A set of SNP molecular markers associated with rapid growth of Procambarus clarkii and their application

Abstract

The present invention provides a set of SNP molecular markers associated with rapid growth of Procambarus clarkii and their applications, belonging to the technical field of genetic breeding of Procambarus clarkii. The SNP molecular markers include first to eleven SNP molecular markers, the nucleotide sequences of which are shown as SEQ ID NO. 1 to SEQ ID NO. 10. By using SNP molecular markers or primers to detect breeding populations and select individuals with advantageous genotypes, the efficiency of selective breeding of Procambarus clarkii can be improved and the breeding cycle can be shortened.

Description

Technical Field

[0001] The invention relates to the technical field of Procambarus clarkii breeding, and in particular to a group of SNP molecular markers associated with rapid growth of Procambarus clarkii and applications thereof. Background Art

[0002] Procambarus clarkii, commonly known as crayfish, is an omnivorous freshwater shrimp. Natural seed or self-propagation (broodstock culture) from stocked ponds still accounts for a large proportion of the supply of Procambarus clarkii seed. The shortage of high-quality seed is a prominent issue, and standardized and large-scale seed production remains a challenge.

[0003] Currently, the most commonly used techniques in Procambarus clarkii breeding are traditional group selection and family selection. Traditional aquaculture breeding methods have many advantages, such as simplicity and ease of implementation, but they also have drawbacks such as low efficiency in selecting target traits and long breeding cycles. Summary of the Invention

[0004] The purpose of the present invention is to provide a group of SNP molecular markers associated with the rapid growth of Procambarus clarkii and their applications. The SNP molecular markers are significantly associated with the rapid growth trait of Procambarus clarkii. By using the SNP molecular markers to assist in the selection of breeding populations, the breeding efficiency of Procambarus clarkii can be improved and the breeding cycle can be shortened.

[0005] In order to achieve the above object, the technical solution provided by the present invention is as follows:

[0006] The present invention provides a group of SNP molecular markers associated with the rapid growth of Procambarus clarkii, including a first SNP molecular marker, a second SNP molecular marker, a third SNP molecular marker, a fourth SNP molecular marker, a fifth SNP molecular marker, a sixth SNP molecular marker, a seventh SNP molecular marker, an eighth SNP molecular marker, a ninth SNP molecular marker, a tenth SNP molecular marker and an eleventh SNP molecular marker.

[0007] The nucleotide sequence of the first SNP molecular marker is shown in SEQ ID NO. 1, the SNP site is located at position 165 of the sequence, and its base is C / A.

[0008] The nucleotide sequence of the second SNP molecular marker is shown in SEQ ID NO. 2. The SNP site is located at position 152 of the sequence, and its base is G / A.

[0009] The nucleotide sequence of the third SNP molecular marker is shown in SEQ ID NO. 3. The SNP site is located at position 163 of the sequence, and its base is C / T.

[0010] The nucleotide sequence of the fourth SNP molecular marker is shown in SEQ ID NO. 4. The SNP site is located at position 202 of the sequence, and its base is A / G.

[0011] The nucleotide sequence of the fifth SNP molecular marker is shown in SEQ ID NO. 5. The SNP site is located at position 159 of the sequence, and its base is C / T.

[0012] The nucleotide sequence of the sixth SNP molecular marker is shown in SEQ ID NO. 6. The SNP site is located at position 161 of the sequence, and its base is T / C.

[0013] The nucleotide sequence of the seventh SNP molecular marker is shown in SEQ ID NO. 7. The SNP site is located at position 157 of the sequence, and its base is T / G.

[0014] The nucleotide sequence of the eighth SNP molecular marker is shown in SEQ ID NO. 7. The SNP site is located at position 174 of the sequence, and its base is A / G.

[0015] The nucleotide sequence of the ninth SNP molecular marker is shown in SEQ ID NO. 8. The SNP site is located at position 160 of the sequence, and its base is A / G.

[0016] The nucleotide sequence of the tenth SNP molecular marker is shown in SEQ ID NO. 9. The SNP site is located at position 161 of the sequence, and its base is G / A.

[0017] The nucleotide sequence of the eleventh SNP molecular marker is shown in SEQ ID NO. 10. The SNP site is located at position 160 of the sequence, and its base is C / A.

[0018] Furthermore, the sequences of the primers for the first SNP molecular marker are shown as SEQ ID NO.11 and SEQ ID NO.12;

[0019] The sequences of the primers for the second SNP molecular marker are shown in SEQ ID NO.13 and SEQ ID NO.14;

[0020] The sequences of the primers for the third SNP molecular marker are shown in SEQ ID NO.15 and SEQ ID NO.16;

[0021] The sequences of the primers for the fourth SNP molecular marker are shown in SEQ ID NO.17 and SEQ ID NO.18;

[0022] The sequences of the primers for the fifth SNP molecular marker are shown in SEQ ID NO.19 and SEQ ID NO.20;

[0023] The sequences of the primers for the sixth SNP molecular marker are shown in SEQ ID NO.21 and SEQ ID NO.22;

[0024] The sequences of the primers for the seventh SNP molecular marker are shown in SEQ ID NO.23 and SEQ ID NO.24;

[0025] The sequences of the primers for the eighth SNP molecular marker are shown in SEQ ID NO.25 and SEQ ID NO.26;

[0026] The sequences of the primers for the ninth SNP molecular marker are shown in SEQ ID NO.27 and SEQ ID NO.28;

[0027] The sequences of the primers for the tenth SNP molecular marker are shown in SEQ ID NO.29 and SEQ ID NO.30;

[0028] The sequences of the primers for the eleventh SNP molecular marker are shown in SEQ ID NO.31 and SEQ ID NO.32.

