A DNA methylation marker for nasopharyngeal carcinoma screening and its application

Abstract

The present invention provides a DNA methylation marker for nasopharyngeal carcinoma screening and its application. The DNA methylation marker is a combination of all methylation sites in the promoter region of the AMIGO2 gene. The present invention found that the methylation level of the marker in nasopharyngeal carcinoma patients was significantly higher than that in healthy controls, and the ROC curve analysis results showed that it has high accuracy when used for nasopharyngeal carcinoma diagnosis and can achieve specific detection of nasopharyngeal carcinoma. The detection sample of the marker of the present invention can be DNA extracted from a nasopharyngeal swab. It is a non-invasive screening method, and the sample is easier to obtain. The subject can collect it by himself. The detection method is simple and can be applied on a large scale.

Description

Technical Field

[0001] The present invention belongs to the technical field of medical diagnosis, and in particular relates to a DNA methylation marker for nasopharyngeal carcinoma screening and an application thereof. Background Art

[0002] With advances in combined radiotherapy and chemotherapy, the prognosis for early-stage NPC has greatly improved, with a five-year survival rate exceeding 95%. However, due to factors such as hidden disease sites, subtle early clinical symptoms, and a lack of regular participation in early NPC screening, the early diagnosis rate for NPC is less than 30%. Over 70% of newly diagnosed NPC cases each year are in the advanced stages, with a five-year survival rate of only approximately 60%. Furthermore, treatment is becoming increasingly difficult, with significant side effects and overall poor efficacy. Therefore, early detection and treatment are key to improving the prognosis for NPC patients. Using sensitive and accurate screening methods to target high-risk individuals for NPC can significantly enhance the effectiveness of NPC screening, improving early diagnosis rates, cure rates, and quality of life for patients.

[0003] Currently, nasopharyngeal carcinoma screening programs are mainly divided into blood EBV antibody programs and nucleic acid programs, but the screening sensitivity, specificity and positive predictive value of these programs are insufficient to varying degrees. Summary of the Invention

[0004] Based on this, the purpose of the present invention is to provide a DNA methylation marker for screening nasopharyngeal carcinoma and its application, wherein the DNA methylation marker has high diagnostic accuracy for nasopharyngeal carcinoma.

[0005] To achieve the above objectives, the present invention adopts the following technical solutions.

[0006] In a first aspect of the present invention, a combination of all methylation sites in the AMIGO2 gene promoter region is provided for use as a biomarker in the preparation of a nasopharyngeal carcinoma detection reagent. The combination of all methylation sites in the AMIGO2 gene promoter region refers to all methylation sites in the AMIGO2 gene promoter region as shown in SEQ ID NO: 3.

[0007] The second aspect of the present invention provides the use of a reagent for detecting the methylation level of the AMIGO2 gene promoter region in the preparation of a nasopharyngeal carcinoma detection product.

[0008] In some embodiments, the nucleotide sequence of the AMIGO2 promoter region is shown in SEQ ID NO: 3.

[0009] In some embodiments, the reagents are used for detection by qPCR, sequencing, and sulfite technology.

[0010] In some embodiments, the reagents include an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2.

[0011] In some embodiments, the detection procedure for detection using the reagent is: 1) pre-denaturation at [94-98]°C for 5 minutes; 2) denaturation at [94-98]°C for [15-30]s, annealing at 60°C for [15-30]s, and extension at 72°C for [15-30]s; and repeating step 2) for 40 cycles.

[0012] In some embodiments, the detection product is a detection kit.

[0013] In a third aspect, the present invention provides a nasopharyngeal carcinoma detection kit, comprising a reagent for detecting the methylation level of the AMIGO2 gene promoter region, wherein the nucleotide sequence of the AMIGO2 promoter region is shown in SEQ ID NO: 3.

[0014] In some embodiments, the reagents include an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO: 2.

[0015] In some embodiments, the kit further comprises Hpych4IV enzyme and AciI enzyme.

