Porcine delta coronavirus neutralizing monoclonal antibody and application thereof

Abstract

This invention discloses a neutralizing monoclonal antibody against porcine deltacoronavirus (PDCoV) and its applications, relating to the field of biotechnology. The invention utilizes purified PDCoV to immunize BALB / c mice, screening to obtain a porcine deltacoronavirus monoclonal antibody. In vitro neutralization experiments demonstrate that the monoclonal antibody possesses neutralizing activity against porcine deltacoronavirus and can block PDCoV infection. The gene sequence of the neutralizing antibody was obtained using RT-PCR, and its encoded amino acid sequence was obtained by sequencing. The amino acid sequence of the heavy chain variable region of the porcine deltacoronavirus neutralizing monoclonal antibody is shown in SEQ ID NO.1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.2. This invention provides an effective new approach for the prevention and treatment of PDCoV infection.

Description

Technical Field

[0001] This invention relates to a neutralizing monoclonal antibody against porcine delta coronavirus and its applications, and belongs to the field of biotechnology. Background Technology

[0002] Porcine deltacoronavirus (PDCoV) is a newly discovered coronavirus that causes intestinal infection in piglets, resulting in diarrheal disease. The main symptoms include fever, lethargy, vomiting, watery diarrhea, and severe dehydration in infected piglets, with a mortality rate reaching 30%. PDCoV was first detected in Hong Kong pig herds in 2012 using whole-genome sequencing. Subsequently, it appeared and spread widely in the United States, mainland China, South Korea, Thailand, and other countries and regions, causing significant economic impact on pig farming worldwide. PDCoV primarily infects suckling piglets aged 5–14 days. Affected piglets mainly exhibit acute watery diarrhea, along with anorexia, lethargy, unsteady gait, vomiting, and dehydration, which can lead to death in severe cases. Necropsy of affected piglets reveals a bloated stomach filled with curdled milk, a thinned and translucent intestinal wall, yellow fluid filling the intestinal tract, and small hemorrhages on the mesentery. Studies have found that in addition to intestinal lesions, PDCoV infection can also cause interstitial pneumonia, suggesting that the virus may have the characteristic of multi-system transmission.

[0003] Neutralizing antibodies play a crucial role in the prevention and treatment of viral infections. They prevent the virus from entering cells, replicating, and spreading by recognizing and binding to specific proteins on the viral surface, thus blocking the virus from binding to host cell receptors. This mechanism not only reduces viral infection but also significantly alleviates the symptoms caused by the infection. Therefore, obtaining a monoclonal antibody with neutralizing activity against PDCoV is of great significance for the prevention and control of PDCoV. Summary of the Invention

[0004] The purpose of this invention is to provide a monoclonal antibody with PDCoV neutralizing activity and its application.

[0005] To achieve the above objectives, the present invention employs the following technical means:

[0006] This invention immunized BALB / c mice with purified PDCoV and screened them using indirect ELISA to obtain a monoclonal antibody, named 3H3. IFA (indirect immunofluorescence assay) results showed that 3H3 specifically reacted with PDCoV and effectively neutralized it, rendering it unable to infect cells. The 3H3 monoclonal antibody subclass was identified as IgG1, with the light chain being the κ chain. The antibody gene was amplified using PCR, and the antibody sequence was obtained by sequencing.

[0007] The present invention discloses a neutralizing monoclonal antibody against porcine delta coronavirus, characterized in that the neutralizing antibody comprises a heavy chain variable region and a light chain variable region, wherein the polynucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.3, and the polynucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.4.

[0008] A polynucleotide encoding a neutralizing antibody against the porcine delta coronavirus, the polynucleotide comprising polynucleotides encoding heavy chain and light chain variable regions respectively, wherein the sequence of the polynucleotide encoding the heavy chain variable region is shown in SEQ ID NO.3, and the sequence of the polynucleotide encoding the light chain variable region is shown in SEQ ID NO.4.

[0009] Expression vectors containing the aforementioned polynucleotides, and host cells containing the aforementioned polynucleotides or recombinant vectors are also within the scope of protection of this invention.

[0010] Furthermore, the present invention also proposes the use of the porcine delta coronavirus neutralizing monoclonal antibody, the polynucleotide, the recombinant vector, or the host cell in the preparation of drugs against porcine delta coronavirus.

[0011] The use of the polynucleotide, recombinant vector, or host cell of the porcine delta coronavirus neutralizing monoclonal antibody in the preparation of reagents for detecting porcine delta coronavirus.

[0012] Preferably, the reagent is a double-antibody sandwich ELISA detection reagent.

