Recombinant Vibrio natriegens and method for promoting the secretion and expression of foreign proteins

Abstract

The present invention discloses a recombinant Vibrio natriegens and a method for promoting the secretion and expression of exogenous proteins. The recombinant Vibrio natriegens is constructed by using the Vibrio natriegens with the preservation number of CICC 10908 as the chassis cell, knocking out the deoxyribonuclease gene on its genome, and inserting a combined expression cassette of T7 RNA polymerase and aminoglycoside adenyltransferase. The recombinant plasmid carrying the exogenous protein is transformed into the above-mentioned recombinant Vibrio natriegens, and the seed liquid is inoculated into the fermentation medium. After culturing to the mid-logarithmic growth phase, IPTG and NaCl are added, and then the culture is continued to obtain a fermentation broth containing the exogenous protein. The present invention solves the problem of secreting and expressing exogenous proteins by Vibrio natriegens at the fermentation level for the first time, with a short culture time, low cost, and certain universality, providing technical guidance for the research of Vibrio natriegens engineering bacteria in the fields of protein engineering and fermentation engineering.

Description

Technical Field

[0001] The present invention belongs to the technical field of fermentation engineering. More specifically, the present invention relates to a recombinant Vibrio natriegens and a method for promoting the secretion and expression of exogenous proteins using the recombinant Vibrio natriegens. Background Art

[0002] Vibrio natriegens is a Gram-negative marine bacterium isolated from the salt marsh mud of Sapelo Island, Georgia, USA. First discovered in 1958, it is the fastest-growing non-pathogenic bacterium reported to date, with a doubling time of approximately 7-10 minutes.

[0003] Before 2016, research on Vibrio natriegens mainly focused on revealing its physiological and biochemical characteristics and rapid growth mechanism. In 2016, foreign researchers first provided a complete genome of Vibrio natriegens, which consists of two closed circular chromosomes of 3.24 Mb (Chr1) and 1.92 Mb (Chr2), encoding a total of 4,578 open reading frames, with a total genome size of approximately 5.17 Mb, which is more than 0.5 Mb larger than the Escherichia coli genome. Two main mechanisms contribute to the rapid growth of Vibrio natriegens. First, during the exponential growth phase, the number of ribosomes in Vibrio natriegens can reach 115,000 per cell, which is 30-60% more than that in Escherichia coli. Second, the 5.17 Mb genome of Vibrio natriegens is distributed on two chromosomes and can start parallel replication simultaneously from two replication origins. Vibrio natriegens has a growth rate exceeding that of Escherichia coli in all tested temperatures below 42°C in both rich and minimal culture media, with the fastest growth rate at 37°C. The growth rate of Vibrio natriegens in enriched medium is 1.4-2.2 times that of Escherichia coli, and in minimal medium supplemented with glucose, it is 1.6-3.9 times. Sucrose is an inexpensive fermentation raw material, and most current commercial Escherichia coli strains cannot utilize sucrose, while Vibrio natriegens can also grow rapidly on sucrose. At 37°C, the doubling time of Vibrio natriegens in high-salt LB medium containing 3% NaCl is 14.8 min, which is 2.1 times faster than the doubling time of Escherichia coli (31.3 min). Vibrio natriegens also has a wide pH tolerance, with an optimal growth pH of 7.5. These mechanisms enable Vibrio natriegens to achieve high biomass and high protein expression levels, making it the next-generation main host for protein expression and metabolic engineering.

[0004] With the rapid development of DNA recombination technology and genomic technology, the complete genome sequence of Vibrio natriegens has been publicly available and annotated, and related genetic tools and methods have been revealed, finally verifying the feasibility of Vibrio natriegens as a heterologous protein expression host. At present, the research on Vibrio natriegens as a heterologous expression host mainly includes the determination and optimization of genetic transformation methods, the compatibility evaluation of the T7 expression system, and the establishment of cell-free protein expression systems. At this stage, Vibrio natriegens adapted to the T7 expression system has good soluble expression ability of foreign proteins, but most foreign proteins can only be expressed intracellularly and cannot be secreted.

[0005] From the perspective of industrial production, the secretory expression of foreign proteins is more conducive to the separation and purification of foreign proteins, can reduce the purification steps, and lower the cost of downstream purification processes. At present, there are few studies on the secretory expression of foreign proteins in Vibrio natriegens. The main method is to screen signal peptides at the gene level to achieve the secretion of foreign proteins, which has a long R & D cycle, high cost and is not universal.

[0006] Therefore, it is of great guiding significance to develop a simple, short-cycle and universal method for promoting the secretory expression of foreign proteins using Vibrio natriegens. Summary of the Invention

[0007] Based on this, the purpose of the present invention is to provide a recombinant Vibrio natriegens and a method for promoting the secretory expression of foreign proteins. By transforming the recombinant plasmid carrying the foreign protein into the recombinant Vibrio natriegens of the present invention and performing fermentation culture using the method of the present invention, the secretory expression of foreign proteins can be promoted.

[0008] The specific technical solutions to achieve the above invention purposes are as follows.

[0009] In the first aspect of the present invention, a recombinant Vibrio natriegens is provided, which is constructed by using Vibrio natriegens with a preservation number of CICC 10908 as the chassis cell, knocking out the deoxyribonuclease gene on its genome, and inserting a combined expression cassette of T7 RNA polymerase and aminoglycoside adenylyltransferase.

[0010] In the second aspect of the present invention, a method for constructing the above recombinant Vibrio natriegens is provided, including the following steps:

[0011] (1) Using Escherichia coli BL21(DE3) genomic DNA as a template, SEQ ID NO:7 and SEQ ID NO:8 as primers, PCR amplification is carried out to obtain the T7 RNA cassette;

[0012] (2) Using the genomic DNA of Vibrio natriegens as a template, PCR amplification was performed with SEQ ID NO:5 and SEQ ID NO:6, as well as SEQ ID NO:11 and SEQ ID NO:12 as primers, to obtain the aL sequence with the nucleotide sequence of SEQ ID NO:3 and the aR sequence with the nucleotide sequence of SEQ ID NO:4;

[0013] (3) Using plasmid pTargetF as a template, linear amplification of plasmid pTargetF was performed with SEQ ID NO:9 and SEQ ID NO:10 as primers;

[0014] (4) Through seamless cloning technology, T7 RNA cassette, aL and aR were constructed into the linearized plasmid pTargetF to obtain a recombinant plasmid, and then the recombinant plasmid was transformed into competent Escherichia coli;

[0015] (5) Using SEQ ID NO:13 and SEQ ID NO:14 as primers, PCR amplification was performed to obtain the aL-T7-SmR-aR expression cassette, and the aL-T7-SmR-aR expression cassette DNA fragment was recovered;

[0016] (6) The aL-T7-SmR-aR expression cassette DNA fragment was electrotransformed into Vibrio natriegens to obtain the product.

[0017] In the third aspect of the present invention, an application of the above recombinant Vibrio natriegens in promoting the secretion and expression of foreign proteins is provided.

[0018] In the fourth aspect of the present invention, a method for promoting the secretion and expression of foreign proteins is provided, including the following steps:

[0019] (1) The recombinant plasmid carrying the foreign protein was transformed into the above recombinant Vibrio natriegens to obtain recombinant Vibrio natriegens producing the foreign protein;

[0020] (2) The seed culture of the above recombinant Vibrio natriegens producing the foreign protein was inoculated into a fermentation medium, cultured to the mid-logarithmic growth phase, IPTG with a final concentration of 0.1 - 1 mM and NaCl with a final concentration of 40 g / L - 100 g / L were added, and then the culture was continued until the total culture time was 22 - 24 h to obtain a fermentation broth containing the foreign protein.

