Application of Zip8 inhibitors in the preparation of drugs for the treatment of thoracic aortic dissection
By specifically knocking out the Zip8 gene in smooth muscle, we developed a Zip8 inhibitor for the treatment of thoracic aortic dissection, which solved the problem of lack of effective drugs in the existing technology, reduced the mortality rate and dissection rupture rate of TAD, and improved the aortic wall structure.
Patent Information
- Application Number
- CN202410937126.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-12
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2044-07-12
AI Technical Summary
Currently, there is a lack of effective drugs for the treatment of thoracic aortic dissection (TAD) in clinical practice. Existing studies have failed to deeply explore its pathogenesis and potential therapeutic targets, especially the role of Zip8 in TAD formation is unknown.
Provide Zip8 inhibitors, use CRISPR/Cas9 gene editing technology or interfering RNA technology to specifically knock out the Zip8 gene in smooth muscle, block its normal transcription or translation process, and develop Zip8 inhibitors for the preparation of drugs for the treatment of thoracic aortic dissection.
Smooth muscle-specific knockout of Zip8 can reduce the mortality and dissection rupture rate of TAD aggravated by TMAO, improve the aortic wall morphology and elastic fiber rupture, and does not affect the natural weight gain of mice, showing a protective effect on TAD in the basal state.
Smart Images

Figure CN118846064B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of a Zip8 inhibitor in preparing a drug for treating thoracic aortic dissection. Background Art
[0002] Thoracic aortic dissection (TAD) is a type of aortic disease with a high mortality rate, characterized by intimal tears and false lumen formation as its core pathological features. Due to the rapid onset of TAD, once diagnosed, patients require emergency surgery or timely drug intervention. Currently, there are no effective clinical treatments for TAD, and open surgery and endovascular repair are the main treatments for TAD. Therefore, in-depth exploration of the pathogenesis of TAD and identification of potential therapeutic intervention targets for TAD are of great significance for the development of targeted drugs to prevent and treat TAD.
[0003] Trimethylamine oxide (TMAO), a metabolite of gut bacteria, has become a risk predictor for cardiovascular disease, but its role in TAD is less well understood. The production of TMAO involves two biochemical metabolic processes: (1) Components such as choline, L-carnitine, and betaine, which are abundant in a high-fat diet, are converted to trimethylamine (TMA) via intestinal bacterial TMA lyase, which is the rate-limiting step in TMAO production. DMB is a non-lethal inhibitor of choline-TMA lyase. (2) After entering the liver, TMA is converted to TMAO via flavin-containing monooxygenase 3 (FMO3).
[0004] The zinc ion transporter Slc39a8, encoding the protein Zip8, is a key member of the solute carrier family 39, responsible for transporting zinc from intercellular vesicles or the extracellular space to the cytoplasm. It is localized to the cell membrane and lysosomal membranes and is widely expressed in various tissues and organs, including the lung, kidney, testis, and liver. Studies have shown that Zip8 plays an important role in immune function, insulin secretion, bone disease, and liver disease. However, the role of Zip8 in TAD formation remains unknown. Summary of the Invention
[0005] In order to solve the above technical problems, the present invention provides a use of a Zip8 inhibitor in the preparation of a drug for treating thoracic aortic dissection. Smooth muscle-specific knockout of Zip8 can inhibit TMAO-induced aggravation of TAD dissection progression and improve the occurrence and development of TAD dissection under basal conditions.
[0006] To achieve the above objectives, this protocol provides the use of a Zip8 inhibitor in the preparation of a drug for treating thoracic aortic dissection.
[0007] Preferably, the application is that the Zip8 inhibitor acts on smooth muscle Zip8 to improve the progression of aortic dissection aggravated by TMAO.
[0008] Preferably, the Zip8 inhibitor includes a Zip8 gene expression inhibitor and a substance that specifically inhibits the activity of Zip8-encoded protein.
[0009] Preferably, the Zip8 inhibitor is selected from CRISPR gene editing therapeutic drugs or antisense nucleic acid drugs that block the normal transcription or post-transcriptional translation process of the Zip8 gene through CRISPR / Cas9 gene editing technology or interfering RNA technology.
[0010] Preferably, the Zip8 inhibitor is chemically synthesized shZip8 or a vector containing shZip8, wherein shZip8 is a small hairpin ZIP8 oligonucleotide.