[0016] The present invention has screened and obtained a nasopharyngeal carcinoma-specific detection marker, which is a combination of all methylation sites in the AMIGO2 gene promoter region. The methylation level of this marker in nasopharyngeal carcinoma patients is significantly higher than that in healthy controls. Receiver-operating characteristic (ROC) curve analysis shows that, when used for nasopharyngeal carcinoma diagnosis, the overall methylation level cutoff value of 0.2 is set, and the training set AUC is as high as 0.919, with a sensitivity of 85.4% and a specificity of 95.8%. The validation set AUC is as high as 0.925, with a sensitivity of 90.6% and a specificity of 95.9%, indicating high accuracy. Therefore, a reagent for detecting the methylation level of the AMIGO2 gene promoter region can be used for the specific detection of nasopharyngeal carcinoma.

[0017] The detection sample of the marker described in the present invention can be DNA extracted from a nasopharyngeal swab. It is a non-invasive screening, and the sample is easier to obtain. The subject can collect it by himself, and the detection method is simple, which can be applied on a large scale.

[0018] Figure 1 The methylation levels of the AMIGO2 promoter region in the healthy control group and nasopharyngeal carcinoma patient group are the training set.

[0019] Figure 2The methylation levels of the AMIGO2 promoter region in the healthy control group and nasopharyngeal carcinoma patient group were used as validation sets.

[0020] Figure 3 ROC curve analysis results for the training set and validation set. DETAILED DESCRIPTION

[0021] To facilitate understanding of the present invention, the present invention will be described more fully below with reference to the examples, and preferred embodiments of the present invention are provided below. However, the present invention can be implemented in many different forms and is not limited to the examples described herein. The purpose of providing these examples is to provide a more thorough and comprehensive understanding of the disclosure of the present invention. It should be understood that the experimental methods in the following examples, for which specific conditions are not specified, are generally based on conventional conditions or the conditions recommended by the manufacturer. The various commonly used reagents used in the examples are all commercially available products.

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention pertains. The terms used in this specification are for the purpose of describing specific embodiments only and are not intended to limit the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0023] In the present invention, the methylation level of the AMIGO2 promoter region refers to the overall methylation level of all methylation sites in the AMIGO2 promoter region. The nucleotide sequence of the AMIGO2 promoter detection region and all methylation sites are shown in SEQ ID NO: 3:

[0024] SEQ ID NO: 3:

[0025] 5'-GTTACTTCCTCCCAGCAGATATCCCTGTGGAGAGGAAA CG TTCCCG ACTTCCCTCCC CG CGACCTCCTCCCTAGAAACGAG CG GAGA CG TCAGGCTGCTTCTGGGTTTATTTTGTAAACCCAGACAGTCAACTGCACTTG-3'.

[0026] Example 1

[0027] Nasopharyngeal brush samples were collected from NPC patients and the methylation level of AMIGO2 promoter region was detected.

[0028] Inclusion criteria for healthy controls: aged between 30 and 69 years, with no history of malignant tumors, and living in Guangdong Province for at least 6 months before recruitment.

[0029] Inclusion criteria for NPC: patients aged 30 to 69 years, no history of NPC treatment, and living in Guangdong Province for at least 6 months before NPC diagnosis and recruitment.

[0030] According to the above criteria, a total of 48 healthy controls and 48 NPC patients were included as a training set. There was no statistical difference in age and gender between the healthy controls and NPC patients in the training set. After sample collection, the methylation level of the AMIGO2 promoter region was tested for each sample using the following method:

[0031] 1. Nasopharyngeal brush collection

[0032] ① Ask the person being sampled to tilt his head back and check for any nasal mucosal adhesion or bleeding.

[0033] ② During the procedure, hold the swab perpendicular to the subject's face when viewed from the side. Slowly insert the swab tip from the inferior nasal passage into the posterior wall of the subject's nasopharynx, gently rotating it once to collect mucosal cells. Collect a swab from the opposite nasopharynx in the same manner.

[0034] ③ During the operation, if the person being collected shows obvious discomfort, or encounters resistance during insertion, do not forcefully insert the swab. Slowly withdraw the swab, adjust the angle, and then slowly insert it again.