[0021] The present invention has the following beneficial effects:

[0022] In the present invention, the inventor used Vibrio natronophilus with the preservation number of CICC 10908 as the chassis cell, knocked out the deoxyribonuclease gene, and inserted a combined expression cassette of T7 RNA polymerase and aminoglycoside adenylyltransferase, thereby constructing a recombinant Vibrio natronophilus. Then, the recombinant plasmid carrying the foreign protein was transformed into the recombinant Vibrio natronophilus. In the research on the fermentation method, it was found that when a certain concentration of NaCl (final concentration of 40 - 100 g / L, preferably 40 - 60 g / L) was added during the fermentation of the recombinant Vibrio natronophilus producing the foreign protein to a certain time (mid-logarithmic growth phase), the secretion and expression level of the foreign protein could be significantly increased. The present invention solves for the first time the problem of the secretion and expression of foreign proteins by Vibrio natronophilus at the fermentation level. Compared with intracellular expression, the secretion and expression of recombinant proteins improve the production efficiency of the product separation and purification process and reduce the downstream purification cost. Moreover, the method of the present invention has a certain universality and realizes the secretion and expression of multiple foreign proteins (TGP, TbChi, GMGL, and LysD6E), providing technical guidance for the research of Vibrio natronophilus engineering bacteria in the fields of protein engineering and fermentation engineering. Description of the Drawings

[0023] Figure 1 It is the SDS-PAGE electrophoresis analysis diagram of the recombinant Vibrio natronophilus secreting and expressing foreign proteins GMGL, LysD6E, and TbChi in Example 2 of the present invention. Among them, lanes 1 - 4 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the control group Vplus / pET28a-LysD6E; lanes 5 - 8 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the experimental group Vplus / pET28a-LysD6E; lanes 9 - 12 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the control group Vplus / pET30a-GMGL; lanes 13 - 16 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the experimental group Vplus / pET30a-GMGL; lanes 17 - 20 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the control group Vplus / pET28a-TbChi; lanes 21 - 24 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the experimental group Vplus / pET28a-TbChi; lanes 25 - 28 respectively represent the supernatant of the fermentation broth, the total bacteria in the cell lysate, the supernatant of the cell lysate, and the precipitate of the cell lysate of the blank group Vplus.

[0024] Figure 2 It is the bar graph of the protein content of the recombinant Vibrio natronophilus secreting and expressing foreign proteins GMGL, LysD6E, and TbChi in Example 2 of the present invention.

[0025] Figure 3 This is a bar graph showing the enzyme activity of the recombinant Natrinema sp. secreting and expressing the exogenous protein GMGL enzyme in Example 2 of the present invention.

[0026] Figure 4 This is a growth curve of the recombinant Natrinema sp. expressing TGP in Example 3 of the present invention.

[0027] Figure 5 This is an SDS-PAGE electrophoresis analysis diagram of the exogenous protein TGP with NaCl added at different times in Example 3 of the present invention; among them, the control group: no additional NaCl; experimental group 1: add NaCl at 2 h of fermentation; experimental group 2: add NaCl at 4 h of fermentation; experimental group 3: add NaCl at 6 h of fermentation; experimental group 4: add NaCl at 12 h of fermentation.

[0028] Figure 6 This is a bar graph showing the protein content in the supernatant of the fermentation broth of Vplus / pET28a-TGP with NaCl added at different times in Example 3 of the present invention.

[0029] Figure 7 This is a bar graph showing the protein content in the supernatant of the cell lysate of Vplus / pET28a-TGP with NaCl added at different times in Example 3 of the present invention.

[0030] Figure 8 This is an SDS-PAGE electrophoresis analysis diagram of the exogenous protein TGP at different NaCl addition concentrations in Example 4 of the present invention; among them, the control group: no additional NaCl; experimental group 1: the final concentration of NaCl is 40 g / L; experimental group 2: the final concentration of NaCl is 60 g / L; experimental group 3: the final concentration of NaCl is 80 g / L; experimental group 4: the final concentration of NaCl is 100 g / L.

[0031] Figure 9 This is a bar graph showing the protein content in the supernatant of the fermentation broth of Vplus / pET28a-TGP at different NaCl addition concentrations in Example 4 of the present invention.

[0032] Figure 10 This is a bar graph showing the protein content in the supernatant of the cell lysate of Vplus / pET28a-TGP at different NaCl addition concentrations in Example 4 of the present invention. Detailed implementation manners

[0033] For the convenience of understanding the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosed content of the present invention more thorough and comprehensive.

[0034] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the technical field to which the present invention pertains. The terms used in the description of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0035] Unless otherwise specified, the examples are carried out under conventional experimental conditions, such as those described in the Molecular Cloning: A Laboratory Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: A Laboratory Manual, 2001), or according to the conditions recommended in the manufacturer's instructions. The raw materials and reagents used in the present invention are commercially available, and any biological germplasm materials can be provided for scientific research purposes.

[0036] In some embodiments of the present invention, a recombinant Vibrio natriegens is disclosed. It is constructed by using Vibrio natriegens with the preservation number of CICC 10908 as the chassis cell (preservation number: CICC 10908, preservation name: Vibrio natriegens, preservation unit: China Center for Industrial Culture Collection), knocking out the deoxyribonuclease (Dns) gene on its genome, and inserting a combined expression cassette of T7 RNA polymerase and aminoglycoside adenylyltransferase (SmR).

[0037] In some embodiments, the nucleotide sequence of the deoxyribonuclease gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the combined expression cassette of T7 RNA polymerase and aminoglycoside adenylyltransferase is as shown in SEQ ID NO:2. SEQ ID NO:1:

[0038] atgaaatacctgttctctttattcattcttgcactatccagtgccgccgtggccgcgccaccaagttcattttcagccgctaagcgcgaagcggtaaa

[0039] aatctatcaagatcatcccaccagcttttattgcggctgtgatattcaatggcaaggcaagaaaggcttacctgatctttcctcttgtggttaccaggt

[0040] tcgcaaacaagaaaagcgtgcttcacgcatcgagtgggaacatgtcgttccagcttggcaatttgggcaccagctgcaatgctggcaaagcggt

[0041] ggtcgtaaaaactgctcgcgtaatgacaaaacattccgctcaatggaagccgatctgcacaacctgactcctgcgattggtgaggtaaatggtga

[0042] tcgctctaactacaatttcagtcagtggaatgggatcgatggcgcaacctatggtcgttgtgaagtccaggtaaacttcaagcaacgcaaagtcat

[0043] gccacccgatcgagcacgcggctccatcgctcgtacctatctttatatgagcaaggagtacggcttcaaactgtccaagcaacaaactcagttaa

[0044] tgagtgcatggaacaaaacctacccagccgataaatgggaatgcgaacgcgataagcgcattgccaaagtacaaggcaaccataatccattcg

[0045] ttcaagaggcctgtcgcgcactgtaa

[0046] Shown in SEQ ID NO:2

[0047] atgcccgagaagatgttgagcaaacttatcgcttatctgcttctcatagagtcttgcagacaaactgcgcaactcgtgaaaggtaggcggatccag

[0048] atcccggacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagtcaattcagggtggtgaatgtgaaacca