[0013] Compared with the prior art, the beneficial effects of the present invention are:

[0014] This invention proposes a neutralizing monoclonal antibody against PDCoV. Sequencing revealed the variable region of the antibody, and experiments demonstrated that this antibody effectively neutralizes PDCoV and blocks PDCoV infection. Given the antibody's biological characteristics and its ability to neutralize PDCoV, it can be obtained using various expression systems according to practical needs. This neutralizing antibody can be used for the preparation of drugs to treat PDCoV infection and for the establishment of a series of diagnostic methods for PDCoV infection, possessing broad research and application value. Attached Figure Description

[0015] Figure 1 To observe porcine delta coronavirus particles using electron microscopy;

[0016] Figure 2 For PCR amplification of the variable region of the monoclonal antibody;

[0017] Figure 3 For IFA testing of the reaction between 3H3 monoclonal antibody and PDCoV;

[0018] Figure 4 To identify the specificity of 3H3 monoclonal antibody for IFA detection;

[0019] Figure 5 To identify the specificity of 3H3 monoclonal antibody for ELISA detection;

[0020] Figure 6 The neutralization assay of PDCoV with 3H3 monoclonal antibody was performed. Detailed Implementation

[0021] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0022] Example 1: Screening and identification of monoclonal antibodies capable of neutralizing porcine delta coronavirus

[0023] 1. Materials and Methods

[0024] 1.1 Cells, laboratory animals, antibodies, and reagents

[0025] ST and SP2 / 0 cells were preserved by the Microbiology and Immunology Laboratory of the College of Veterinary Medicine, Northeast Agricultural University; 1640 medium was purchased from Sigma-Aldrich; HAT and HT medium, Freund's adjuvant, Freund's incomplete adjuvant, and PEG fusion agent were all purchased from Thermo Fisher Scientific; BALB / c mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd.; FITC-labeled goat anti-mouse was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.

[0026] 1.2 Cultivation and purification of PDCoV

[0027] 1.2.1 Cultivation of PDCoV

[0028] After the ST cells have grown into a confluent monolayer and are in good condition, wash the cells three times with sterile PBS; dilute the virus solution to 100 TCID with cell maintenance medium. 50 / mL, seeded into ST cells, and cultured in a 37℃, 5% CO2 cell culture incubator; observe that the cytopathic effect rate reaches about 80%, and after repeated freeze-thaw cycles twice, store the cell culture at -80℃ for later use.

[0029] 1.2.2 Purification of PDCoV

[0030] Collect PDCoV cell culture and centrifuge at 10,000 rpm at 4°C for 30 min to remove cell debris. Aspirate the viral supernatant and centrifuge at 30,000 rpm at 4°C for 3 h using an ultracentrifuge. Discard the supernatant and resuspend the precipitate in an appropriate amount of PBS to obtain the concentrated viral solution.

[0031] 1.3 Preparation of PDCoV monoclonal antibodies

[0032] 1.3.1 Animal Immunity

[0033] The concentrated virus solution was mixed with an equal volume of Freund's complete adjuvant, and after thorough emulsification using the double-push method, it was subcutaneously injected into the back of BALB / c mice. The immunization dose was 200 ng / mouse per immunization. On days 14 and 28, the mice were immunized with virus solution emulsified with Freund's incomplete adjuvant, at the same dose as the initial immunization.

[0034] 1.3.2 Cell fusion and screening of positive hybridoma cells

[0035] SP2 / 0 cells and mouse spleen cells were added to centrifuge tubes at a ratio of 1:8. The tubes were centrifuged at 1000 rpm for 6 min, the supernatant was discarded, and the bottom of the tubes was gently tapped to disperse the cells evenly into a paste. The tubes were then placed in a 37°C water bath, and 600 μL of pre-warmed cell fusion medium (at 37°C) was slowly and evenly added. The tubes were incubated at 37°C for 90 s. Then, 10 mL of pre-warmed 1640 culture medium (at 37°C) was added slowly and gradually increased in speed. After mixing, the tubes were centrifuged at 800 rpm for 6 min. The cells were washed twice, resuspended in HAT medium, and 100 μL of the mixture was added to each well of a 96-well cell culture plate containing feeder cells. The plates were then incubated at 37°C in a 5% CO2 incubator. When the cell colonies reached 1 / 3 of the bottom area of ​​the wells, the cell culture supernatant was collected, and the antibody titer of the hybridoma cell supernatant was detected using an indirect ELISA method. Positive hybridoma cells were then cloned.