[0029] The application of the above primers in the selection of fast-growing varieties of Procambarus clarkii to screen individuals with advantageous genotypes as breeding materials for Procambarus clarkii breeding materials is as follows:

[0030] The present invention also provides the use of the above-mentioned SNP molecular marker in improving the genetic breeding efficiency of Procambarus clarkii.

[0031] Application methods include:

[0032] Method 1: Based on the primers of the first SNP molecular marker, amplify the fragment containing the above-mentioned first SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with the AA genotype as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0033] Method 2: Based on the primers of the second SNP molecular marker, amplify the fragment containing the above-mentioned second SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with the AA genotype as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0034] Method 3: Based on the primers of the third SNP molecular marker, the fragment containing the above-mentioned third SNP site was amplified, and the genotype of the SNP site was typed by direct sequencing. According to the genotype of the tested individual, it was determined whether the tested individual had the potential for rapid growth, that is, individuals with the CC genotype were screened as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0035] Method 4: Based on the primers of the fourth SNP molecular marker, amplify the fragment containing the above-mentioned fourth SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with the AA genotype as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0036] Method 5: Based on the primers of the fifth SNP molecular marker, amplify the fragment containing the above-mentioned fifth SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with the genotype of TT as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0037] Method 6: Based on the primers of the sixth SNP molecular marker, amplify the fragment containing the sixth SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with the CC genotype as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0038] Method 7: Based on the primers of the seventh SNP molecular marker, amplify the fragment containing the seventh SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with the GG genotype as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0039] Method 8: Based on the primers of the eighth SNP molecular marker, amplify the fragment containing the eighth SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth according to the genotype of the tested individual, that is, screen individuals with the GG genotype as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0040] Method 9: Based on the primers of the ninth SNP molecular marker, amplify the fragment containing the ninth SNP site, type the genotype of the SNP site by direct sequencing, and determine whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screen individuals with a genotype of GG as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0041] Method 10: Based on the primers of the tenth SNP molecular marker, a fragment containing the tenth SNP site was amplified, and the genotype of the SNP site was typed by direct sequencing. According to the genotype of the tested individual, it was determined whether the tested individual had the potential for rapid growth, that is, individuals with the AA genotype were screened as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0042] Method 11. Based on primers for the eleventh SNP molecular marker, a fragment containing the eleventh SNP site was amplified, and the genotype of the SNP site was typed by direct sequencing. According to the genotype of the tested individual, it was determined whether the tested individual had the potential for rapid growth, that is, individuals with the AA genotype were screened as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0043] In practical applications, the above application methods can be combined, and individuals that meet the screening criteria of at least one of the above application methods can be used as breeding materials to improve the genetic breeding efficiency of Procambarus clarkii.

[0044] The beneficial effects of the present invention are:

[0045] Based on the breeding population of Procambarus clarkii, the present invention conducted a whole-genome association analysis (GWAS analysis) for the fast growth trait, screened and obtained 11 SNP molecular markers that were significantly associated with the harvest weight trait, and developed and designed relevant detection primers for these SNPs, which has important guiding significance for the selection of new Procambarus clarkii varieties with fast growth traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 is the chromosome distribution map of the SNP sites provided in the examples of this application;

[0047] Figure 2 This is a scatter plot of individual weights of Procambarus clarkii provided in the examples of the present application;

[0048] Figure 3 : is a box plot of individual body weight of Procambarus clarkii provided in the examples of the present application;

[0049] Figure 4 The figure is a histogram of individual weights of Procambarus clarkii and a probability density curve provided in the embodiments of the present application;

[0050] Figure 5 The weight distribution function curve of individual Procambarus clarkii provided in the examples of the present application is shown;

[0051] Figure 6 This is a Manhattan plot of the weight trait of Procambarus clarkii based on GLM provided in the examples of the present application. DETAILED DESCRIPTION

[0052] To make the objectives, technical solutions, and advantages of the present invention more apparent, the present invention will be further described in detail below with reference to the accompanying drawings. It is apparent that the embodiments described are only some, not all, of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are intended to fall within the scope of protection of the present invention.

[0053] The terms used in the embodiments of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The singular forms "a," "an," "the," and "the" used in the embodiments of the present invention and the appended claims are also intended to include plural forms, and unless the context clearly indicates otherwise, "a plurality" generally includes at least two.

[0054] Example 1: This example describes a group of SNP molecular markers associated with rapid growth of Procambarus clarkii, including a first SNP molecular marker, a second SNP molecular marker, a third SNP molecular marker, a fourth SNP molecular marker, a fifth SNP molecular marker, a sixth SNP molecular marker, a seventh SNP molecular marker, an eighth SNP molecular marker, a ninth SNP molecular marker, a tenth SNP molecular marker, and an eleventh SNP molecular marker;

[0055] It can be understood that SNP, or Single Nucleotide Polymorphism (SNP), mainly refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level;

[0056] The nucleotide sequence of the first SNP molecular marker is shown in SEQ ID NO. 1. The SNP site is located at position 165 of the sequence, and its base is C / A.

