Rescue of a 3'UTR deletion mutant of a yellow fever virus vaccine strain and its application in the preparation of a live attenuated vaccine

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to the rescue of a 3'UTR deletion mutant of a yellow fever virus vaccine strain and its application in the preparation of a live attenuated vaccine. The applicant constructs an infectious clone and rescues YFV-17D-Δ77. YFV-17D-Δ77 can express YFV-17D E protein, and the virus titer can reach 10 6 PFU / ml, high genetic stability. Compared with YFV-17D, YFV-17D-Δ77 has a similar growth trend in cells, causes weaker cytopathic effects, weakens tissue infection in mice, and has reduced lethality, but can induce strong humoral and cellular immune responses in mice, the level of which is comparable to that induced by YFV-17D, and has a long immune duration. Therefore, YFV-17D-Δ77 can be used as a promising second-generation YFV attenuated live vaccine candidate to supplement the shortcomings of YFV-17D in application.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the rescue of a 3'UTR deletion mutant of a yellow fever virus vaccine strain and its application in the preparation of an attenuated live vaccine. Background Art

[0002] Yellow fever virus (YFV) is an ancient virus, first reported in 1648 in the Yucatán Peninsula of Mexico. The virus is approximately 50 nm in size and encapsulated. Its genome consists of a single-stranded positive-strand RNA approximately 11 kb in length, with untranslated regions at both ends and a large central reading frame that is translated into a polyprotein precursor. This is then processed into three structural proteins (capsid, membrane, and envelope) and seven nonstructural proteins.

[0003] Yellow fever virus is transmitted by Aedes mosquitoes. After a person is bitten by an infected mosquito, the virus is transmitted to local draining lymph nodes via dendritic cells, where it multiplies rapidly. The virus and activated immune cells then enter the peripheral bloodstream through the lymphatic fluid, reaching various organs throughout the body and causing pathological changes. Extensive viral replication in the liver triggers a molecular chain reaction that leads to an imbalance between pro-inflammatory and anti-inflammatory cytokines, causing a cytokine storm, severe liver damage, and vascular lesions. The mortality rate is 5-50%. Clinically, there is no effective treatment, so interventional therapy is the primary approach.

[0004] Yellow fever virus (YFV) is predominantly endemic in tropical and subtropical regions of South America and Africa. Despite the availability of a safe and effective live attenuated vaccine (YFV-17D, derived from the YFV-Asibi wild-type strain serially passaged in mouse and chicken embryos) since 1937, YFV remains a significant public health problem in these endemic regions. Current clinically used live attenuated YFV vaccines utilize an ancient production method that requires production in specific pathogen-free chicken embryos, resulting in limited production and contraindications for individuals allergic to vaccine components, such as eggs. During the 2016-2018 outbreaks in Angola and Brazil, vaccine supply exceeded demand, requiring only one-fifth of the dose to be administered. Furthermore, rare adverse events have been reported in recipients since the vaccine's introduction, and certain populations are contraindicated for vaccination, including infants under nine months of age, breastfeeding women, individuals over 60 years of age, and individuals with egg allergies. Consequently, thanks to the dedicated efforts of researchers worldwide, over ten new yellow fever vaccine candidates are in various stages of development. Among them, the inactivated vaccine candidate XRX-00159 and the recombinant viral vector vaccine candidate MVA-BN-YF60 have been tested in Phase I clinical trials. Although XRX-001 has an adequate safety profile, it requires two doses to induce sufficient protective neutralizing antibodies in macaques, and the duration of immunity is poor. Similarly, MVA-BN-YF also requires multiple doses to provide immune protection comparable to that of a single dose of YFV-17D. Therefore, neither vaccine is an ideal candidate for an epidemic or for large-scale vaccination campaigns. No further research has been conducted to advance their development. A recently developed mRNA vaccine candidate also requires two injections to induce slightly lower levels of neutralizing antibodies in rhesus macaques compared to a single injection of YFV-17D. 17D-IR ES (derived from an infectious clone of YFV-17D) has demonstrated a better safety profile than YFV-17D, but only results from a two-dose immunization have been presented, leaving insufficient data to support its status as a superior vaccine candidate. For other novel vaccine candidates, there is also a lack of sufficient evidence and further exploration to demonstrate their promise. Therefore, the development of effective and safer second-generation yellow fever vaccines remains extremely necessary.