[0049] gtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcg

[0050] ggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcg

[0051] ttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtc

[0052] gatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgct

[0053] ggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattatttt

[0054] ctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtct

[0055] cggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgt

[0056] ccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcg

[0057] cgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaa

[0058] ccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagc

[0059] tgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagct

[0060] ggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtaagttagctcactcattaggcaccccaggctttacacttt

[0061] atgcttccggctcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgtt

[0062] ttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggc

[0063] ccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctg

[0064] gctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtgacct

[0065] atcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctggctacaggaagg

[0066] ccagacgcgaattatttttgatggcgtcgggatctgatccggatttactaactggaagaggcactaaatgaacacgattaacatcgctaagaacga

[0067] cttctctgacatcgaactggctgctatcccgttcaacactctggctgaccattacggtgagcgtttagctcgcgaacagttggcccttgagcatgag

[0068] tcttacgagatgggtgaagcacgcttccgcaagatgtttgagcgtcaacttaaagctggtgaggttgcggataacgctgccgccaagcctctcat

[0069] cactaccctactccctaagatgattgcacgcatcaacgactggtttgaggaagtgaaagctaagcgcggcaagcgcccgacagccttccagttc

[0070] ctgcaagaaatcaagccggaagccgtagcgtacatcaccattaagaccactctggcttgcctaaccagtgctgacaatacaaccgttcaggctgt

[0071] agcaagcgcaatcggtcgggccattgaggacgaggctcgcttcggtcgtatccgtgaccttgaagctaagcacttcaagaaaaacgttgagga

[0072] acaactcaacaagcgcgtagggcacgtctacaagaaagcatttatgcaagttgtcgaggctgacatgctctctaagggtctactcggtggcgag

[0073] gcgtggtcttcgtggcataaggaagactctattcatgtaggagtacgctgcatcgagatgctcattgagtcaaccggaatggttagcttacaccgc

[0074] caaaatgctggcgtagtaggtcaagactctgagactatcgaactcgcacctgaatacgctgaggctatcgcaacccgtgcaggtgcgctggctg

[0075] gcatctctccgatgttccaaccttgcgtagttcctcctaagccgtggactggcattactggtggtggctattgggctaacggtcgtcgtcctctggc

[0076] gctggtgcgtactcacagtaagaaagcactgatgcgctacgaagacgtttacatgcctgaggtgtacaaagcgattaacattgcgcaaaacacc

[0077] gcatggaaaatcaacaagaaagtcctagcggtcgccaacgtaatcaccaagtggaagcattgtccggtcgaggacatccctgcgattgagcgt

[0078] gaagaactcccgatgaaaccggaagacatcgacatgaatcctgaggctctcaccgcgtggaaacgtgctgccgctgctgtgtaccgcaagga

[0079] caaggctcgcaagtctcgccgtatcagccttgagttcatgcttgagcaagccaataagtttgctaaccataaggccatctggttcccttacaacatg

[0080] gactggcgcggtcgtgtttacgctgtgtcaatgttcaacccgcaaggtaacgatatgaccaaaggactgcttacgctggcgaaaggtaaaccaat

[0081] cggtaaggaaggttactactggctgaaaatccacggtgcaaactgtgcgggtgtcgataaggttccgttccctgagcgcatcaagttcattgagg

[0082] aaaaccacgagaacatcatggcttgcgctaagtctccactggagaacacttggtgggctgagcaagattctccgttctgcttccttgcgttctgcttt

[0083] gagtacgctggggtacagcaccacggcctgagctataactgctcccttccgctggcgtttgacgggtcttgctctggcatccagcacttctccgc

[0084] gatgctccgagatgaggtaggtggtcgcgcggttaacttgcttcctagtgaaaccgttcaggacatctacgggattgttgctaagaaagtcaacg

[0085] agattctacaagcagacgcaatcaatgggaccgataacgaagtagttaccgtgaccgatgagaacactggtgaaatctctgagaaagtcaagct

[0086] gggcactaaggcactggctggtcaatggctggcttacggtgttactcgcagtgtgactaagcgttcagtcatgacgctggcttacgggtccaaag

[0087] agttcggcttccgtcaacaagtgctggaagataccattcagccagctattgattccggcaagggtctgatgttcactcagccgaatcaggctgctg

[0088] gatacatggctaagctgatttgggaatctgtgagcgtgacggtggtagctgcggttgaagcaatgaactggcttaagtctgctgctaagctgctgg

[0089] ctgctgaggtcaaagataagaagactggagagattcttcgcaagcgttgcgctgtgcattgggtaactcctgatggtttccctgtgtggcaggaat

[0090] acaagaagcctattcagacgcgcttgaacctgatgttcctcggtcagttccgcttacagcctaccattaacaccaacaaagatagcgagattgatg

[0091] cacacaaacaggagtctggtatcgctcctaactttgtacacagccaagacggtagccaccttcgtaagactgtagtgtgggcacacgagaagta

[0092] cggaatcgaatcttttgcactgattcacgactccttcggtaccattccggctgacgctgcgaacctgttcaaagcagtgcgcgaaactatggttga

[0093] cacatatgagtcttgtgatgtactggctgatttctacgaccagttcgctgaccagttgcacgagtctcaattggacaaaatgccagcacttccggct

[0094] aaaggtaacttgaacctccgtgacatcttagagtcggacttcgcgttcgcgtaacgccaaatcaatacgactccggatccccttcgaaggaaaga

[0095] cctgatgcttttcgtgcgcgcataaaataccttgatactgtgccattaccctgttatccctactcgagttcatgtgcagctccataagcaaaagggga

[0096] tgataagtttatcaccaccgactatttgcaacagtgccgttgatcgtgctatgatcgactgatgtcatcagcggtggagtgcaatgtcatgagggaa

[0097] gcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacgg

[0098] ctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttg

[0099] atcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccg

[0100] tggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattga

[0101] tctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatct

[0102] atttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttg

[0103] gtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcata

[0104] cttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcg

[0105] agatcaccaaggtagtcggcaaataagatgccgctcgccagtcgattggctgagctc

[0106] In some other embodiments of the present invention, a method for constructing the above-mentioned recombinant Natronovibrio is disclosed, including the following steps:

[0107] (1) Using Escherichia coli BL21(DE3) genomic DNA as a template and SEQ ID NO:7 and SEQ ID NO:8 as primers, PCR amplification is carried out to obtain T7 RNA cassette;

[0108] (2) Using Natronovibrio genomic DNA as a template, PCR amplification is carried out respectively with SEQ ID NO:5 and SEQ ID NO:6, and SEQ ID NO:11 and SEQ ID NO:12 as primers to obtain the aL sequence with the nucleotide sequence of SEQ ID NO:3 and the aR sequence with the nucleotide sequence of SEQ ID NO:4;

[0109] (3) Using plasmid pTargetF as a template and SEQ ID NO:9 and SEQ ID NO:10 as primers, linear amplification of plasmid pTargetF is carried out;

[0110] (4) Through seamless cloning technology, T7 RNA cassette, aL and aR are constructed into the linearized plasmid pTargetF to obtain a recombinant plasmid, and then the recombinant plasmid is transformed into Escherichia coli competent cells;

[0111] (5) Using SEQ ID NO:13 and SEQ ID NO:14 as primers, PCR amplification is carried out to obtain the aL-T7-SmR-aR expression cassette, and the aL-T7-SmR-aR expression cassette DNA fragment is recovered;

[0112] (6) The aL-T7-SmR-aR expression cassette DNA fragment is electrotransformed into Natronovibrio to obtain the recombinant Natronovibrio.