[0057] SEQ ID NO.1:

[0058] CATATTTAATCAATCAGCCAATATGATTAATCCTATCAGTACACTGTAATGCTATAGTAAGTCCACCAGTAGGAACCTCTGGTGGGCCAATAGGAACTACGGTACCTACAGTACAGCAGTAAGGACAAAATATATTATAA CAACAGAATAATAGAACTGCTCCCAGAATTGGCAGAAATAAAATTGAAAAAATTACCAGTGAGAGGATGAATAATTTTTCTGAGGGTGGCCACACGAGGAGATGGGAGCGTCGCCGGCTCTGTCATGCGCGAGAAGACGT

[0059] The nucleotide sequence of the second SNP molecular marker is shown in SEQ ID NO. 2. The SNP site is located at position 152 of the sequence, and its base is G / A.

[0060] SEQ ID NO.2:

[0061] TCTTTTAATTCTGGTCTGACGTTTGAATGCATTTCGTAATGATTATTACATTTTCAAAAGATTAGGTTTACACACAAAATACATTATACTTATACTCGCTTTGGGTGAGGTGACAGAGATAAGACAGAATATGAAGGTAT AAATTGGATAAGAAAATATAAGAATAGAAGTAACTGCAGAAGGCCTATTGGCCCATACATGCTCTTGCTGCTTCTATGTTGGTTCGGGATCTTGAAGTGGGTAGACTATAAGTAGTAGCGATGAAGCCATATGGGAACTT

[0062] The nucleotide sequence of the third SNP molecular marker is shown in SEQ ID NO. 3. The SNP site is located at position 163 of the sequence, and its base is C / T.

[0063] SEQ ID NO.3:

[0064] TAAAACGAGTGAACGAATGAAATGCGCTAAGAAGGGAAATGCTGGAGGCAGACTCCCTACACACCATGAAGTGTAGATATGACAAAAGAGCCCAATAGGCTCTGTGGAATCTGTACTCCAGTTGATTAAAAGTTAAAAG GCGAGACGGAAGAACCGTGATTCATTCCCACAAATACTAACATGTGAGTACAGCTAGGTCAGAACTCTTCCGGCGGGGGGTGGGGGGTGGGGGGAAGGTGTATAACAGTGGGAGATGCCATTCTTCCAGCGGGGGAG

[0065] The nucleotide sequence of the fourth SNP molecular marker is shown in SEQ ID NO. 4. The SNP site is located at position 202 of the sequence, and its base is A / G;

[0066] SEQ ID NO.4:

[0067] AACCTTATGAAGCAAAAATCCAAAATGGAAAAGTTTCGAGGTTTGCAATCGGATTAGTGACAGATCTAAGAGGATTAACCTACGATTAAGATAGGTAAATGTAAATCAATCTTACAACCGAACAAGTAAAGAAAGGGGAT ATGAGCACAACGTACAATACAAGAACAGCCACATTAAAGTGAGAGACACTAAGACACGAACGCAAAGATCGAAGCTAGAAACGTCAGTGAGTCGAAGATATGTAAGGAAATACCCGTCCCCAGTACTGGAGGTTAACAAG

[0068] The nucleotide sequence of the fifth SNP molecular marker is shown in SEQ ID NO. 5. The SNP site is located at position 159 of the sequence, and its base is C / T.

[0069] SEQ ID NO.5:

[0070] TAAGCTAGTGTGGAGGACTGAAGCAGGACTGAGAGTCGTGCTTCAATGCCCCCTAACTGTTGTGTAACATTGTATGTGGCAACTGTGCTATAGAAGGGTCTTCGTGGCCTGGAGCTGATCTTGCGCAGTCCCAAGCTGCTTTGTGTATTATAGAATTGTCGATAGAGGGCGCCTT ATGGTACTCACCTGGTTGTGCTTGCGGGGGTTGAGCTCTTTGGTCCAACCTCTCAAATGTCAGTCAACTGGTGAAACAGTGTTACTGCAGGAGAGTACAGTATGAGAAGTCAGGATTGCGCTAGTCCCCTCAGTATCACGGTGACCCCATACCTGATAGCAACATACACCACCTA

[0071] The nucleotide sequence of the sixth SNP molecular marker is shown in SEQ ID NO. 6. The SNP site is located at position 161 of the sequence, and its base is T / C.

[0072] SEQ ID NO.6:

[0073] GAAGGACTTGATCCCTTCATCCGCGATCTCCCCAGCCCGGAAGAGTACGAAGCCTCGGTCATGGCTCAGCCCTGGTGGTGGGGGAGAGAGAGAGAGTGGTTAATATACCTCCTTCCTGTAGTTCGGTCAATTCGTACACCAGACCAGATGACAAAGTTCTCTTGCTAAAAT TACGTCTATTGTTAGGTAATAATGATCTGCTTTTTCTGAATTATGTCTACTATATAAACAAATCCACTAGGAGGATTCGAACCTACGTCCGAGAGCATCCCAGACGCTGCCTTAATCGACTGAGCTACGACATGGTCAAAAGAGTTGTAACCAGAAGTTGTACCTACCTTGCTTG

[0074] The nucleotide sequence of the seventh SNP molecular marker is shown in SEQ ID NO. 7. The SNP site is located at position 157 of the sequence, and its base is T / G.

[0075] The nucleotide sequence of the eighth SNP molecular marker is shown in SEQ ID NO. 7. The SNP site is located at position 174 of the sequence, and its base is A / G.