[0011] Preferably, the sequence of shZip8 is as shown in SEQ ID NO.1.
[0012] The principle of this regimen's Zip8 inhibitor for the treatment of thoracic aortic dissection is:
[0013] Smooth muscle-specific knockout of Zip8 showed a protective effect in TMAO-exacerbated TAD, reducing mortality and dissection rupture rate. Smooth muscle-specific knockout of Zip8 improved aortic wall morphology and elastic fiber rupture, and did not affect the natural weight gain of mice.
[0014] Moreover, smooth muscle-specific knockout of Zip8 also has a protective effect on TAD in the basal state. In the basal state, smooth muscle-specific knockout of Zip8 can improve the survival rate and dissection rupture rate of TAD mice.
[0015] Compared with the prior art, the present invention has the following beneficial effects:
[0016] (1) This study found that the smooth muscle-specific knockout of the zinc ion transporter Zip8 can improve TMAO-exacerbated TAD and inhibit the occurrence and development of TAD under basal conditions.
[0017] (2) Smooth muscle-specific knockout of Zip8 can improve aortic wall morphology and elastic fiber rupture without affecting the natural weight gain of mice. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0019] Figure 1 This is a picture showing that CMap suggests that the zinc ion transporter Slc39a8 (Zip8) is a potential target for therapeutic intervention in TAD. Figure 1 A is the experimental flow chart; Figure 1 B is a volcano map; Figure 1 C is the CMap database comparison result, CC, CMap classification; CP, compound; GKD, gene knockdown; GOE, gene overexpression;
[0020] Figure 2 This is a diagram showing abnormal intestinal structure and function in TAD mice in Experimental Example 1. Figure 2 A is the total intestinal length of the mouse; Figure 2 B is the morphological diagram of mouse colorectum; Figure 2 C is the length of the mouse colon and intestine; Figure 2 D is the whole intestinal transit time of mice; Figure 2 E is the defecation frequency of mice (number of fecal pellets within the first hour); Figure 2 F is the maximum cross-sectional area of a single mouse feces; Figure 2 G is a representative image of H&E staining of mouse colon tissue (monitoring crypt depth), immunofluorescence staining of tight junction protein ZO-1 (monitoring intestinal epithelial barrier), and penonidazole (monitoring oxygen content in the colon lumen); Figure 2 H is the statistical depth of mouse colonic crypts; Figure 2 I is the expression statistics of tight junction protein ZO-1 in mouse colon, Figure 2 J is the statistical oxygen content in the mouse colon cavity;
[0021] Figure 3 This is the dissection phenotype of TAD mice aggravated by TMAO in Experimental Example 1. Figure 3 A is the plasma TMAO level of mice, Figure 3 B is a simplified diagram of the experimental dosing regimen; Figure 3 C is the anatomical diagram of the mouse aorta. Figure 3 DE are survival curves of C57BL / 6J male mice (D) and female mice (E). The differences between the groups were analyzed using the Log-rank (Mantel-Cox) test. * indicates P < 0.05, ** indicates P < 0.01, and **** indicates P < 0.0001. Figure 3 F is the incidence of aortic disease (aortic dissection or aortic rupture) in mice, Figure 3G is the weight growth graph of mice, Figure 3 H is a representative picture of H&E staining (observing the overall vascular morphology and false lumen) and EVG staining (observing the elastic fiber rupture) of the ascending aorta of mice. Figure 3 I is the specific location of aortic dissection;
[0022] Figure 4 This is the diagram showing that smooth muscle-specific knockout of Zip8 improves the dissection phenotype of TAD mice in Experiment 2. Figure 4 A is a schematic diagram of the experimental dosing regimen. Figure 4 B is the anatomy of the mouse aorta. Figure 4 C is the mouse survival curve. Figure 4 D is the incidence of aortic disease (aortic dissection or aortic rupture) in mice, Figure 4 E is the graph of mouse weight growth;
[0023] Figure 5 This is a diagram showing that smooth muscle-specific knockout of Zip8 improves the dissection phenotype of TAD mice aggravated by TMAO in Experimental Example 2. Figure 5 A is a schematic diagram of the experimental dosing regimen. Figure 5 B is the anatomy of the mouse aorta. Figure 5 C is the mouse survival curve. Figure 5 D is the incidence of aortic disease (aortic dissection or aortic rupture) in mice, Figure 5 E is a representative picture of H&E staining (observing the overall vascular morphology and false lumen) and EVG staining (observing the elastic fiber rupture) of the ascending aorta of mice. Figure 5 F is the graph of mouse weight gain. DETAILED DESCRIPTION
[0024] In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.