[0035] ④ Insert the collected swab head vertically into the specimen collection tube to avoid contamination, break it along the crease, cover the specimen tube tightly, and make sure there is no leakage of the preservation solution.

[0036] Nasopharyngeal brush sample collection tube: 1mL GTC Lysis Buffer preservation solution.

[0037] 2. DNA Extraction from Nasopharyngeal Brush

[0038] DNA was extracted using the Omega DNA / RNA / protein co-extraction kit (R6734-02) as follows:

[0039] ① Move the nasopharyngeal brush sample to the HiBind TM In the DNA Column, centrifuge at 13000 rpm for 1 minute;

[0040] ② HiBind TM Insert the DNA separation column into a new 2 ml collection tube;

[0041] ③ To HiBind TMAdd 500 μl of HB Buffer to the DNA separation column, centrifuge at 13,000 rpm for 1 minute, and discard the liquid in the collection tube;

[0042] ④ To HiBind TM Add 500 μl DNA Wash Buffer to the DNA separation column, centrifuge at 13,000 rpm for 1 minute, and discard the liquid in the collection tube;

[0043] ⑤ Empty HiBind TM DNA separation column, centrifuged at 13000 rpm for 2 minutes;

[0044] ⑥HiBind TM Place the DNA separation column in a new 1.5ml EP tube and add TM Add 100 μl of Elution Buffer to the center of the DNA separation column. Incubate at room temperature for 3 minutes, then centrifuge at 13,000 rpm for 2 minutes. Aliquot the extracted DNA and store at -80°C.

[0045] 3. Enzyme Digestion of Nasopharyngeal Brush DNA Samples

[0046] ① Use nanodrop to measure the DNA concentration of nasopharyngeal brushes;

[0047] ② Take 200ng of nasopharyngeal brush DNA sample for enzyme digestion. The enzyme digestion system is as follows:

[0048]

[0049] Incubate at 37°C for 2 hours; then add enzyme-free water to 200ul to obtain the methylated DNA sample.

[0050] In addition, 200 ng of nasopharyngeal brush DNA was taken and added with enzyme-free water to 200 ul as the control DNA sample.

[0051] 4. qPCR identification of AMIGO2 promoter region methylation level

[0052] Using Roche Real-time RT-PCR was performed using 480 SYBR Green I Master. The 10 μl reaction system was as follows:

[0053] 480SYBR Green I Master 5ul

[0054] 1ul of a mixture of 2.5μM upstream and downstream primers

[0055] Nasopharyngeal brush DNA 4ul

[0056] Amplification procedure: 1) Pre-denaturation at 95°C for 5 minutes; 2) Denaturation at 95°C for 15 seconds, annealing at 60°C for 15 seconds, and extension at 15 seconds. Repeat step 2) for 40 cycles. Melting curve procedure: 95°C for 15 seconds, 60°C for 15 seconds, and 95°C for 15 seconds. Melting curve analysis is used to assess the specificity of the amplified product.

[0057] The primer sequences are:

[0058] Upstream primer (SEQ ID NO: 1): 5′-GTTACTTCCTCCCAGCAGAT-3′;

[0059] Downstream primer (SEQ ID NO: 2): 5'-CAAGTGCAGTTGACTGTCTG-3'.

[0060] Each person's sample was divided into two parts, one for enzyme digestion (enzyme digestion targets methylated sites) and then tested, and the other was tested directly without enzyme digestion. The methylation level of the AMIGO2 promoter region of the person was calculated based on the Ct values ​​of the two samples from the same person. The methylation level of the AMIGO2 promoter region was calculated using the ΔCt value method, ΔCt = the average of [Ct value of methylated DNA sample] - [Ct value of control DNA sample], where the Ct value of the methylated DNA sample refers to the Ct value of the sample after enzyme digestion, and the Ct value of the control DNA sample refers to the Ct value of the sample without enzyme digestion from the same person. The methylation level of the AMIGO2 promoter region = 2 -△Ct The t-test analysis was performed based on the methylation level of the AMIGO2 promoter region.