[0076] SEQ ID NO.7:

[0077] GGTTAGTGAATGAGTGAAAGAAAGTGCGTCTGGCGTACCTGCGCTCGCTGGTCGATGAGATCGCTGCGGCCCGTCTCTGCGAAGGACTTGATCCCTTCATCCGCGATCTCCCCAGCCCGGAAGAGTACGAAGCCTCGGTCATGGCTCAGCCCTGGTGGTGGGGGAGAGAGAGAGA GAGAGTGGTTAATATACCTCCTTCCTGTAGTTCGGTCAATTCGTACACCAGACCAGATGACAAAGTTCTCTTGCTAAAATTACGTCTATTGTTAGGTAATAATGATCTGCTTTTTCTGAATTATGTCTACTATATAAACAAATCCACTAGGAGGATTCGAACCTACGTCCGAGAG

[0078] The nucleotide sequence of the ninth SNP molecular marker is shown in SEQ ID NO. 8. The SNP site is located at position 160 of the sequence, and its base is A / G.

[0079] SEQ ID NO.8:

[0080] ACCACTACCTACACGCAAACTTGTTTACGAGATGAAGCTGTCAGGGCTGACAGGTGCGGTTTATAGGCGTCTTGTAAGGCAGATAGACGGGGGAAGGAGGGCTGCAGGGGTCGTTCAGGCCTTTCTGGCCCATATGTGGGAGGGCAACCCATATGCCAGAGCTGATGGACAGAG GGCAGGGGCGTGTTTCAACTAATGGACAGAAGGCAAGAGATGTCTGAGCTGATGGACAGAAAGCAGGACATATACCTCAGATCTTGGGGGACTCCTGACGAGAGGTCAGACTCTAGGACTGGTTTCGCGTAGGCGATACTTGCTACCTACCTTTATAAACAATCTCTCGTGTGGA

[0081] The nucleotide sequence of the tenth SNP molecular marker is shown in SEQ ID NO. 9. The SNP site is located at position 161 of the sequence, and its base is G / A.

[0082] SEQ ID NO.9:

[0083] CCAAAATGGAAGTGGTAGCGCTTGGGGGGATGTATGTGATGATGAGCCAGTAAGTAGAGAGGATGAGAGGCAAGAGTTACTGTACACAAGAGCTGTGTACAGTAATATTACCAGGCAGGCGTCAGCGATGCAAGCCCGGACCAACCGAACTTCTCCTTCACTATAAACAAAGCCT AACATTTGGAAATAAATATTAGCATTAATGCATTTATTTTCGGAGAGTAGATCAGCATTATTGTATGCCAAATATACCTCACTCTATCACATATTTCAAACGCAAATGGAATGTGTGTGTTTTTTCCTCGGTACTAACGTTTGTGTGCCTTTAGGATCCAGTTTCAGCTACTGGG

[0084] The nucleotide sequence of the eleventh SNP molecular marker is shown in SEQ ID NO. 10. The SNP site is located at position 160 of the sequence, and its base is C / A;

[0085] SEQ ID NO.10:

[0086] AGGACACCTTTCGTACCACTGTTGGGTTCCACCATTTTGATCTTTCCCATGCTCCCACATCTTCATAATGTTGGCTCATCTGTCCTGCAGAATTTTTATTTCCATCGGATTTGCACCTGTATAGTATTCTGGCCTGACAG TTTCCGCAAAAGCTCTCTAAAAAATGGGTCCATGATGGTATGGCGCACACAATGTCTTACACTATCGCACTCCGTGCGGGTGCGCCACAGACTGTGACGTCATGCTCCAGACGTTTCAGGGGAGCGCATTGCGACATCGAA

[0087] In the embodiment of the present application, the method for obtaining the above-mentioned SNP molecular marker is as follows:

[0088] 1. Family group construction

[0089] A single-pair mating method was used to construct a half-sib family - 1♂×2♀ (one male with two females, all offspring with the same father but different mothers belong to one half-sib family), and 30 full-sib families were placed in the same pond for breeding (pond size 660m 2 ), 100 shrimp were stocked from each family; after 50 days of culture, 1000 shrimp were randomly harvested from the ponds, their growth traits (harvest weight) were measured, and the tail muscle of each shrimp was frozen for DNA extraction;

[0090] 2. Simplifying genome sequencing

[0091] The 1,000 individuals of Procambarus clarkii were sequenced using SuperGBS (Super-genotyping-by-sequencing) technology to develop single-nucleotide polymorphism (SNP) molecular markers. SNPs with a minor allele frequency (MAF) greater than or equal to 0.05 were retained for subsequent genome-wide association studies (GWAS).

[0092] 3. Genotype Data Preprocessing

[0093] Simplified genome sequencing is used to obtain a large number of SNP variant sites. Since the sequencing conditions of each individual are different, some individuals may have unsatisfactory sequencing results. Genotype interpolation can increase the marker density and facilitate subsequent data processing. The specific processing steps are as follows:

[0094] Step 1: Use the genotype filling software Beagle 5.3 to complete the interpolation of missing genotype data;

[0095] Step 2: Use the genotype quality control software plink to perform data quality control, according to MAF = 0.05,

[0096] HWE=10e -4 Conduct screening;

[0097] Step 3: Use R language to match the genotype and phenotype of the data set and delete missing phenotypic values;

[0098] 4. Obtaining breeding trait data

[0099] In the present embodiment, a total of 911 Procambarus clarkii individuals were included in the subsequent analysis; Figure 1 As shown, a total of 105,150 SNP sites were identified on 94 chromosomes; the target trait, that is, the weight (continuous trait) of 911 Procambarus clarkii individuals was obtained;