[0025] The following examples are provided to illustrate the present invention but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.
[0026] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.
[0027] Example 1
[0028] Selecting Zip8 as an intervention target for the treatment of thoracic aortic dissection
[0029] The experimental animals used in this study were 3-week-old mice of different strains (with C57BL / 6J as the genetic background), all of which were obtained through self-breeding.
[0030] To investigate the effects of TMAO on TAD, three-week-old mice were fed a diet supplemented with 0.3% BAPN (β-aminopropionitrile fumarate) and 0.12% TMAO as the experimental group. Reference transcriptome sequencing was performed on the ascending aorta of C57BL / 6J male mice treated with either BAPN+Vehicle or BAPN+TMAO (experimental groups) for 7 days. A list of upregulated and downregulated differentially expressed genes was obtained. This differentially expressed gene list was then aligned with a reference gene dataset using CMap, and correlation scores were generated based on the enrichment of differentially expressed genes in the reference gene expression profiles. The CMap database is a gene expression database established by linking interfering substances (different concentrations of small molecule compounds, gene knockdown, and gene overexpression) to gene expression differences in different human cells.
[0031] The experimental flow chart is as follows Figure 1 As shown in A, the volcano map results are as follows Figure 1 As shown in B, genes such as Mgst1, Car8, Fmo1, and Capn11 were downregulated, while genes such as Dnah5, Tnc, Acan, and P2rx1 were upregulated.
[0032] The CMap visualization results are as follows Figure 1 As shown in Figure C, after setting a correlation score threshold of ±97, the differentially expressed genes of interest showed high similarity with the cellular gene expression profiles of eight small molecule compounds, eight genes (knockdown), and two genes (overexpression) in the database. Because the SLC39A8 gene had a correlation score of +97.32 and its encoded zinc ion transporter Zip8 protein controls zinc ion transmembrane transport in cells, the research target was locked on SLC39A8.
[0033] Example 2 Construction of model mice
[0034] (1) Construction of TAD mouse model
[0035] Three-week-old mice were fed a 0.3% m / m BAPN diet for 28 consecutive days to induce TAD. To ensure the stability and reproducibility of TAD formation rates in the experiment, the age of the mice was strictly controlled (21±2 days). TAD was assessed in three ways: (1) Autopsy: The mice were observed for death at 8:00 am and 19:00 pm every day. The dead mice were dissected. If the mice were found to have hemorrhage in the thoracic cavity or hemorrhage in the peritoneal cavity, the cause of death was preliminarily determined to be dissection rupture. (2) Aortic appearance and morphology: The entire aorta of the dead or experimentally terminated mice was dissected and placed in 1×PBS. The connective tissue around the aorta was removed and the appearance and morphology of the aorta from the ascending aorta to the common iliac aorta were observed (whether there was dilatation, aneurysm, intramural hematoma, dissection or rupture). (3) Morphological staining (H&E or EVG staining): The ascending aorta with lesions was morphologically stained. The formation of a false lumen can prove the formation of dissection.
[0036] (2) Construction of a TAD mouse model with TMAO administration
[0037] To investigate the effect of TMAO on TAD, 3-week-old mice were fed a 0.3% BAPN diet and supplemented with vehicle (water) or 0.12% TMAO for 28 consecutive days.
[0038] (3) Hybridization and breeding of Zip8 knockout mice
[0039] Smooth muscle-specific knockout Zip8 mice (Zip8 smKO ) by Zip8 fl / fl with Tagln-Cre + The macrophage-specific knockout Zip8 mice (Zip8 MΦKO ) by Zip8 fl / fl with LysM-Cre + Hybridization. Zip8 fl / fl Mice were prepared by Saiye Biotechnology Co., Ltd., and Tagln-Cre + and LysM-Cre + All mice were housed in a specific pathogen-free environment with a constant temperature and humidity, and a 12 / 12 hour light / dark cycle.