[0005] The 3'UTRs of flaviviruses are highly structured, non-coding sequences that share certain structural similarities. The 3'UTRs of various flaviviruses, such as dengue virus, Zika virus, and West Nile virus, have been reported to be associated with viral virulence and serve as targets for attenuated vaccine design. The 3'UTR of YFV-17D conforms to the basic characteristics of flavivirus 3'UTRs and is divided into three structural domains: Domain I is highly variable, Domain II is relatively conserved, and Domain III is highly conserved. Domain II contains a dumbbell structure similar to that used in the design of live attenuated vaccines for dengue and Zika viruses. In order to further reduce the toxic and side effects of YFV-17D and improve its safety, the present invention deleted 77 nucleotides corresponding to the dumbbell structure in the 3'UTR domain II of the YFV-17D genome, constructed a corresponding infectious clone, and used the Vero cells, the only ones approved by the WHO for human vaccine production, to rescue the virus. Since the 3'UTR is usually not involved in the expression of viral structural proteins, the deletion mutation theoretically does not affect the expression of the virus's main immunogenic envelope protein. Therefore, if it is verified that the mutant strain has an attenuated effect and has immunogenicity and immune protection that are not weaker than YF V-17D, it is expected to develop a safer vaccine candidate strain that can be produced on Vero cells, expand the vaccinated population and provide sufficient vaccine reserves for possible epidemic outbreaks. Summary of the Invention

[0006] The present invention aims to provide a method for rescuing 3'UTR deletion mutants of yellow fever virus vaccine strains, which is simple, easy to implement and suitable for large-scale production. The sequence of the viral infectious clone is shown in SEQ ID NO.1.

[0007] Another object of the present invention is to provide the use of rescued YFV-17D-Δ77 in the preparation of an attenuated yellow fever virus vaccine. To achieve the above object, the present invention adopts the following technical measures:

[0008] A method for obtaining a 3'UTR deletion mutant of a yellow fever virus vaccine strain:

[0009] (1) The SV40 promoter sequence and hepatitis D ribozyme (HDVr) sequence were added to the genome of YFV-17D (GenBank accession no. JN628279) at both ends. This complete sequence was synthesized on the single-copy plasmid pCC1 using synthetic biology techniques to obtain the infectious clone pCC1-YFV-17D.

[0010] (2) A deletion mutation (corresponding to the 3'UTR of the YFV-17D genome) was introduced into pCC1-YFV-17D using a molecular cloning method to obtain pCC1-YFV-17D-Δ77, which was then transfected into Vero cells to rescue the recombinant virus YFV-17D-Δ77, which is shown in SEQ ID NO.1.

[0011] The protection scope of the present invention also includes:

[0012] Other effective mutant viruses were obtained after passage of the recombinant virus YFV-17D-Δ77. The mutant virus plaque morphology was similar to that of YFV-17D-Δ77, the replication rate on Vero cells was similar to that of YFV-17D-Δ77, and the mutant virus had no pathogenicity to mice.

[0013] The recombinant virus described above is preferably the recombinant virus described in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4.

[0014] Use of the above recombinant virus in the preparation of yellow fever virus vaccine.

[0015] Use of the recombinant virus in preparing medicines for treating or preventing diseases caused by yellow fever virus infection.

[0016] Compared with the prior art, the present invention has the following advantages and effects:

[0017] After 20 passages, the YFV-17D-Δ77 virus provided by the present invention still has Δ77 present in the viral genome. Several cell-adaptive mutations have accumulated, which alter viral plaques and growth curves, but do not affect the virus's pathogenicity, immunogenicity, and immune protection. This indicates that YFV-17D-Δ77 has excellent genetic stability, which can avoid the phenomenon of unstable immune effects caused by different batches.

[0018] The YFV-17D-Δ77 provided by the present invention was confirmed to be further attenuated compared to YFV-17D in the AG129 mouse model. On the premise that the virulence is lower than YFV-17D, a single injection can provide immune protection that is no weaker than YFV-17D.

[0019] A single injection provides long-lasting immune protection against YFV-Asibi.

[0020] In summary, the yellow fever virus vaccine strain 3'UTR deletion mutant virus YFV-17D-Δ77 provided by the present invention can be used as a safer cell-based attenuated vaccine to make up for the shortcomings of YFV-17D, and has good application prospects and very important theoretical and practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 for the rescue of YFV-17D and 3'UTR deletion mutants;

[0022] A: Schematic diagram of the construction of the YFV-17D infectious clone;

[0023] B: The corresponding positions of the five different deletions in the 3'UTR secondary structure of the YFV-17D genome and the linear genome;

[0024] C: Immunofluorescence results of Vero cells transfected with YFV-17D and 3'UTR deletion mutant infectious clones at different time points. Figure 2 Comparison of biological characteristics between YFV-17D-Δ77 and YFV-17D;

[0025] A: Comparison of plaque morphology formed by YFV-17D and 3'UTR deletion mutant on BHK-21;

[0026] B: Growth curves of YFV-17D and 3'UTR deletion mutants in Vero cells and C6 / 36 cells;

[0027] C: Differences in cytopathic effects of YFV-17D and 3'UTR deletion mutants on Vero cells.