[0113] SEQ ID NO:3

[0114] atgtgagacttacgttaaaaccggtatggtaatggtgggtggtgaaatcacgacttcagcatgggttgacattgaagagctaactcgtgaaaccgt

[0115] tcgtgaaatcggctacgtacactcagatatgggttttgatgcgaactcttgtgcagtactaaacacaattggtaaacagtcaccagatatcaaccaa

[0116] ggtgttgataaagcggatccaaaagagcaaggcgccggtgaccaaggcatcatgttcggttacgcatgtaacgaaactgaagttttaatgccag

[0117] ctccaattacttactctcaccgtcttgttgaaaaacaagcagaagtacgtaagaacggtacacttccttggttacgtccagatgcgaaatctcaggt

[0118] aacgttccaatacgaccaaggtaagatcgtaggtatcgatgctgttgttctatcaactcagcactgtgattcaatctcaactcctgaactgcgtgaag

[0119] cggtaatggaagagatcatcaagccagttctaccttcagagtggatcaacaaagagactaacttcttcatcaacccaactggccgtttcgtaatcg

[0120] gtggtccaatgggtgactgtggtctaactggtcgtaagattatcgtagatacttacggcggtgcggctcgtcacggtggtggtgcgttctcaggta

[0121] aagatccatcaaaagttgaccgtagtgcagcatacgcagcgcgttacgtagcgaaaaacatcgttgcagctggtatggctgaccgttgtgaaatc

[0122] caactttcttacgctatcggtgtggcagatccaacgtcaatcatggtggaaacgtttggtactgagaaagtatctcacgacatcatcatcgaagcag

[0123] tacgtcagttcttcgacctacgtccatacggtctgcaagaaatgcttaaccttctgcagccaatctacaagaagacagcagcatacggccactttg

[0124] gtcgtgaagagttcccatgggaagcgactgataaagcagcacttcttcgcgaattcgctggcatcaagtaatcgagcttgctctgaatttccaaag

[0125] ccctcgccttatggtgggggctttttgtttcccccgactcccctccttctctatcctccagccccacccactaagaacaaattttaagcaaatagttgt

[0126] aaattcccccaactccgccaatagttaaaatattgttaaattgcgtttccgtaacaacgtggatgtaagctagtgtgacgacagcaaccttggggaa

[0127] aacgttagctaaacatcctttatgcttttaaaacttataggggttagtaccaatccaagtaagcaaactgtcaggaatagcgtagtcaaaacgcctg

[0128] aaattaacgcgtaatgttttgataaataattattttccagtcaaacattgtcgcggaattatcgagtatttgaacgcgttagaatgaacaattatttactc

[0129] cgatgggtacaagtcatttgacagacaactgtgtaggaataagccaaggaggagttatgcctcgaacagtcaatccatccgacttccatagtaaa

[0130] cgaaaggaagtccctgataacgaatacgctagaaccattccgtgcaacacggtcaatcttagcgcgcctttccactggctcgcgctagggcttca

[0131] tgacttcgtgcgtatgccactcattagtgccttttatggactgtgcttcatggcagcagcgattggcatcgtattgcttgtgcaatggcaagggacgc

[0132] accttgtcgtgatgccgagtttgatcgtctatatgcttattgggccatttttagccctaggtttgtatgatgccagttgggaacgagagcgcggccac

[0133] aaagctcgcctgttccactcaatgaaagcgataggtcgtaactcaagctctcaatgggcatttgcggttctgcttgcggtttgtatgattttctggatg

[0134] cgaatcgccgcacttctccatgcattgtacccttccgttcaaggtgcaccgctgacagagttcttgcccttcttagtgattgggtcactcattggttttg

[0135] tactagcaagcgtggtattcagcatttctgccttctctattccattaatgatggagcgcagagttgacatgatgacggcggtattcaccagctttaatg

[0136] cggtcaaatccaacattccagcaatgatcgtgtgggcggcaatcatctgtgggggtatcttaattggtttcgccacctacggaatcggtatgctgttt

[0137] actatgcctattctcggctacggtacttggcacgcctaccatgcaacgattaagaaaaaacacacaccttaattcagtgatgctatgatccggccct

[0138] cgcaactgcgggggctttttattgaacttgagaggaacgaatggacattgaactaagctacaaagcaaaacaggtgatggcgcactatatcgcat

[0139] tagctgaacatgcttttaagcgttcattccctattcccagcctgacctttaaagtccgaggtaaagcagcaggaaaagcgtaccttcagctcaatga

[0140] gattcgccttaacccggttttatttaaagaaaacacccaagcgttcttgcaagaagtgataccgcatgaggtcgctcacttaatcacatatcaggttt

[0141] acggtcgcgtccgtcctcatggcaaagagtggcaaaccgtaatggaatccgtatttaacgttccggccaaaaccacacatagtttcgaagtctctt

[0142] ccgttcaaggcaaaaccttcgaataccgatgtcgctgcacgacatatcccctttctattcgccgtcacaacaaagtgctgcgcaaacaagccgtgt

[0143] attcgtgtcaaaaatgtcgtcagcctcttagcttcactggtgtccagctttcctaatcctcagttcaattaagtctcaataggaaatattgaccaacattt

[0144] cttttgttattattaacttgcttattacgaaagctaatatctgagtgatagaatggataaagtcatactttttaaagactttaact

[0145] SEQ ID NO:4

[0146] cggctccatcgctcgtacctatctttatatgagcaaggagtacggcttcaaactgtccaagcaacaaactcagttaatgagtgcatggaacaaaac

[0147] ctacccagccgataaatgggaatgcgaacgcgataagcgcattgccaaagtacaaggcaaccataatccattcgttcaagaggcctgtcgcgc

[0148] actgtaatcctcaccaatcgcgacaatcgctaatctttctgtttgaggcgtttcatttactccaattgaaacgcctcttgccccttgttttttcgatggaa

[0149] agcatccatgttaggaactaagtttattctcttgctggaaatctcatgcgtatccctcgaatttatcatccagaaaccattcaccaacttggtacactcg

[0150] ctttaagtgacgacgccgctggccatattggccgcgtacttcgtatgaaggaaggtcaggaagttctcctatttgacggtagtggtgcagagtttc

[0151] ccgcagttatcgcagaagtcagcaaaaagaatgtcctcgtagacatctctgagcgcgtagagaacagcattgaatcccctttggatcttcacctag

[0152] gacaggtgatttcacgaggcgacaagatggagttcaccattcagaagtcagtcgaactcggagtaaataccatcactccccttatttctgaacgtt

[0153] gtggcgtaaagctcgatcaaaaacgatttgagaagaaactggcccaatggcagaagattgctatcagtgcttgcgagcagtgtggacgtaacat

[0154] cgttccagaaattcgcccaatcatgagcttggaagagtggagcaaagaagagtacgatggacttaagctcaaccttcaccctcgtgccaaatact

[0155] cgatcaacaccctgcctacaccagttgaaaaagtgcgcctgctgattggccctgaaggcggtttgtcagctgaagaaatcgatatgacgcgcga

[0156] gtaccaatttgaagagacgcttctcggtccgcgtgtacttcgcaccgaaacagcggctcttaccgcaattacagctttacaagttcgtttcggcgat