[0100] 5. Normal distribution analysis of breeding target trait data

[0101] The normal distribution analysis of the weight of 911 Procambarus clarkii individuals was performed to obtain the individual weight scatter plot of Procambarus clarkii (refer to Figure 2 ), individual weight box plot of Procambarus clarkii (reference Figure 3 ), vertical histogram and probability density curve of individual weight of Procambarus clarkii (reference Figure 4 ) and the individual weight distribution function curve of Procambarus clarkii (reference Figure 5 ),Depend on Figure 2-Figure 5 It can be seen that the weight trait data of Procambarus clarkii approximately obey the normal distribution;

[0102] 6.GWAS Analysis

[0103] A generalized linear model (GLM) was used to conduct genome-wide association analysis on the rapid growth trait (weight at 50 days of harvest) and screen SNP molecular markers closely related to the rapid growth trait (refer to Figure 6 );

[0104] The genome-wide significance level was determined based on the Bonferroni correction, and the statistical threshold for determining a significant association between SNP variation and rapid growth traits was P < 4 × 10 -8 , a total of 11 SNP loci significantly associated with the rapid growth trait (50-day harvest weight) of Procambarus clarkii were screened, as shown in Table 1;

[0105] Table 1 Information of SNPs significantly associated with rapid growth traits of Procambarus clarkii

[0106]

[0107]

[0108] As shown in Table 1, the first SNP molecular marker (i.e., LG13:15613604) is located on chromosome 13 of Procambarus clarkii, with a physical position of 15613604 BP; the base of the first SNP molecular marker is C (wild type) or A (mutant), where the allele frequency of A is 0.4885, the allele frequency of C is 1-0.4885=0.5115, and the minimum allele frequency (MAF) of the marker is 0.4885, i.e., the allele frequency of A; the site passed the Hardy-Weinberg equilibrium test, and its P(HWE) value was 0.6119; the whole genome association analysis was performed using the GLM algorithm, and the marker regression effect was 2.76482336, and the corresponding Z statistic was 5.929466648. After the hypothesis test, its P value was 4.33E -09The odds ratio (OR value) of this site was 1.315205198, indicating that the probability of individuals with genotype A showing a rapid growth advantage was 1.315205198 times that of individuals with genotype C, and individuals with genotype AA of Procambarus clarkii had the potential to grow faster.

[0109] The second SNP molecular marker (i.e., LG30:3806403) is located on chromosome 30 of Procambarus clarkii, with a physical position of 3806403 BP. The base of the second SNP molecular marker is G (wild type) or A (mutant), where the allele frequency of G is 0.09137 and the allele frequency of A is 0.90863. The site passed the Hardy-Weinberg equilibrium test with a P(HWE) value of 0.001912. The whole genome association analysis was performed using the GLM algorithm, and the marker regression effect was 4.964470603, and the corresponding Z statistic was 5.885610993. After the hypothesis test, the P value was 5.60E -09 The odds ratio (OR value) of this site was 1.603115084, indicating that the probability of individuals with genotype G showing a rapid growth advantage was 1.315205198 times that of individuals with genotype A, and individuals with GG genotype Procambarus clarkii had the potential to grow faster.

[0110] The third SNP molecular marker (i.e., LG10:10542324) is located on chromosome 10 of Procambarus clarkii, with a physical position of 10542324 BP. The base of the third SNP molecular marker is C (wild type) or T (mutant), where the allele frequency of T is 0.2686 and the allele frequency of C is 0.7314. The site passed the Hardy-Weinberg equilibrium test with a P(HWE) value of 0.6284. The whole genome association analysis was performed using the GLM algorithm, and the marker regression effect was obtained to be -2.982355166, and the corresponding Z statistic was -5.850274359. After the hypothesis test, the P value was 6.87E. -09 The odds ratio (OR value) of this site was 0.737102339, indicating that the probability of individuals with T genotype showing a rapid growth advantage was 0.737102339 times that of individuals with C genotype, and individuals with CC genotype of Procambarus clarkii had the potential to grow faster.

[0111] The fourth SNP molecular marker (LG26:12272026) is located on chromosome 26 of Procambarus clarkii at a physical position of 12272026bp. The base of the fourth SNP molecular marker is either A (wild type) or G (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 0.743731092, indicating that individuals with the G genotype are 0.743731092 times more likely to exhibit a rapid growth advantage than those with the A genotype, indicating that individuals with the AA genotype have the potential for faster growth.

[0112] The fifth SNP molecular marker (LG23:20227099) is located on chromosome 23 of Procambarus clarkii at 20227099bp. The base of the fifth SNP molecular marker is either C (wild type) or T (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 1.311102438, indicating that individuals with the T genotype are 1.311102438 times more likely to exhibit a rapid growth advantage than those with the G genotype. Therefore, individuals with the TT genotype have the potential for faster growth.

[0113] The sixth SNP molecular marker (LG24:13313383) is located on chromosome 24 of Procambarus clarkii at a physical position of 13313383bp. The base of the sixth SNP molecular marker is either T (wild type) or C (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 1.520230201, indicating that individuals with the C genotype are 1.520230201 times more likely to exhibit a rapid growth advantage than those with the T genotype. Therefore, individuals with the CC genotype have the potential for faster growth.

