing only DPBS) and the water body containing alumina nanomaterials. The final concentration of the alumina nanomaterials was 400 μg / mL, and incubation was carried out for 10 min;
[0080] (3) After the incubation was completed, centrifugation was carried out at a centrifugal force of 11000 g for 5 min, and the supernatant was discarded;
[0081] (4) Elution was carried out using 1 M Tris buffer, with a pH value of 9.5; the elution time was 10 min, and finally centrifugation was carried out at 11000 g for 5 min to collect the virus;
[0082] (5) The collected virus was subjected to nucleic acid extraction, and quantitative PCR was carried out (primers: F - CCTTAATTTGCCCATTCCCCTCTTC; R - AGTAGTCTACTCCCATCTGGTGGA G), and the virus copy number was calculated according to the CT value (copy number = 10^CT), and further the virus recovery rate was calculated (recovery rate = (recovered virus copy number / input virus copy number) * 100%).
[0083] The results were as Figure 5 shown. The alumina nanomaterials of Example 1 could well achieve the enrichment of megalocytivirus, and its enrichment efficiency was as high as 91%. Therefore, the porous rod-shaped alumina nanomaterials had a good enrichment effect on megalocytivirus.
[0084] Test Example 3: Enrichment and detection of ranavirus
[0085] Based on the alumina nanomaterials prepared in Example 1, the enrichment and detection of ranavirus were carried out as follows:
[0086] (1) The alumina nanomaterials prepared in Example 1 were separately dissolved in DPBS to prepare 20 mg / mL alumina nanomaterials; the pH value was 7.2;
[0087] (2) Frog iridovirus was added to the control group (containing only DPBS) and the water body containing alumina nanomaterials respectively. The final concentration of alumina nanomaterials was 400 μg / mL, and incubated for 10 min;
[0088] (3) After incubation, centrifuge at 11000g for 5 min, and discard the supernatant;
[0089] (4) Elute with 1M Tris buffer, the pH value was 9.5; the elution time was 10 min, and finally centrifuge at 11000g for 5 min to collect the virus;
[0090] (5) Extract nucleic acid from the collected virus, and perform quantitative PCR (primers F-CATTATCCCGTGGGTTGGTTTAC; R-GGACCCTAGCTCCTGCTTGAC), and calculate the virus copy number according to the CT value (copy number = 10^CT), and further calculate the virus recovery rate (recovery rate = (recovered virus copy number / input virus copy number) * 100%).
[0091] The results are as Figure 6 shown. The alumina nanomaterials of Example 1 can well achieve the enrichment of frog iridovirus, and its enrichment efficiency is as high as 92%. Therefore, the porous rod-shaped alumina nanomaterials have a good enrichment effect on frog iridovirus.
[0092] Test Example 4: Enrichment and detection of rhabdovirus
[0093] Based on the enrichment and detection of rhabdovirus by the alumina nanomaterials prepared in Example 1, the specific steps are as follows:
[0094] (1) The alumina nanomaterials prepared in Example 1 were separately dissolved in DPBS to prepare 20 mg / mL alumina nanomaterials; the pH value was 7.2;
[0095] (2) Rhabdovirus was added to the control group (containing only DPBS) and the water body containing alumina nanomaterials respectively. The final concentration of alumina nanomaterials was 400 μg / mL, and incubated for 10 min;
[0096] (3) After incubation, centrifuge at 11000g for 5 min, and discard the supernatant;
[0097] (4) Elute with 1M Tris buffer, the pH value was 9.5; the elution time was 10 min, and finally centrifuge at 11000g for 5 min to collect the virus;
[0098] (5) Extract nucleic acids from the collected virus and perform quantitative PCR (primers: F-CTGGACATCCTTTGGAATCGAG; R-TTCACCAGCTCTGCAGATGTTC;), and calculate the virus copy number based on the CT value (copy number = 10^CT), and further calculate the virus recovery rate (recovery rate = (recovered virus copy number / input virus copy number) * 100%).
[0099] The results are as Figure 7 shown. The alumina nanomaterial of Example 1 can well achieve the enrichment of rhabdovirus, and its enrichment efficiency is as high as 81%. Therefore, the porous rod-shaped alumina nanomaterial has a good enrichment effect on rhabdovirus.