[0157] cttggttaaaacggagaaaaataatgatcaaactcggtattgtaatggacccaatttcgtccattaacatcaagaaagactctagctttgccatgatg

[0158] cttgaagcgcaacgccgcggctacgaaatccactacatggaaatgaatgatcttcacctcgaccaaggtgtggccattgccgacaccaaagtg

[0159] gttgagctaaaagaagatccaaacggctggtacgaattcaaatcagagcaaactatcgagctatctgagttagacgcggttctgatgcgtaaaga

[0160] tcctccgtttgacactgaatacatctacgcaacgtacatccttgagcgtgcagaagagcaaggcacactgatcgtcaacaaacctcagagccttc

[0161] gtgactgcaatgagaagttgtttacagcatggttccctgaattgactccaaccactatcgttacccgtaaagctgaaaagattaaagcattccgtga

[0162] agaacacggcgatgtgatcttaaagcctcttgacggtatgggcggtgcgtctattttccgcgtaaatgagaacgatccaaacgtatcagtgatcat

[0163] cgaaacgctgactaaccatggtcagcattacgcgatggcacaaacattcgtgcctgatatcagcaatggtgacaagcgcattctcgtggttgacg

[0164] gcgagccaatgccttactgtctggcacgtattccggcgaaaggcgaaacgcgcggtaaccttgcggcgggcggcacgggtgaagctcgtcct

[0165] ctaagtgaaacagacattaaaattgcccaaaccgtagcaccaactctgaaagaaaaaggtcttatttttgtgggtcttgatgtgattggcgataagc

[0166] tgacagaaatcaacgtaaccagcccgacctgtattcgtgaaatcgaagcagcatttgatatctcaattacgggcaaactaatggatgccattgaac

[0167] gccgagtaaaaggcgaataaatagggtctgtttatcttgcgtggttaatttttgttcgagataaaagcgttttaatcgcggcgagaggtttatagccta

[0168] gtcattctaagcaaaatacctctcaacaaagagtaaagcgcttttagccgaacccttcgggcagcgtttgtggatactttctactgcgttatcggctt[[ID=1�]]

[0169] atcaggtaggccaactacatttcaaagcctctgccttgtataaagaacccacaaacagctgcaaaaatcagcgcgaaaggtcaacagaccctaa

[0170] atatatagtaaagttatagtagagagctaaatgcaaacttaagcaaattcatgcatatattgccaatttgcttaagtgcacttctgagtcctaaggatc

[0171] agtatgaatatgaacctcacaaaccattttttagttgccatgcctggaatgaaagatccctatttccagaatagcgtgatctacgtctgcgagcacaa

[0172] cgaagaaggcgcaatggggttgataatcaatgcgccagtcgatatcaccgtgggtaacatgcttaagcaagtcaaagtacaacctgtacacccg

[0173] cgtttgttcgaagcaagccttgaccggcctgtatataacggcggcccgatctcagaagatcgtggctttattctgcataaaccgaaagattactatg

[0174] aatccagtattcagatgactgatgagcttgcagtgacaacctcgcgagacattctgactgtgttggggaccgaagctgagccaagcgactatttg

[0175] gttgctttgggctacgcaggttggagcgcagggcagctggaaaatgagttagttgaaaactcttggctgaccatagaagctacgccagaaatcat

[0176] ctttgatactccaattacagaccgttggaaaaaagcagtagaaaaactggggatcgatccgagtcagctttcttctgatgcaggacatgcctgata

[0177] aggcagactgttcccctagattg

[0178] In other embodiments of the present invention, the application of the above-mentioned recombinant Natronovibrio in promoting the secretion and expression of foreign proteins is disclosed.

[0179] In other embodiments of the present invention, a method for promoting the secretion and expression of foreign proteins is disclosed, comprising the following steps:

[0180] (1) Transform the recombinant plasmid carrying the foreign protein into the above-mentioned recombinant Natronovibrio to obtain recombinant Natronovibrio producing the foreign protein;

[0181] (2) Inoculate the seed liquid of the above-mentioned recombinant Natronovibrio producing the foreign protein into a fermentation medium, culture until the mid-logarithmic growth phase, add IPTG with a final concentration of 0.1 - 1 mM and NaCl with a final concentration of 40 g / L - 100 g / L, and then continue to culture until the total culture time is 22 - 24 h to obtain a fermentation broth containing the foreign protein.

[0182] In some of these embodiments, the final concentration of NaCl in step (2) is 40 g / L to 60 g / L.

[0183] In some of these embodiments, the mid-logarithmic growth phase in step (2) is determined according to the growth curve of recombinant Natronovibrio requiring sodium for exogenous protein production.

[0184] In some of these embodiments, the exogenous protein in step (1) is green fluorescent protein TGP (27.6 kDa), chitinase TbChi (49.8 kDa), lipase GMGL (27.6 kDa), or phage lyase LysD6E (25 kDa).

[0185] In some of these embodiments, the recombinant plasmid carrying the exogenous protein in step (1) is pET28a-TGP, pET30a-GMGL, pET28a-LysD6E, or pET28a-TbChi.

[0186] In some of these embodiments, the recombinant Natronovibrio requiring sodium for exogenous protein production in step (1) is the recombinant Natronovibrio requiring sodium for green fluorescent protein production, and the mid-logarithmic growth phase in step (2) is at 2 to 4 h of culture, preferably at 2 h of culture.

[0187] In some of these embodiments, the inoculum amount of the seed solution in step (2) is 1 to 5%, preferably 4 to 5%.

[0188] In some of these embodiments, a method for promoting the secretory expression of exogenous proteins includes the following steps:

[0189] (1) Transform the recombinant plasmid pET28a-TGP into the above-mentioned recombinant Natronovibrio requiring sodium to obtain recombinant Natronovibrio requiring sodium for exogenous protein TGP production;

[0190] (2) Inoculate the seed solution of the above-mentioned recombinant Natronovibrio requiring sodium for exogenous protein TGP production into a fermentation medium, shake culture at 30°C to 37°C and 220 to 250 rpm for 2 h, add IPTG with a final concentration of 0.8 to 1 mM and NaCl with a final concentration of 40 g / L to 60 g / L, and then shake culture at 30°C to 37°C and 250 to 280 rpm for 22 h to obtain a fermentation broth containing exogenous protein TGP.

[0191] In the following examples, the recombinant plasmids pET28a-TGP, pET28a-TbChi, pET28a-LysD6E, and pET30a-GMGL were constructed by the applicant using conventional construction methods in the art in the early stage. The Natronovibrio requiring sodium with the preservation number of CICC 10908 was used as the chassis cell and was purchased from the China Center for Industrial Culture Collection.

[0192] In the following examples, the culture media used are as follows: ① LB3 solid medium: 10 g / L tryptone, 5 g / L yeast extract, 30 g / L NaCl, 15 g / L agar, autoclaved at 115 °C for 20 min. ② LB3 liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 30 g / L NaCl, autoclaved at 115 °C for 20 min. ③ 1 M sorbitol solution: Weigh 18.217 g of sorbitol, dissolve it in pure water, and make up the volume to 100 mL, autoclaved at 115 °C for 20 min, and stored at 4 °C for a long time. ④ Fermentation medium TBv2: 12 g / L tryptone, 24 g / L yeast extract, 0.5% v / v glycerol, 15 g / L NaCl, 2.31 g / L KH2PO4, 16.43 g / L K2HPO4·3H2O.

[0193] The present invention will be described in detail below with reference to the accompanying drawings and specific examples.