[0028] Figure 3 The pathogenicity differences between YFV-17D and 3'UTR deletion mutants in AG129 mice

[0029] A: Experimental flow chart showing the differences in pathogenicity between YFV-17D and 3'UTR deletion mutants in AG129 mice;

[0030] B: Infectious virus load in the blood of AG129 mice at different time points after infection with YFV-17D and 3'UTR deletion mutants; C: Infectious virus load in various tissues of AG129 mice at different time points after infection with YFV-17D and 3'UTR deletion mutants; D: Survival rate of AG129 mice after infection with YFV-17D and 3'UTR deletion mutants;

[0031] E: Body weight changes of AG129 mice after infection with YFV-17D and 3'UTR deletion mutants.

[0032] Figure 4 Comparison of immunogenicity between YFV-17D and 3'UTR deletion mutants

[0033] A: Serum neutralizing antibody levels at different time points after A129 mice were immunized with YFV-17D-Δ77 and YFV-17D;

[0034] B: ELISPOT test results of BALB / c mice immunized with YFV-17D-Δ77 and YFV-17D, which reflect the cellular immune response stimulated after immunization.

[0035] Figure 5 The immune protection effect of YFV-17D-Δ77 on A129 mice

[0036] A: Flowchart of the experimental immune protection of A129 mice by YFV-17D-Δ77;

[0037] B: Ability of serum from YFV-17D-Δ77-immunized A129 mice to neutralize YFV-17D-mScarlet;

[0038] C: Ability of serum from YFV-17D-Δ77-immunized A129 mice to neutralize YFV-Asibi;

[0039] D: Viremia in immunized A129 mice after challenge;

[0040] E: Tissue viral load of immunized A129 mice after challenge;

[0041] F: Survival rate of immunized A129 mice after challenge;

[0042] G: Body weight changes of immunized A129 mice after challenge with poison.

[0043] Figure 6 The long-term immune protection of YFV-17D-Δ77 in A129 mice

[0044] A: Experimental process of the long-term immune protection of A129 mice by YFV-17D-Δ77;

[0045] B: Serum neutralizing antibodies in A129 mice immunized with YFV-17D-Δ77 were maintained at high levels for a long time;

[0046] C: Cellular immunity level of BALB / c mice immunized with YFV-17D-Δ77 for half a year;

[0047] D: Viremia in A129 mice immunized with YFV-17D-Δ77 six months after challenge;

[0048] E: Survival rate of A129 mice immunized with YFV-17D-Δ77 six months after challenge;

[0049] F: Body weight changes of A129 mice immunized with YFV-17D-Δ77 six months after challenge.

[0050] Figure 7 The stability of YFV-17D-Δ77 as an attenuated vaccine

[0051] A: Plaque morphology of YFV-17D-Δ77 after 20 passages in Vero cells;

[0052] B: Growth curve of P20 YFV-17D-Δ77 in Vero cells;

[0053] C: Pathogenicity of P20 YFV-17D-Δ77 in AG129 mice;

[0054] D: Neutralizing antibody titer of serum from A129 mice immunized with P20 YFV-17D-Δ77;

[0055] E: Viremia in A129 mice challenged with P20 YFV-17D-Δ77;

[0056] F: Tissue viral load of A129 mice challenged with P20 YFV-17D-Δ77;

[0057] G: Survival rate of A129 mice challenged with P20 YFV-17D-Δ77;

[0058] H: Body weight changes of A129 mice after immunization with P20 YFV-17D-Δ77. DETAILED DESCRIPTION

[0059] The present embodiments describe in detail a method for rescuing a 3'UTR deletion mutant of a yellow fever virus vaccine strain and its validation in mice as a live attenuated vaccine. The technical solutions described in the present embodiments, unless otherwise specified, are conventional in the art. The following are several specific embodiments of the present invention. Obviously, the present invention is not limited to the following embodiments and is subject to numerous variations. Therefore, modifications or improvements made by those skilled in the art based on the present disclosure are intended to fall within the scope of protection claimed herein.