[0100] Application example: Enrichment and detection of environmental viruses
[0101] Based on the enrichment and detection of rhabdovirus by the alumina nanomaterial prepared in Example 1, the specific steps are as follows:
[0102] (1) Dissolve the alumina nanomaterial prepared in Example 1 in DPBS respectively to prepare 20 mg / mL alumina nanomaterial; the pH value is 7.2;
[0103] (2) Collect the water samples in a certain fish pond and divide them into two parts A and B. Add the alumina nanomaterial to water body B, and the final concentration of the alumina nanomaterial is 400 μg / mL, and incubate for 10 min;
[0104] (3) After incubation, centrifuge at 11000 g for 5 min and discard the supernatant;
[0105] (4) Use 1 mL of 1 M Tris buffer for elution, the pH value is 9.5; the elution time is 10 min, and finally centrifuge at 11000 g for 5 min to collect the virus;
[0106] (5) Extract nucleic acids from the water samples in A and the above-enriched water samples, and perform quantitative PCR (primers: F-CTGGACATCCTTTGGAATCGAG; R-TTCACCAGCTCTGCAGATGTTC), and calculate the virus copy number based on the CT value (copy number = 10^CT).
[0107] The results are as Figure 8 shown. The virus copy number without enrichment is 4.2 * 10^3, and the virus copy number enriched by the alumina nanomaterial is 5.01 * 10^5. The alumina nanomaterial of Example 1 can well achieve the enrichment of rhabdovirus in the environment. Therefore, the porous rod-shaped alumina nanomaterial has a good enrichment effect on rhabdovirus and can be applied to the enrichment of viruses in the actual environment.
[0108] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.
Claims
1. A method for preparing an alumina nanomaterial, characterized in that, It includes the following steps: (1) Dissolve the poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) triblock copolymer and the aluminum salt in water, and incubate at 20°C - 60°C for 1 h - 48 h; The concentration of the poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) triblock copolymer is 1 mM - 50 mM; the concentration of the aluminum salt is 100 mM - 800 mM; (2) Add urea and heat for reaction for 1 h - 72 h; the heating temperature is 20°C - 200°C; The concentration of the urea is 1 M - 5 M; (3) Calcinate at 100°C - 800°C for 1 h - 72 h; then it is ready.
2. The preparation method of the alumina nanomaterial according to claim 1, characterized in that The aluminum salt includes at least one of aluminum chloride, aluminum sulfate, aluminum nitrate, aluminum sulfide, and aluminum silicate.
3. An alumina nanomaterial, characterized in that, It is prepared by the preparation method described in claim 1 or 2.
4. A virus enrichment material, characterized in that, It includes the alumina nanomaterial described in claim 3.
5. A virus enrichment method, characterized in that, It includes the following steps: (1) Adjust the pH of the water sample to 4 - 8; add the alumina nanomaterial described in claim 3 for treatment, and centrifuge to collect the precipitate; (2) Add the eluent to the precipitate, adjust the pH to 8.5 - 12, and centrifuge to collect the virus; then it is ready.
6. The virus enrichment method according to claim 5, wherein In step (1), the final concentration of the alumina nanomaterial is 1 μg / mL - 800 μg / mL; the treatment time is 1 min - 60 min; the centrifugal force for centrifugation is 1000 g - 12000 g, and the time is 1 min - 10 min; in step (2), the elution time is 1 min - 60 min; the centrifugal force for centrifugation is 1000 g - 12000 g, and the time is 1 min - 10 min.
7. Application of the alumina nanomaterial described in claim 3, or the preparation method described in claim 1 or 2, or the virus enrichment material described in claim 4, or the virus enrichment method described in claim 5 or 6 in environmental and food virus enrichment.
8. The application according to claim 7, characterized in that The environment includes aquaculture water bodies, livestock and poultry farm sewage, natural water bodies, rural and urban domestic sewage.
Citation Information
Patent Citations
Preparation method of nano powder pigment
CN104559337A
Graded porous nano aluminum oxide with adjustable morphology as well as preparation method and application of graded porous nano aluminum oxide
CN114735735A
Kit and method for detecting live norovirus in seawater
CN116987825A