[0194] Example 1 Construction of recombinant Vibrio natriegens

[0195] The construction method of the recombinant Vibrio natriegens in this example refers to the literature: Xu J, Dong F, Wu M, et al. Vibrio natriegens as a pET-Compatible Expression Host Complementary to Escherichia coli [J]. Frontiers in Microbiology, 2021, 12. The specific steps are as follows:

[0196] 1. Construction of the aL-T7-SmR-aR combined expression cassette

[0197] (1). Use a cell genomic DNA extraction kit (purchased from Tiangen Biochemical) to extract the genomic DNA of Escherichia coli BL21(DE3) and Vibrio natriegens CICC 10908, respectively.

[0198] (2). Using the genomic DNA of Escherichia coli BL21(DE3) as a template, the T7 RNA cassette was obtained by PCR amplification; using the genomic DNA of Vibrio natriegens CICC 10908 as a template, the 3000 bp sequences aL (nucleotide sequence as shown in SEQ ID NO: 3) and aR (nucleotide sequence as shown in SEQ ID NO: 4) before and after the deoxyribonuclease (Dns) were obtained by PCR amplification, respectively.

[0199] (3) The T7 RNA cassette, aL, and aR were constructed into the plasmid pTargetF (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) through seamless cloning technology, and the recombinant plasmid was transformed into Escherichia coli competent Top10 (purchased from Tiangen Biochemical). The aL-T7-SmR-aR combined expression cassette was obtained by PCR amplification and purified and recovered using a PCR product recovery kit (purchased from Sangon Biotech, Shanghai).

[0200] In this step, the primers used are shown in Table 1.

[0201] Table 1

[0202]

[0203] 2. Construction and transformation of recombinant Vibrio natriegens

[0204] The DNA fragment of the aL-T7-SmR-aR combined expression cassette obtained in step 1 was electrotransformed into Vibrio natriegens CICC10908, and the transformation method is as follows:

[0205] (1) The glycerol bacteria stored at -80°C were activated on LB3 solid medium and cultured at 37°C for 8 - 12 h.

[0206] (2) A single colony was picked and inoculated into a test tube containing 5 mL of LB3 solid medium and cultured at 37°C and 220 rpm for 6 h.

[0207] (3) 1 mL of the resuspended solution was inoculated into 100 mL of LB3 liquid medium and cultured at 37°C and 220 r / min for about 50 min - 1 h until the OD 600 was 0.4 - 0.6.

[0208] (4) The bacterial solution was transferred to a pre-cooled 50 mL centrifuge tube and ice-bathed for 5 min. Then it was centrifuged at 4°C and 3500 rpm for 5 min, and the supernatant was gently aspirated with a pipette and discarded.

[0209] (5) 1 mL of pre-cooled 1 mol / L sorbitol solution was added, and the cells were gently resuspended by pipetting, centrifuged at 4°C and 15000×g for 2 min, and the supernatant was gently aspirated with a pipette and discarded.

[0210] (6) 1 mL of pre-cooled 1 mol / L sorbitol solution was added, and the cells were gently resuspended by pipetting, centrifuged at 4°C and 15000×g for 2 min, and the supernatant was gently aspirated with a pipette and discarded.

[0211] (7) 1 mL of pre-cooled 1 mol / L sorbitol solution was added, and the cells were gently resuspended by pipetting, centrifuged at 4°C and 15000×g for 2 min, and the supernatant was gently aspirated with a pipette and discarded.

[0212] (8) Add 1 mL of pre-cooled 1 mol / L sorbitol solution, gently pipette to resuspend the cells, transfer the bacterial solution to a pre-cooled 2 mL centrifuge tube, centrifuge at 4 °C and 15,000×g for 2 min, gently aspirate and discard all the supernatant with a pipette.

[0213] (9) Add 100 - 200 μL of pre-cooled 1 mol / L sorbitol solution, gently pipette to resuspend the cells, aliquot into pre-cooled 1.5 mL EP tubes in a water bath, with 50 μL in each tube. Store at -80 °C for later use.

[0214] (10) Add approximately 50 - 200 ng of the DNA from step 1 to the competent cells, gently mix, transfer to a pre-cooled 1 mm electroporation cuvette, let stand for 3 min and then perform transformation, set the transformation voltage to 0.8 kV (Bio-Rad, MicroPulserTM, 25 μF, 200 Ω).

[0215] (11) Immediately add 1 mL of pre-cooled LB3 liquid medium, gently pipette to mix, transfer all the bacterial solution to a pre-cooled 1.5 mL EP tube, resuscitate at 37 °C and 220 r / min for 1.5 h, centrifuge at 9000 rpm and 4 °C for 1 min, aspirate 900 μL of the supernatant and discard the supernatant.

[0216] (12) Gently pipette to resuspend the cells, aspirate 100 μL of the bacterial solution and spread it on LB3 solid medium (containing 200 μg / L spectinomycin), culture at 37 °C for 6 - 12 h.

[0217] (13) Pick well-grown single colonies into test tubes of LB3 liquid medium (containing 200 μg / L spectinomycin), culture at 37 °C and 220 rpm for 5 - 6 h, aspirate 200 μL of the bacterial solution for bacterial liquid PCR identification. The successfully identified bacterial strain is the recombinant Vibrio natriegens (hereinafter named recombinant Vibrio natriegens Vplus).

[0218] Example 2 A method for promoting the secretion and expression of foreign proteins

[0219] It includes the following steps:

[0220] 1. Respectively transform the recombinant plasmids pET30a-GMGL, pET28a-LysD6E and pET28a-TbChi into the recombinant Vibrio natriegens Vplus to obtain recombinant Vibrio natriegens producing foreign proteins, named Vplus / pET30a-GMGL, Vplus / pET28a-LysD6E and Vplus / pET28a-TbChi respectively. The transformation method is the same as that in Example 1 (the antibiotic in the medium is replaced with 100 μg / mL kanamycin).

[0221] 2. Seed liquid preparation

[0222] Streak Vplus / pET30a-GMGL, Vplus / pET28a-LysD6E, Vplus / pET28a-TbChi and Vplus from step 1 onto LB3 solid medium (containing 100 μg / mL kanamycin) and culture at 37 °C for 10 - 12 h. Pick a single colony and inoculate it into 5 mL of LB3 liquid medium, then culture at 37 °C for 5 - 6 h to obtain the seed culture.

[0223] 3. Fermentation culture

[0224] Inoculate 5 mL of the seed culture into the fermentation medium with an inoculation amount of 5%. When culturing at 37 °C and 250 rpm for 2 h, add IPTG to a final concentration of 1 mM and add NaCl to a final concentration of 60 g / L, then continue fermentation at 37 °C and 280 rpm for 22 h. The control group does not add NaCl additionally.

[0225] 4. Cell lysis: Pipette 10 mL of the fermentation broth into a 15 mL centrifuge tube, centrifuge at 12000 rpm and 4 °C for 3 min, pour the supernatant of the fermentation broth into a new 15 mL centrifuge tube and store it at 4 °C for later use. Resuspend the centrifuged precipitate with 10 mL of 50 mM pH 7.4 Tris-HCl buffer, and use an ultrasonic cell disruptor (Ningbo Xinzhi Biotechnology Co., Ltd.) to lyse the cells, setting the program as "power 250 w, working for 2 s and stopping for 2 s, temperature 4 °C, running time 10 min". Centrifuge the total lysed bacterial solution at 12000 rpm and 4 °C for 3 min, take the supernatant of the lysate and pour it into a new 15 mL centrifuge tube, and store it at 4 °C for later use. Resuspend the centrifuged precipitate of the lysate with 10 mL of 50 mM pH 7.4 Tris-HCl buffer and store it at 4 °C for later use. The supernatant of the fermentation broth and the supernatant of the cell lysate are used for protein concentration determination and SDS-PAGE electrophoresis detection. The total lysed bacteria and the precipitate of the cell lysate are used for SDS-PAGE electrophoresis detection.