[0061] The detection results of the training set are shown in Table 1:

[0062] Table 1

[0063]

[0064]

[0065]

[0066] The statistical results are as follows Figure 1 As shown in Table 1 and Figure 1 It can be seen that compared with the healthy controls, the methylation level of the AMIGO2 promoter region in the nasopharyngeal carcinoma patient group was significantly increased, and the difference was statistically significant, suggesting that the combination of all methylation sites in the AMIGO2 promoter region can be used as a detection marker for nasopharyngeal carcinoma.

[0067] The ROC curve was further used to analyze the efficacy of AMIGO2 promoter region methylation sites in diagnosing nasopharyngeal carcinoma patients. Figure 3As shown, the AUC was as high as 0.919, the sensitivity was 85.4%, and the specificity was 95.8%, with high accuracy. Therefore, the combination of all methylation sites in the AMIGO2 promoter region can be used as a specific detection marker for nasopharyngeal carcinoma and for the diagnosis of nasopharyngeal carcinoma.

[0068] To effectively distinguish NPC patients from healthy controls, the global methylation level cutoff value can be set at 0.2.

[0069] Example 2

[0070] This example verifies the diagnostic efficacy of the methylation site in the AMIGO2 promoter region as a specific detection marker for nasopharyngeal carcinoma.

[0071] According to the inclusion criteria of Example 1, a total of 32 healthy controls and 32 nasopharyngeal carcinoma patients were included as a validation set. There was no statistical difference in age and gender between the healthy controls and nasopharyngeal carcinoma patients in the validation set.

[0072] For the validation set specimens, the same method as in Example 1 was adopted to collect samples and detect the methylation level of the AMIGO2 promoter region, setting 0.2 as the overall methylation level cutoff value to verify the diagnostic efficacy of the methylation level of the AMIGO2 promoter region for nasopharyngeal carcinoma.

[0073] The test results of the validation set are shown in Table 2:

[0074] Table 2

[0075]

[0076]

[0077]

[0078] The statistical results are as follows Figure 2 As shown in Table 2 and Figure 2 It can be seen that compared with the healthy controls, the methylation level of the AMIGO2 promoter region in the nasopharyngeal carcinoma patient group was significantly increased, and the difference was statistically significant, suggesting that in the validation set, the combination of all methylation sites in the AMIGO2 promoter region can be used as a detection marker for nasopharyngeal carcinoma. The ROC curve was further used to analyze the efficacy of the combination of all methylation sites in the AMIGO2 promoter region in diagnosing nasopharyngeal carcinoma patients. The results are as follows Figure 3 As shown in the figure, the AUC was as high as 0.925, the sensitivity was 90.6%, and the specificity was 95.9%, with high accuracy.

[0079] The technical features of the above-described embodiments can be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0080] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention shall be determined by the appended claims.

Claims

1. Use of a reagent combination for detecting the methylation level of all methylation sites in the promoter region of the AMIGO2 gene in the preparation of a nasopharyngeal carcinoma detection kit, characterized in that: The nucleotide sequence of the AMIGO2 gene promoter region is shown in SEQ ID NO: 3; the reagent combination includes primers for specifically amplifying the nucleotide sequence of the fragment shown in SEQ ID NO: 3, Hpych4IV enzyme and AciI enzyme; The detection steps of the kit include: extracting DNA samples; performing enzyme digestion treatment on the DNA samples using Hpych4IV enzyme and AciI enzyme; and qPCR identification.

2. The use according to claim 1, characterized in that The primers include an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 1 and a downstream primer as shown in SEQ ID NO:

2.

3. The use according to claim 2, characterized in that The qPCR identification procedure is as follows: 1) pre-denaturation at 94-98°C for 5 minutes; 2) denaturation at 94-98°C for 15-30 seconds, annealing at 60°C for 15-30 seconds, and extension at 72°C for 15-30 seconds; and step 2) is repeated for 40 cycles.

Images