[0114] The seventh SNP molecular marker (LG24:13313383) is located on chromosome 24 of Procambarus clarkii at a physical position of 13313383bp. The base of the seventh SNP molecular marker is either T (wild type) or G (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 1.520230201, indicating that individuals with the G genotype are 1.520230201 times more likely to exhibit a rapid growth advantage than those with the T genotype. Therefore, individuals with the GG genotype have the potential for faster growth.

[0115] The eighth SNP molecular marker (LG24:13313320) is located on chromosome 24 of Procambarus clarkii at a physical position of 13313320bp. The base of the eighth SNP molecular marker is either A (wild type) or G (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 1.520230201, indicating that individuals with the G genotype are 1.520230201 times more likely to exhibit a rapid growth advantage than those with the A genotype. Therefore, individuals with the GG genotype have the potential for faster growth.

[0116] The ninth SNP molecular marker (LG24:13280505) is located on chromosome 24 of Procambarus clarkii at a physical position of 13280505bp. The base of the ninth SNP molecular marker is either A (wild type) or G (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 1.481570801, indicating that individuals with the G genotype are 1.481570801 times more likely to exhibit a rapid growth advantage than those with the A genotype. Therefore, individuals with the GG genotype have the potential for faster growth.

[0117] The tenth SNP molecular marker (LG24:13158565) is located on chromosome 24 of Procambarus clarkii at a physical position of 13158565bp. The base of the tenth SNP molecular marker is either G (wild type) or A (mutant). This locus passed the Hardy-Weinberg equilibrium test, with an odds ratio (OR) of 1.478643374, indicating that individuals with the A genotype are 1.478643374 times more likely to exhibit a rapid growth advantage than those with the G genotype, indicating that individuals with the AA genotype have the potential for faster growth.

[0118] The eleventh SNP molecular marker (i.e., LG24:13211832) is located on chromosome 24 of Procambarus clarkii, with a physical position of 13211832BP; the base of the eleventh SNP molecular marker is C (wild type) or A (mutant); this site passed the Hardy-Weinberg equilibrium test, and the odds ratio (OR value) of this site was 1.462268636, indicating that the probability of individuals with genotype A showing a rapid growth advantage is 1.462268636 times that of individuals with genotype C, and individuals with genotype AA have the potential to grow faster.

[0119] Example 2: This example of the present application describes a set of primers related to the rapid growth of Procambarus clarkii, which were designed based on the SNP molecular markers described in Example 1;

[0120] The primers include: a primer for a first SNP molecular marker, a primer for a second SNP molecular marker, a primer for a third SNP molecular marker, a primer for a fourth SNP molecular marker, a primer for a fifth SNP molecular marker, a primer for a sixth SNP molecular marker, a primer for a seventh SNP molecular marker, a primer for an eighth SNP molecular marker, a primer for a ninth SNP molecular marker, a primer for a tenth SNP molecular marker, and a primer for an eleventh SNP molecular marker;

[0121] Among them, the sequences of the primers for the first SNP molecular marker are shown in SEQ ID NO.11 and SEQ ID NO.12; the sequences of the primers for the second SNP molecular marker are shown in SEQ ID NO.13 and SEQ ID NO.14; the sequences of the primers for the third SNP molecular marker are shown in SEQ ID NO.15 and SEQ ID NO.16; the sequences of the primers for the fourth SNP molecular marker are shown in SEQ ID NO.17 and SEQ ID NO.18; the sequences of the primers for the fifth SNP molecular marker are shown in SEQ ID NO.19 and SEQ ID NO.20; the sequences of the primers for the sixth SNP molecular marker are shown in SEQ ID NO.21 and SEQ ID NO.22; the sequences of the primers for the seventh SNP molecular marker are shown in SEQ ID NO.23 and SEQ ID NO.24; the sequences of the primers for the eighth SNP molecular marker are shown in SEQ ID NO.25 and SEQ ID NO.26; the sequences of the primers for the ninth SNP molecular marker are shown in SEQ ID NO.27 and SEQ ID NO.28; the sequences of the primers for the tenth SNP molecular marker are shown in SEQ ID NO.29 and SEQ ID NO. The sequences of the primers for the eleventh SNP molecular marker are shown in SEQ ID NO.31 and SEQ ID NO.32;

[0122] In the present embodiment, 10 pairs of specific PCR primers were designed using PrimerPlex (multiple PCR primer design software), and multiplex PCR amplification was performed using the genomic DNA of the sample to be tested. The amplified product fragments were between 152 and 249 bp;

[0123] Two rounds of PCR reactions were used to construct the target sequence sequencing library;

[0124] The first-round PCR amplification system included: 25 μL of 2× PCR Master Mix, 2 μL of forward and reverse primer mix (10 nmol / L), 1 μL of DNA template (100 ng / μL), and double-distilled water to 50 μL. Amplification conditions were: 95°C denaturation for 5 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing and extension at 61°C for 1 min, and extension at 72°C for 5 min. The first-round PCR amplification product was diluted 10-fold and centrifuged for 1 min before being used as the template for the second-round PCR amplification.

[0125] The second-round PCR amplification system included: 25 μL of 2× PCR Master Mix, 2 μL of forward and reverse primer mix (10 nmol / L), 1 μL of the first-round PCR amplification product, and double-distilled water to 50 μL. The second-round PCR amplification conditions were: 95°C denaturation for 5 min, followed by 20 cycles of denaturation at 95°C for 30 s, annealing and extension at 61°C for 1 min, and extension at 72°C for 5 min. After quality control, the PCR products were used to construct second-generation sequencing libraries, which were sequenced using the Illumina HiSeq2500 platform for high-throughput sequencing.