[0226] SDS-PAGE electrophoresis detection: Use a 15% SDS-PAGE denaturing acrylamide color gel rapid preparation kit (Shanghai Sangon Biotech Co., Ltd.) to perform SDS-PAGE electrophoresis detection. After electrophoresis, place the gel in a decolorization tray, add 100 mL of Coomassie brilliant blue staining solution and shake at 60 rpm for 1 h. Pour out the staining solution, add the boiled Coomassie brilliant blue decolorizing solution, shake at 60 rpm for 2 h, and take pictures with a gel imaging system.

[0227] Determination of protein concentration: The protein concentration was determined using a modified Bradford protein concentration assay kit (Sangon Biotech Co., Ltd., Shanghai). A protein standard curve was prepared with bovine serum albumin (BSA) standard, and a series of BSA standard solutions with different concentrations were configured. In the wells of the microplate, 10 μL of BSA standard solution and 200 μL of Bradford dye solution were added in sequence. After reacting for 5 min, the absorbance was measured at 595 nm. The standard curve was plotted with the protein concentration on the x-axis and the absorbance on the y-axis. The test solution was diluted until the absorbance was within the linear range of the standard curve, and then the protein concentration of the test solution was calculated. All experiments were performed in triplicate.

[0228] 5. Expression results of exogenous proteins

[0229] The SDS-PAGE electrophoresis patterns of lipase GMGL, phage lyase LysD6E, and chitinase TbChi are as Figure 1 shown. As can be seen from Figure 1 : The protein band of LysD6E (25 kDa) in lane 5 is darker than that in lane 1. The protein band of GMGL (27.6 kDa) in lane 13 is darker than that in lane 9. The protein band of TbChi (49.8 kDa) in lane 21 is darker than that in lane 17. Since no exogenous protein was inserted in the Vplus strain (blank group), there is no exogenous protein band in lanes 25 - 28.

[0230] The protein contents in the supernatants of the fermentation broths of Vplus / pET30a-GMGL, Vplus / pET28a-LysD6E, and Vplus / pET28a-TbChi are as Figure 2 shown. As can be seen from Figure 2 : Compared with the control group, when NaCl was added additionally to a final concentration of 60 g / L at 2 h of fermentation, the extracellular protein contents of LysD6E, GMGL, and TbChi all increased significantly, indicating that it can significantly promote the secretion and expression of GMGL, LysD6E, and TbChi. The extracellular protein content in the blank group did not change significantly with the increase in salt concentration, indicating that increasing the salt concentration has no obvious effect on the secretion and expression of endogenous proteins.

[0231] The detection methods for the intracellular and extracellular enzyme activities of lipase GMGL refer to the literature: Characterization of Enzymatic Properties and Catalytic Mechanism of Lipase from Bacillus licheniformis in the Ocean [D] (Tang Wei, 2019). The results are as Figure 3 shown. As can be seen from Figure 3It can be seen that when NaCl was additionally added to a final concentration of 60 g / L at 2 h of fermentation, the activity of intracellular GMGL enzyme (supernatant of cell lysate) decreased by 23.5% compared with the control group, and the activity of extracellular GMGL enzyme (supernatant of fermentation broth) increased by 315% compared with the control group, verifying that adding a certain concentration of NaCl during the fermentation process can significantly promote the secretion of intracellular soluble foreign proteins to the extracellular.

[0232] Example 3 Effect of NaCl addition timing on the secretion and expression of foreign proteins

[0233] It includes the following steps:

[0234] 1. Transform the recombinant plasmid pET28a-TGP into the recombinant Natronovibrio Vplus to obtain the recombinant Natronovibrio producing foreign proteins, named Vplus / pET28a-TGP. The transformation method is the same as that in Example 1 (the antibiotic in the medium is replaced with 100 μg / mL kanamycin).

[0235] 2. Seed liquid preparation

[0236] Streak Vplus / pET28a-TGP in step 1 on LB3 solid medium (containing 100 μg / mL kanamycin) and culture at 37 °C for 10 - 12 h. Pick a single colony into 5 mL of LB3 liquid medium and culture at 37 °C for 5 - 6 h to obtain the seed liquid.

[0237] 3. Fermentation culture

[0238] Inoculate 5 mL of the seed liquid into the fermentation medium with an inoculation amount of 5%. When cultured at 37 °C and 250 rpm for 2 h, add IPTG to a final concentration of 1 mM. Culture at 37 °C and 280 rpm until the mid-logarithmic growth phase to the stationary phase (at 2 h, 4 h, 6 h, and 12 h of fermentation) (the growth curve of the recombinant Natronovibrio expressing TGP is as Figure 4 ) Add NaCl to a final concentration of 40 g / L respectively and continue fermentation at 37 °C and 280 rpm. The total fermentation time is 24 h. The control group is without additional NaCl addition.

[0239] 4. Cell lysis, protein content determination, and SDS-PAGE electrophoresis detection are the same as in Example 2.

[0240] 5. Expression results of foreign proteins

[0241] The SDS-PAGE electrophoresis pattern of the green fluorescent protein TGP is as Figure 5 shown. From Figure 5It can be seen that compared with the control group, when NaCl was additionally added at different fermentation times (2 h, 4 h, 6 h, and 12 h of fermentation), the protein band of TGP (27.6 kDa) could be detected in the supernatant of the fermentation broth. However, there was no obvious TGP protein band in the supernatant of the fermentation broth of the control group, indicating that the additional addition of NaCl at different fermentation times could promote the secretion and expression of TGP. When NaCl was added at the mid-logarithmic growth phase, i.e., 2 h of fermentation, the protein band of TGP in the supernatant of the fermentation broth was the darkest, indicating the highest expression level.

[0242] The column chart of the protein content in the supernatant of the fermentation broth of Vplus / pET28a-TGP expressing green fluorescent protein TGP is as Figure 6 shown. From Figure 6 it can be seen that when NaCl was added at 2 h of fermentation, the protein content in the supernatant of the fermentation broth reached the highest of 0.133 g / L. When NaCl was added at 4 h, 6 h, and 12 h of fermentation, the protein content in the supernatant of the fermentation broth was higher than that of the control group. This result was consistent with Figure 5 the result of the electrophoresis diagram.

[0243] The column chart of the protein content in the supernatant of the cell lysate of Vplus / pET28a-TGP expressing green fluorescent protein TGP is as Figure 7 shown. From Figure 7 it can be seen that the addition of NaCl during the fermentation process decreased the content of intracellular soluble proteins compared with the control group (1.289 g / L), indicating that the addition of NaCl did not necessarily increase the expression level of intracellular soluble proteins, but promoted the secretion of intracellular soluble proteins to the extracellular. Therefore, the content of intracellular soluble proteins decreased, and the secretion of extracellular proteins increased.