[0040] The sequence of the Zip8 gene knocked out using CRISPR / Cas9 technology is shown in SEQ ID NO.2. Frameshift knockout is used to knock out exon 3 of the Zip8 gene and the surrounding non-coding regions. The knockout is a non-triplicate base pair, and the subsequent coding region undergoes a frameshift, rendering gene expression ineffective, thus achieving the purpose of "knockout."
[0041] SEQ ID NO.2:
[0042] ggatggtagatgggctcctgactgtgtcctctctactgtcccttcatctgaatggaccagggtccttcttataacactaattatttacgtagacgatctc
[0043] catatatcaccacactgtggattagggtccgacatgaattttgaggaacacagttcagtttatggtacaaagctaagattttagtggggttagagtatt
[0044] gactgaaatagacaaaaaatatctctcagttgatttttatgaaagacaggcttttgtctgaggaaatgggtatttctcagcttctaatttgtatgacattga
[0045] tttattaatgtttcatccattttacagtgaaaatgcacttgagagtaaatgaccctttaaaaaattgcttttgcagagatttctttttctaatgcagattctttg
[0046] cctcattaaaaaagttaatgaatttctaagtggcccagcactatccacaaaactctttataatagaaaccctaatcatcagcatttagaataatttagt
[0047] aaacaacagcttgagctaagatataatttaaaacaattttggaactctttttgcgatattgatggatatatttttaaactatgaaattgtaaggacccaag
[0048] tagccatcaataaagaatgctggaaagctactctgacagcatccacaaaatatctatttaaagaactaaaaaggtaaattgagacaattaaaaaaat
[0049] catctcagagccctgtgttcaaatactaccattgtgccattggtacttctttcctgttttatagtcttgggtacccagactttgtgtatgctaggcaagca
[0050] cttccccctaacctggagttatagccacagcccagctcttattattatttttgaagtctttctcaacgtctaaaccagttttttaaaatcttattttgtttataa
[0051] tagataggcagttgattaaataattcttttgctattttgtttgtttctttctggatttaaagaggaacggactggtccatttatttcggtagtgagttcagac
[0052] gcagcactgcatgcctggtcggagtacggcttgtttctctagaccgtactctacatctaaggtttagtgttcattcatatgtgctggctcattactatct
[0053] gtgtgcctctgtttgctctgtttcagtgtttgtcagcagaagacatcttttctcttcatggtttctcaaatgtcacccagataaccagctcgaacttctctg
[0054] ccatctgccccgcgatcttacagcagctgaacttccatccctgcgaggatctaagaaagcacaacgcaaagcccagtctttccgaaggtaccgg
[0055] aagccgctttcccactccatagggaaggaagtctgagaggcagcgggagataaagctctcacgcacccttttctcatttatcgctcttaattaagtt
[0056] gtgagaaacctcctgataaaataagatttagcgagtttttagataagaatattggaaactcatacaaactgtatgcaatgcgcttctgcttgtgggatc
[0057] aagactgaccctagtatgcgttaaaattctacaatccagtcttctcattttacttattcatttgatttttattgtatagattcatcaaacattgtgttctgttac
[0058] atatgaaattttcacgcaaatacacaataatgcgttgaccgtatttatccgaagccttcctcccctccccctttccctctttttttcccccaaagtctttgtt
[0059] ctggtaagaggagtggtcctcacccttccgaatgctgtgaccctttaatccagttctttgtgttgtggggaccccaaccataaaatgatttcattgcta
[0060] cttcatgcctataagtttgctactgttataaatcataatggaaatacctgataggatatccgatatacggatcc
[0061] To investigate the role of zinc ion transporter Zip8 in TAD formation, 3-week-old Zip8 fl / fl 、Zip8 smKO and Zip8 MΦKO Male mice were fed a diet containing 0.3% BAPN and supplemented with vehicle or TMAO for 28 days.
[0062] Experimental Example 1
[0063] (1) Investigating the intestinal structure and function of the TAD mouse model
[0064] To investigate whether BAPN-induced TAD mice have intestinal abnormalities, 0.3% BAPN was added to the diet of 3-week-old C57BL / 6J male mice to induce TAD for 14 days. The normal feed group (Chow) served as the control, and the experimental group was the BAPN feed group.
[0065] The experimental results are as follows Figure 2 As shown in Figures 2A-2F, compared with control mice, the gross structure and physiological function of the intestine of TAD mice were abnormal, manifested by shortened total intestinal and colorectal lengths, prolonged whole-intestinal transit time, reduced defecation frequency, and reduced single fecal area. These variables will affect the colonization of downstream intestinal microbiota.