[0126] SOAPnuke software was used to filter and quality control the raw sequencing data. High-quality paired-end reads were aligned to the Procambarus clarkii genome reference sequence (ASM2042438v2) using SOAP2.22 software. SOAPsnpv1.05 software was used to read the SNPs of each sample to be tested. The resulting primer sequences are shown in Table 2.

[0127] Table 2 Primers used for screening and typing of SNPs associated with rapid growth in Procambarus clarkii

[0128]

[0129]

[0130] Example 3: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the first SNP molecular marker, PCR amplification of a fragment containing the above-mentioned first SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of AA as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0131] In the embodiment of the present application, the above-mentioned PCR amplification system includes: 2×PCR Master Mix 25 μL, 2 μL of forward and reverse primers (10 nmol / L), 1 μL of DNA template (100 ng / μL), and double-distilled water to make up the volume to 50 μL; the PCR amplification program is: a total of 40 cycles of PCR reaction, pre-denaturation at 94°C for 5 minutes before the cycle, each cycle including denaturation at 94°C for 30 seconds and annealing and extension at 60°C for 60 seconds; after the cycle is completed, extension is performed at 72°C for 5 minutes.

[0132] Example 4: This example describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the second SNP molecular marker, PCR amplification of a fragment containing the second SNP site is performed, and the genotype of the SNP site is typed by direct sequencing. Based on the genotype of the tested individual, it is determined whether the tested individual has the potential for rapid growth, that is, individuals with the genotype AA are screened as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0133] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0134] Example 5: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the third SNP molecular marker, PCR amplification of a fragment containing the third SNP site, genotyping the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of CC as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0135] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0136] Example 6: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the fourth SNP molecular marker, PCR amplification of a fragment containing the fourth SNP site is performed, and the genotype of the SNP site is typed by direct sequencing. Based on the genotype of the tested individual, it is determined whether the tested individual has the potential for rapid growth, that is, individuals with the genotype AA are screened as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0137] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0138] Example 7: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the fifth SNP molecular marker, PCR amplification of a fragment containing the fifth SNP site, genotyping the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of TT as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0139] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0140] Example 8: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the fifth SNP molecular marker, PCR amplification of a fragment containing the fifth SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of TT as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0141] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0142] Example 9: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the sixth SNP molecular marker, PCR amplification of a fragment containing the sixth SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of CC as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0143] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0144] Example 10: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the seventh SNP molecular marker, PCR amplification of a fragment containing the seventh SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of GG as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0145] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0146] Example 11: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the eighth SNP molecular marker, PCR amplification of a fragment containing the eighth SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of GG as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0147] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0148] Example 12: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the ninth SNP molecular marker, PCR amplification of a fragment containing the ninth SNP site is performed, and the genotype of the SNP site is typed by direct sequencing. Based on the genotype of the tested individual, it is determined whether the tested individual has the potential for rapid growth, that is, individuals with a genotype of GG are screened as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0149] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0150] Example 13: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the tenth SNP molecular marker, PCR amplification of a fragment containing the tenth SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with the AA genotype as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0151] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0152] Example 14: This example of the present application describes the use of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2. The specific method is: based on the primer of the eleventh SNP molecular marker, PCR amplification of a fragment containing the above-mentioned eleventh SNP site, typing the genotype of the SNP site by direct sequencing, and determining whether the tested individual has the potential for rapid growth based on the genotype of the tested individual, that is, screening individuals with a genotype of AA as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii;

[0153] In the examples of the present application, the above-mentioned PCR amplification system and PCR amplification procedure are the same as those in Example 3.

[0154] Example 15: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals through Example 3 and Example 4, and uses individuals with a genotype of AA at the first SNP site and a genotype of AA at the second SNP site obtained by direct sequencing as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0155] Example 16: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals through Example 3 and Example 5, and uses individuals with a genotype of AA at the first SNP site and a genotype of CC at the third SNP site obtained by direct sequencing as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0156] Example 17: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals through Example 4 and Example 6, and uses individuals with a genotype of AA at the second SNP site and a genotype of AA at the fourth SNP site obtained by direct sequencing as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0157] Example 18: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals through Example 5, Example 6 and Example 7, and uses individuals with a genotype of CC at the third SNP site, AA at the fourth SNP site and TT at the fifth SNP site obtained by direct sequencing as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0158] Example 19: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals through Example 8, Example 9, Example 10 and Example 11, and uses individuals with a genotype of TT at the fifth SNP site, CC at the sixth SNP site, GG at the seventh SNP site, and GG at the eighth SNP site obtained by direct sequencing as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0159] Example 20: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals through Example 10, Example 11, Example 12, Example 13 and Example 14, and uses individuals with a genotype of GG at the seventh SNP site, GG at the eighth SNP site, GG at the ninth SNP site, AA at the tenth SNP site and AA at the eleventh SNP site obtained by direct sequencing as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

[0160] Example 21: The example of the present application records the application of a PCR amplification primer in improving the genetic breeding efficiency of Procambarus clarkii, based on the primer provided in Example 2; the example of the present application screens Procambarus clarkii individuals according to Examples 3 to 14, and uses individuals with the genotype of the first SNP site obtained by direct sequencing as AA, the genotype of the third SNP site as CC, the genotype of the fourth SNP site as AA, the genotype of the fifth SNP site as TT, the genotype of the sixth SNP site as CC, the genotype of the seventh SNP site as GG, the genotype of the eighth SNP site as GG, the genotype of the ninth SNP site as GG, the genotype of the tenth SNP site as AA, and the genotype of the eleventh SNP site as AA as breeding materials for improving the genetic breeding efficiency of Procambarus clarkii.