[0244] Example 4 Effect of NaCl addition concentration on the secretion and expression of foreign proteins

[0245] It includes the following steps:

[0246] 1. Transform the recombinant plasmid pET28a-TGP into the recombinant sodium-requiring vibrio Vplus to obtain the recombinant sodium-requiring vibrio producing foreign proteins, named Vplus / pET28a-TGP. The transformation method is the same as that in Example 1 (the antibiotic in the medium is replaced with 100 μg / mL kanamycin).

[0247] 2. Seed solution preparation

[0248] Streak Vplus / pET28a-TGP in step 1 on LB3 solid medium (containing 100 μg / mL kanamycin) and culture it at 37 °C for 10 - 12 h. Pick a single colony into 5 mL of LB3 liquid medium and culture it at 37 °C for 5 - 6 h to obtain the seed solution.

[0249] 3. Fermentation culture

[0250] Inoculate 5 mL of the seed solution into the fermentation medium at an inoculation amount of 5%. When culturing at 37 °C and 250 rpm for 2 h, add IPTG to a final concentration of 1 mM, and add NaCl to final concentrations of 40 g / L, 60 g / L, 80 g / L, and 100 g / L respectively, and continue fermentation at 37 °C and 280 rpm for 22 h. The control group does not add extra NaCl.

[0251] 4. Cell lysis, protein content determination, and SDS-PAGE electrophoresis detection are the same as in Example 2.

[0252] 5. Expression results of the foreign protein

[0253] The SDS-PAGE electrophoresis pattern of the green fluorescent protein TGP is as Figure 8 shown. It can be seen from Figure 8 that compared with the control group, adding different concentrations of NaCl at 2 h of fermentation all makes the protein band of TGP (27.6 kDa) in the fermentation broth supernatant darker, and the extracellular TGP protein band is the most obvious when adding NaCl to a final concentration of 40 - 60 g / L.

[0254] The column charts of the protein content in the fermentation broth supernatant and the cell lysate supernatant of Vplus / pET28a-TGP expressing the green fluorescent protein TGP are as Figure 9 and Figure 10 shown. It can be seen from Figure 9 and Figure 10 that increasing the NaCl concentration all reduces the intracellular protein content compared with the control group (1.335 g / L), but the extracellular protein content increases significantly compared with the control group (0.102 g / L). This shows that increasing the NaCl concentration promotes the secretion of intracellular soluble proteins to the extracellular.

[0255] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as these combinations of technical features do not conflict, they should all be considered as the scope described in this specification.

[0256] The above-described embodiments only represent several implementation manners of the present invention. Their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent should be subject to the appended claims.

Claims

1. A recombinant Vibrio natriegens, characterized in that, It is constructed by using Vibrio natriegens with the preservation number of CICC 10908 as the chassis cell, knocking out the deoxyribonuclease gene on its genome, and inserting a combined expression cassette of T7 RNA polymerase and aminoglycoside adenylyltransferase; the nucleotide sequence of the deoxyribonuclease gene is as shown in SEQ ID NO:1, and the nucleotide sequence of the combined expression cassette of T7 RNA polymerase and aminoglycoside adenylyltransferase is as shown in SEQ ID NO:

2.

2. The method for constructing the recombinant Vibrio natriegens according to claim 1, characterized in that, It includes the following steps: (1) Using Escherichia coli BL21(DE3) genomic DNA as a template and SEQ ID NO:7 and SEQ ID NO:8 as primers, PCR amplification is carried out to obtain the T7 RNA cassette; (2) Using Vibrio natriegens genomic DNA with the preservation number of CICC 10908 as a template, PCR amplification is carried out respectively with SEQ ID NO:5 and SEQ ID NO:6, and SEQ ID NO:11 and SEQ ID NO:12 as primers to obtain the aL sequence with the nucleotide sequence of SEQ ID NO:3 and the aR sequence with the nucleotide sequence of SEQ ID NO:4; (3) Using plasmid pTargetF as a template and SEQ ID NO:9 and SEQ ID NO:10 as primers, linear amplification of plasmid pTargetF is carried out; (4) The T7 RNA cassette, aL and aR are constructed into the linearized plasmid pTargetF through seamless cloning technology to obtain a recombinant plasmid, and then the recombinant plasmid is transformed into Escherichia coli competent cells; (5) Using SEQ ID NO:13 and SEQ ID NO:14 as primers, PCR amplification is carried out to obtain the aL-T7-SmR-aR expression cassette, and the aL-T7-SmR-aR expression cassette DNA is recovered; (6) The aL-T7-SmR-aR expression cassette DNA is electrotransformed into Vibrio natriegens to obtain the product.

3. Use of the recombinant Vibrio natriegens according to claim 1 in promoting the secretory expression of exogenous proteins.

4. A method for promoting the secretory expression of exogenous proteins, characterized in that, It includes the following steps: (1) The recombinant pET plasmid carrying the exogenous protein is transformed into the recombinant Vibrio natriegens according to claim 1 to obtain a recombinant Vibrio natriegens producing the exogenous protein; (2) The seed liquid of the above recombinant Vibrio natriegens producing the exogenous protein is inoculated into a fermentation medium, cultured until the mid-logarithmic growth phase, IPTG with a final concentration of 0.1~1 mM and NaCl with a final concentration of 40 g / L~100 g / L are added, and then the culture is continued until the total culture time is 22~24 h to obtain a fermentation broth containing the exogenous protein.

5. The method for promoting the secretory expression of exogenous proteins according to claim 4, wherein In step (2), the final concentration of NaCl is 40 g / L~60 g / L.

6. The method for promoting the secretory expression of exogenous proteins according to claim 4, wherein, The mid-logarithmic growth phase described in step (2) is determined according to the growth curve of the recombinant Natronovibrio requiring sodium that produces the exogenous protein; and / or, the exogenous protein described in step (1) is green fluorescent protein TGP, chitinase TbChi, lipase GMGL or phage lyase LysD6E; and / or, the recombinant plasmid carrying the exogenous protein described in step (1) is pET28a-TGP, pET30a-GMGL, pET28a-LysD6E or pET28a-TbChi.

7. The method for promoting the secretory expression of exogenous proteins according to claim 4, wherein The recombinant Natronovibrio requiring sodium that produces the exogenous protein described in step (1) is the recombinant Natronovibrio requiring sodium that produces green fluorescent protein, and the mid-logarithmic growth phase described in step (2) is at 2 to 4 h of culture.

8. The method for promoting the secretory expression of exogenous proteins according to any one of claims 4 to 7, characterized in that, The inoculum size of the seed liquid described in step (2) is 1 to 5%.

9. The method for promoting the secretory expression of exogenous proteins according to claim 8, wherein The inoculum size of the seed liquid described in step (2) is 4 to 5%.

10. The method for promoting the secretory expression of exogenous proteins according to claim 4, wherein It includes the following steps: (1), Transform the recombinant plasmid pET28a-TGP into the recombinant Natronovibrio requiring sodium described in claim 1 to obtain a recombinant Natronovibrio requiring sodium that produces the exogenous protein TGP; (2), Inoculate the seed liquid of the above recombinant Natronovibrio requiring sodium that produces the exogenous protein TGP into the fermentation medium, shake culture at 30 °C to 37 °C and 220 to 250 rpm for 2 h, add IPTG with a final concentration of 0.8 to 1 mM and NaCl with a final concentration of 40 g / L to 60 g / L, and then shake culture at 30 °C to 37 °C and 250 to 280 rpm for 22 h to obtain a fermentation broth containing the exogenous protein TGP.

Images