[0066] The results of H&E staining are as follows Figure 2 As shown in G, the length of the colonic crypts in TAD mice was shortened to 2 / 3 of that in the control mice. The immunofluorescence labeling of the connexin ZO-1 was shown in Figure 2 G and 2I results showed that the ZO-1 protein content in the colon wall of TAD mice was significantly reduced, suggesting that the colon epithelial barrier was damaged.
[0067] Under normal circumstances, the colon always maintains a low oxygen state to allow anaerobic bacteria to reproduce. However, the content of Pimonidazole, a specific hypoxia marker, in the colon of TAD mice is reduced, suggesting that the low oxygen microenvironment of the colonic intestinal cavity is destroyed ( Figure 2 G and 2J). These results indicate that TAD mice already have abnormalities in colon structure and function at the mid-stage of dissection development (day 14).
[0068] (4) Investigating the progression of dissection in TAD mice aggravated by TMAO
[0069] The control group included Chow (Vehicle) and Chow (TMAO), and the experimental group included BAPN (Vehicle) and BAPN (TMAO).
[0070] HPLC-MS / MS test results are as follows Figure 3 As shown in A, it shows that the plasma TMAO level of TAD mice is increased. Moreover, after TMAO administration, both female and male TAD mice died due to dissection rupture ( Figure 3 CF). During the entire administration process, BAPN and TMAO did not affect the natural increase in mouse body weight ( Figure 3 G). H&E and EVG staining results showed that the aortic wall of TAD mice showed dissection (false lumen) and disorder and rupture of the elastic fiber layer, and the dissection was mainly located in the outer 1 / 3 of the tunica media of the vascular wall; TMAO could further aggravate the damage of the aortic structure, but did not change the specific location of the dissection ( Figure 3 HI).
[0071] Experimental Example 2
[0072] (1) Investigating the improvement of the dissection phenotype in TAD mice by smooth muscle-specific knockout of Zip8
[0073] At 3 weeks old, Zip8 fl / fl 、Zip8 smKO and Zip8 MΦKO Male mice were given BAPN alone for 28 days to induce TAD ( Figure 4 A). The results showed that, under basal conditions, smooth muscle-specific knockout of Zip8 improved the survival rate and dissection rupture rate of TAD mice, while macrophage-specific knockout of Zip8 failed to improve the dissection phenotype of TAD mice ( Figure 4 BE).
[0074] (2) Investigating whether smooth muscle-specific knockout of Zip8 improves the dissection phenotype of TAD mice exacerbated by TMAO
[0075] At 3 weeks old, Zip8 fl / fl , Zip 8smKO and Zip8MΦKO Male mice were given BAPN diet and TMAO for 28 days ( Figure 5 A). The results show that Zip8 fl / fl Compared with WT mice, Zip8 smKO The mortality rate of mice was reduced from 100% to 60%, and the rate of dissection rupture was reduced.
[0076] H&E and EVG staining results showed that smooth muscle-specific knockout of Zip8 could improve aortic wall morphology and elastic fiber fragmentation ( Figure 5 BD). However, macrophage-specific knockout of Zip8 significantly improved both survival rate and ascending aorta wall structure ( Figure 5 E). Smooth muscle or macrophage-specific knockout of Zip8 did not affect the natural weight gain of mice ( Figure 5 F).
[0077] The above is only a preferred embodiment of the present invention, and the scope of protection of the present invention is not limited to the above embodiment. For those skilled in the art, improvements and modifications obtained without departing from the technical concept of the present invention should also be considered as the scope of protection of the present invention.
Claims
1. Application of a Zip8 inhibitor in the preparation of a drug for treating thoracic aortic dissection, characterized in that: The Zip8 inhibitor is a CRISPR / Cas9 gene editing system that knocks out the Zip8 gene.
2. The use according to claim 1, characterized in that The application method is that the Zip8 inhibitor acts on smooth muscle Zip8 to improve the progression of aortic dissection aggravated by TMAO.
Citation Information
Patent Citations
Use of monocytes / macrophages in diagnosis and treatment of aortic injury
CN111656195A
Application of CD43 inhibitor in preparation of medicine for resisting colorectal tumor
CN115814091A