Claims

1. A primer composition for detecting SNP molecular markers associated with the rapid growth trait of Procambarus clarkii, characterized in that: The rapid growth trait is weight, and the SNP molecular markers include a first SNP molecular marker, a second SNP molecular marker, a third SNP molecular marker, a fourth SNP molecular marker, a fifth SNP molecular marker, a sixth SNP molecular marker, a seventh SNP molecular marker, an eighth SNP molecular marker, a ninth SNP molecular marker, a tenth SNP molecular marker, and an eleventh SNP molecular marker, wherein: The nucleotide sequence of the first SNP molecular marker is shown in SEQ ID NO. 1, the SNP site is located at position 165 of the sequence, and its base is C / A; The nucleotide sequence of the second SNP molecular marker is shown in SEQ ID NO. 2, the SNP site is located at position 152 of the sequence, and its base is G / A; The nucleotide sequence of the third SNP molecular marker is shown in SEQ ID NO. 3, the SNP site is located at position 163 of the sequence, and its base is C / T; The nucleotide sequence of the fourth SNP molecular marker is shown in SEQ ID NO. 4, the SNP site is located at position 202 of the sequence, and its base is A / G; The nucleotide sequence of the fifth SNP molecular marker is shown in SEQ ID NO. 5, the SNP site is located at position 159 of the sequence, and its base is C / T; The nucleotide sequence of the sixth SNP molecular marker is shown in SEQ ID NO.6, the SNP site is located at position 161 of the sequence, and its base is T / C; The nucleotide sequence of the seventh SNP molecular marker is shown in SEQ ID NO. 7, the SNP site is located at position 157 of the sequence, and its base is T / G; The nucleotide sequence of the eighth SNP molecular marker is shown in SEQ ID NO. 7, the SNP site is located at position 174 of the sequence, and its base is A / G; The nucleotide sequence of the ninth SNP molecular marker is shown in SEQ ID NO. 8, the SNP site is located at position 160 of the sequence, and its base is A / G; The nucleotide sequence of the tenth SNP molecular marker is shown in SEQ ID NO. 9, the SNP site is located at position 161 of the sequence, and its base is G / A; The nucleotide sequence of the eleventh SNP molecular marker is shown in SEQ ID NO. 10, the SNP site is located at position 160 of the sequence, and its base is C / A; The sequences of the primers for the first SNP molecular marker are shown in SEQ ID NO.11 and SEQ ID NO.12; The sequences of the primers for the second SNP molecular marker are shown in SEQ ID NO.13 and SEQ ID NO.14; The sequences of the primers for the third SNP molecular marker are shown in SEQ ID NO.15 and SEQ ID NO.16; The sequences of the primers for the fourth SNP molecular marker are shown in SEQ ID NO.17 and SEQ ID NO.18; The sequences of the primers for the fifth SNP molecular marker are shown in SEQ ID NO.19 and SEQ ID NO.20; The sequences of the primers for the sixth SNP molecular marker are shown in SEQ ID NO.21 and SEQ ID NO.22; The sequences of the primers for the seventh SNP molecular marker are shown in SEQ ID NO.23 and SEQ ID NO.24; The sequences of the primers for the eighth SNP molecular marker are shown in SEQ ID NO.25 and SEQ ID NO.26; The sequences of the primers for the ninth SNP molecular marker are shown in SEQ ID NO. 27 and SEQ ID NO. 28; The sequences of the primers for the tenth SNP molecular marker are shown in SEQ ID NO.29 and SEQ ID NO.30; The sequences of the primers for the eleventh SNP molecular marker are shown in SEQ ID NO.31 and SEQ ID NO.

32.

2. Use of the primer combination according to claim 1 in screening for a rapid growth trait of Procambarus clarkii, wherein the rapid growth trait is body weight, wherein: The base of the first SNP molecular marker is C or A, and individuals of the AA genotype of Procambarus clarkii have the potential to grow faster; The base of the second SNP molecular marker is G or A, and individuals of the GG genotype of Procambarus clarkii have the potential to grow faster; The base of the third SNP molecular marker is C or T, and individuals of the CC genotype of Procambarus clarkii have the potential to grow faster; The base of the fourth SNP molecular marker is A or G, and individuals of the AA genotype Procambarus clarkii have the potential to grow faster; The base of the fifth SNP molecular marker is C or T, and individuals of the TT genotype of Procambarus clarkii have the potential to grow faster; The base of the sixth SNP molecular marker is T or C, and individuals of the CC genotype of Procambarus clarkii have the potential to grow faster; The base of the seventh SNP molecular marker is T or G, and individuals of the GG genotype of Procambarus clarkii have the potential to grow faster; The base of the eighth SNP molecular marker is A or G, and individuals of the GG genotype of Procambarus clarkii have the potential to grow faster; The base of the ninth SNP molecular marker is A or G, and individuals of the GG genotype of Procambarus clarkii have the potential to grow faster; The base of the tenth SNP molecular marker is G or A, and individuals of the AA genotype Procambarus clarkii have the potential to grow faster; The base of the eleventh SNP molecular marker is C or A, and individuals of the AA genotype Procambarus clarkii have the potential to grow faster.

Images