[0060] Example 1:

[0061] Construction of a 3'UTR deletion mutant infectious clone of a yellow fever virus vaccine strain and virus rescue method:

[0062] This example explores the properties of mutant viruses by exploring deletions of different lengths in the 3'UTR. The steps are as follows:

[0063] (1) Construction of infectious clones of yellow fever virus vaccine strain (YFV-17D) and 3'UTR deletion mutant strain:

[0064] According to the YFV-17D sequence (GenBank accession no. JN628279), the functional elements SV40 promoter sequence and HDVr sequence were added to its 3' and 5' ends, respectively. The complete SV40-YFV-17D genome-HDVr sequence was synthesized on the pCC1 single-copy plasmid to obtain the YFV-17D infectious clone pCC1-YFV-17D. The schematic diagram of its structure is shown in Figure 1 A. Twelve primers were synthesized based on the pCC1-YFV-17D sequence, and their sequence information is shown in Table 1.

[0065] Table 1. Primers used for the construction of infectious clones of YFV-17D 3'UTR deletion mutant viruses

[0066]

[0067] pCC1-YFV-17D-Δ77, pCC1-YFV-17D-Δ50, pCC1-YFV-17D-Δ30, pCC1-YFV-17D-Δ20, and pCC1-YFV-17D-Δ10 were constructed using pCC1-YFV-17D as a template. Fusion PCR amplification was performed using PrimeSTAR Max Premix (purchased from Takara). Table 2 lists the primer combinations for the first round of PCR, and then the PCR products were recovered by gel.

[0068] Table 2. Primer information for the first round of PCR for the construction of infectious clones of YFV-17D 3'UTR deletion mutant viruses

[0069]

[0070]

[0071] The second round of fusion PCR was performed using the gel-recovered products of PCR fragment 1 and PCR fragment 2 of each strain as templates, using the primer pairs YF-8195F and pCC1-FseⅠ-R. The two-round PCR reaction system was prepared according to the PrimeSTAR MaxPremix instructions. The reaction conditions were: 98°C for 3 minutes, one cycle; 98°C for 10 seconds, 55°C for 15 seconds, 72°C for 1 minute, 30 cycles; and 68°C for 5 minutes, one cycle.

[0072] After the second round of PCR products were recovered, they were double-digested with XholⅠ and FseⅠ and recovered by gel extraction. They were then ligated with the pCC1-YFV-17D gel extraction product treated with the same enzymes and transformed into E. coli competent EPI300. Single clones were picked and the plasmids were extracted. After sequencing verification, they were named pCC1-YFV-17D-Δ77, pCC1-YFV-17D-Δ50, pCC1-YFV-17D-Δ30, pCC1-YFV-17D-Δ20, and pCC1-YFV-17D-Δ10. The corresponding positions of each deletion fragment in the YFV-17D 3'UTR secondary structure and linear sequence are Figure 1 Marked in B.

[0073] (2) Yellow fever virus vaccine strain (YFV-17D) and 3'UTR deletion mutant infectious clones were transfected into Vero cells by lipofection to rescue the virus:

[0074] The verified correct infectious clones pCC1-YFV-17D, pCC1-YFV-17D-Δ77, pCC1-YFV-17D-Δ50, pCC1-YFV-17D-Δ30, pCC1-YFV-17D-Δ20, and pCC1-YFV-17D-Δ10 were amplified in large quantities, and the plasmids were extracted using the QIAGEN Plasmid Plus Kit.

[0075] One day before transfection, 4 × 10 5 Vero cells were plated in each well of a 6-well cell culture plate to a cell density of approximately 80% on the day of transfection. Transfection was performed using Roche's DNA transfection reagent. On the day of transfection, the transfection reagent, serum-free Opti-MEM medium, and plasmid DNA were removed from the refrigerator and equilibrated to room temperature. The transfection reagent and plasmid were briefly vortexed and then centrifuged to collect the reagent at the bottom of the tube. The plasmid was diluted in Opti-MEM and the transfection reagent and plasmid were added to the diluted plasmid solution at a ratio of 3:1 (m:v) to a final plasmid concentration of 0.01 μg / μl. After the transfection mixture was prepared, it was allowed to stand at room temperature for 30 minutes and then added dropwise to the cell culture medium in the 6-well plate at 200 μl / well. Three wells were transfected with each plasmid. After incubation of the cell culture plate at 37°C in a cell culture incubator for 8 days, the culture medium from each well was collected and centrifuged at 1000g for 5 minutes at 4°C. The supernatant was aliquoted into appropriate volumes and stored at -80°C. This sample is the P0 virus.