[0036] 1.3.4 Preparation of Ascites

[0037] 6-8 week old BALB / c mice were intraperitoneally injected with 500 μL of dry heat-sterilized liquid paraffin. Seven days later, approximately 10⁶ hybridoma cells were injected intraperitoneally. Eight to twelve days later, when the mice showed signs of abdominal enlargement and lethargy, ascites fluid was aspirated. The ascites fluid was centrifuged at low speed for 15 min, and the supernatant obtained was stored at -40°C for later use.

[0038] 1.3.5 Determination of the variable region gene sequence of monoclonal antibodies

[0039] The variable regions of the heavy and light chains of the antibody were amplified by PCR using universal primers VH-F / R and VL-F / R for the variable region of the mouse antibody. Table 1 shows the primer sequences.

[0040] Table 1 Primer sequences for antibody variable region genes

[0041]

[0042] 1.3.6 Indirect immunofluorescence identification of monoclonal antibodies

[0043] ST cells infected with PDCoV were fixed with pre-cooled anhydrous ethanol when 80% lesions were observed. After blocking with 3% BSA at room temperature for 1 h and washing with PBS 3 times, hybridoma cell supernatant was used as the primary antibody and FITC-labeled goat anti-mouse IgG (1:200) diluted with 1% BSA as the secondary antibody. The cells were incubated at 37°C for 50 min, washed with PBS 3 times, and then incubated with DAPI at room temperature for 2 min. After washing with PBS 3 times, the cells were observed and photographed using a fluorescence microscope.

[0044] 1.3.7 Monoclonal antibody subtype identification

[0045] The monoclonal antibody subtypes were detected using a mouse monoclonal antibody typing kit. Capture antibody (UNLB) was diluted to 10 μg / mL with PBS, and 100 μL / well was used to coat the microplate. The plate was incubated overnight at 4°C, and washed three times with PBST for 5 min each time. 100 μL of 1% BSA was added to each well for blocking, and the plate was incubated at room temperature for 1 h, followed by three washes with PBST for 5 min each time. Hybridoma cell supernatant was added, and the plate was incubated at 37°C for 1 h, followed by three washes with PBST for 5 min each time. HRP-labeled detection antibody (1:500) diluted in PBS was added, and the plate was incubated at room temperature for 1 h, followed by three washes with PBST for 5 min each time. 100 μL of TMB chromogenic solution was added to each well, and the plate was incubated at room temperature in the dark for 10 min. Then, 50 μL of stop solution was added to each well, and the OD values ​​were read using a microplate reader. 450nm value.

[0046] 1.3.8 Identification of PDCoV monoclonal antibody specificity

[0047] The specificity of the 3H3 monoclonal antibody against PDCoV, TGEV and PEDV porcine diarrhea coronavirus was identified using IFA and indirect ELISA.

[0048] 1.3.9 Monoclonal antibody neutralizing activity assay

[0049] The neutralizing titer of the prepared mouse ascites fluid was determined according to the method of fixing the virus and diluting the ascites fluid. The virus was diluted to 200 TCID50 / mL and mixed with an equal volume of serially diluted (2-fold) ascites fluid for testing. The mixture was incubated in a 37°C water bath for 60 min. Eight wells were seeded for each dilution. After 24 h of seeding, the number of wells showing CPE in each group was recorded. The half-maximal protective dose (PD50) was calculated using the Reed-Muench method, and the neutralizing titer of the ascites fluid was calculated using the following formula:

[0050] lg PD50 = ascites dilution rate with a protection rate of 50% or higher + distance ratio × logarithm of dilution factor.

[0051] 2 Results

[0052] 2.1 Purification of PDCoV viral particles

[0053] The results of electron microscopy observation of the purified virus particles are as follows: Figure 1 Complete PDCoV virus particles are visible.

[0054] 2.2 Preparation of anti-PDCoV monoclonal antibodies

[0055] 2.2.1 Obtaining Monoclonal Antibody Hybridoma Cell Lines

[0056] Using PDCoV cell culture as the detection antigen, the antibodies secreted by the fused hybridoma cells were detected by indirect ELISA. Positive hybridoma cell lines were screened, and after three rounds of subcloning, a positive hybridoma cell line was obtained and named 3H3.

[0057] 2.2.2 IFA analysis of monoclonal antibodies

[0058] To detect the binding efficacy of this monoclonal antibody to PDCoV, IFA experiments were performed using the supernatant of five hybridoma cell lines as primary antibodies. The results showed that the monoclonal antibody produced a specific green fluorescent signal with PDCoV-infected ST cells, while no fluorescence was observed in the ST cell control group. Figure 2 This indicates that the monoclonal antibody can recognize and bind to PDCoV.

[0059] 2.2.3 Identification of monoclonal antibody subtypes

[0060] To determine the types of heavy and light chains of the prepared monoclonal antibody, the subtype of the monoclonal antibody was detected using indirect ELISA. The heavy chain subtype of the monoclonal antibody was IgG1, and the light chain was κ chain.

[0061] 2.2.4 Determination of the variable region gene sequence of PDCoV monoclonal antibody

[0062] To obtain the gene sequence of the variable region of monoclonal antibodies, hybridoma cells were used as templates to amplify the VH and VL regions of the antibody heavy chain variable region (VH) and light chain variable region (VL) genes, respectively, using specific primers (VH-F / R and VL-F / R), and then sequenced. The PCR amplification results showed a target band of approximately 340 bp, consistent with the expected size. Figure 3 )

[0063] After sequencing, the nucleotide sequence of the heavy chain variable region of the 3H3 monoclonal antibody is as follows:

[0064] GCGGAGGTGAAGCTGTCCTGCAAGGCTTCTGGCTACTCCTTCACCAACTACAGGATGAACTGGGTGAAGCAGAGGCCTGGACAAGGCCTTGAGTGGATTGGCATGATTCATCCTTCCGATAGTGAAGCTAGGGTTAAATCAGAAGTTCAAGGACAGGGCC ACATTGACTGTAGACAAATCCTCCGGCACAGCCTACATGCAACTCAACAGCCCGACATCTGAGGACTCTGCGGTCTATTACTGTGCCCTCTATGGTTACGACGGTCTCTATAGTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCG(SEQ ID NO.3)

[0065] The nucleotide sequence of the light chain variable region of the 3H3 monoclonal antibody is as follows:

[0066] GCACGCGTAGACATTGTGCTGACCCAATCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAGTTATATGCACTGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCTCATCTATCT TGTATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAACCTATTACTGTCAGCACATTAGGGAGCTTACACGTTCGGAGGGGGGACCAAGCTGGAAATAA(SEQ ID NO.4)

[0067] 2.2.5 Identification of PDCoV monoclonal antibody specificity

[0068] IFA results showed that specific fluorescence was detected in ST cells inoculated with PDCoV, while no specific fluorescence signal was detected in cells infected with TGEV and PEDV. Figure 4 Indirect ELISA results showed that the monoclonal antibody bound only to PDCoV and not to other viruses or ST cells. Figure 5 The above results indicate that the prepared monoclonal antibody has good specificity.

[0069] 2.2.6 Neutralizing effect of monoclonal antibodies

[0070] The virus-neutralizing properties of the monoclonal antibody secreted by the prepared 3H3 hybridoma cells were identified using IFA. The results showed that when the ascites fluid was diluted 20-fold, no fluorescence signal was observed, indicating complete virus neutralization; when the ascites fluid was diluted 160-fold, specific green fluorescence appeared. Figure 6 This result indicates that the monoclonal antibody prepared in this invention has the ability to neutralize PDCoV. The neutralizing titer was calculated using the Reed-Muench method (Table 1), and the neutralizing titer of the prepared monoclonal antibody in mouse ascites fluid was determined to be 1:60.

[0071] Table 2 Results of 3H3 antibody neutralization assay

[0072]

Claims

1. A neutralizing monoclonal antibody against porcine delta coronavirus, characterized in that, The neutralizing monoclonal antibody comprises a heavy chain variable region and a light chain variable region. The polynucleotide sequence encoding the heavy chain variable region is shown in SEQ ID NO.3, and the polynucleotide sequence encoding the light chain variable region is shown in SEQ ID NO.

4.

2. A polynucleotide encoding a neutralizing antibody against porcine delta coronavirus as claimed in claim 1, characterized in that, The polynucleotides include polynucleotides encoding the heavy chain and light chain variable regions, respectively, wherein the sequence of the polynucleotide encoding the heavy chain variable region is shown in SEQ ID NO.3, and the sequence of the polynucleotide encoding the light chain variable region is shown in SEQ ID NO.

4.

3. A recombinant vector, characterized in that, It comprises the polynucleotide of claim 2.

4. A host cell, characterized in that... ， It comprises the polynucleotide of claim 2 or the recombinant vector of claim 3.

5. The use of the porcine delta coronavirus neutralizing monoclonal antibody of claim 1, the polynucleotide of claim 2, the recombinant vector of claim 3, or the host cell of claim 4 in the preparation of a drug against porcine delta coronavirus.

6. The use of the porcine delta coronavirus neutralizing monoclonal antibody of claim 1, the polynucleotide of claim 2, the recombinant vector of claim 3, or the host cell of claim 4 in the preparation of reagents for detecting porcine delta coronavirus.

7. The application as described in claim 6, characterized in that, The reagent described is a double-antibody sandwich ELISA detection reagent.

Images