[0076] (3) Indirect immunofluorescence (IFA) detection of viral protein expression of deletion mutant viruses YFV-17D-Δ77 (the nucleotide sequence of the virus is shown in SEQ ID NO. 1), YFV-17D-Δ50, YFV-17D-Δ30, YFV-17D-Δ20, and YFV-17D-Δ10:

[0077] One day in advance, the Vero cells were cultured to 10 5 Two 24-well plates were inoculated with cells / well, and Vero cells in the 24-well plates were transfected with 1 μg of plasmid / well according to the above transfection method. Each plasmid was transfected into two wells, and the two plates were treated identically. On the 4th and 6th day after transfection, one plate was collected and the cells were fixed by adding 200 μl of 4% paraformaldehyde pre-cooled at 4°C to each well, fixing the cells on ice for 20 min, aspirating the fixative, and washing the cells three times with cold PBS; adding 200 μl of permeabilization solution (0.2% TritonX-100-PBS) to each well, permeabilizing on ice for 20 min, aspirating the permeabilization solution, and washing the cells three times with PBS; adding 200 μl of 5% FBS-PBS was incubated on a shaker at room temperature for 30 minutes, and the cells were washed 3 times with PBS. The mouse monoclonal antibody 4G2 against the E protein of the flavivirus (purchased from GeneTex) was diluted 500-fold with PBS containing 1% FBS, and 200 μl was added to each well. The cells were incubated at room temperature for 2 hours, and the cells were washed 3 times with PBS. The goat anti-mouse fluorescent secondary antibody was diluted 2000-fold with PBS containing 1% FBS, and 200 μl was added to each well. The cells were incubated at room temperature in the dark for 1 hour, and the cells were washed 3-5 times with PBS. Hochest 34580 was diluted to 0.2 μg / ml with PBS, and 100 μl was added to each well. The cells were incubated at room temperature for 10 minutes, and the cells were washed 3 times with PBS. The images were taken under a fluorescence microscope at a magnification of 400×. The results are shown in Figure 1 Middle C middle.

[0078] The results showed that the expression of viral E protein could be detected in Vero cells transfected with all infectious clones, and the expression level accumulated over time. Among them, the E protein expression of the Δ20 and Δ50 mutant strains was slightly weaker than that of the other strains.

[0079] Example 2:

[0080] Comparison of the plaque morphology, growth curve, and cytopathic effect between the YFV-17D 3'UTR deletion mutant and the prototype strain provided by the present invention:

[0081] (1) The P0 generation YFV-17D, YFV-17D-Δ77, YFV-17D-Δ50, YFV-17D-Δ30, YFV-17D-Δ20, and YFV-17D-Δ10 rescued in Example 1 were subjected to plaque assay to determine the virus titer and compare the plaque morphology: 1.3×10 5 BHK-21 cells were cultured. When the cell confluence reached 90%, the culture medium in the wells was discarded, and 100 μl of the virus collected in step 2 above was added, diluted 10-fold with DMEM medium containing 2% FBS. The virus was adsorbed at 37°C for 1 hour, and the cell plate was shaken every 15 minutes. After adsorption, the virus liquid in each well was discarded, and DMEM containing 2% FBS and 2% sodium methylcellulose was added to cover the wells. The cells were cultured in an incubator at 37°C and 5% CO2 for 3 days. After plaques were formed, they were fixed with 3.7% paraformaldehyde for 30 minutes. After discarding the formaldehyde, the bottom of the wells were rinsed with running water, and then stained with 0.5% crystal violet for 5 minutes. The excess dye was then washed off with running water. After drying, the virus titer was calculated and the plaque morphology was observed. Figure 2 As can be seen in the figure, the plaques of all mutant viruses are smaller than those of YFV-17D, indicating that the virulence of the mutant strains may be weakened compared to YFV-17D.

[0082] (2) 1.3×10 5 Vero or C6 / 36 cells were cultured at 37°C and 5% CO2. After 20 hours, 200 μl of diluted YFV-17D 3'UTR deletion mutant or prototype strain was added to each well at an MOI (multiplicity of infection) of 0.05. The cells were incubated in a 37°C, 5% CO2 incubator for 2 hours. The virus solution was discarded, and 2 ml of DMEM medium containing 2% FBS was added to each well. The cells were cultured at 37°C and 5% CO2. The supernatants of 3 wells infected with one virus were collected every day for 6 consecutive days. The collected samples were stored at -80°C. The virus titers of the samples at different time points were determined according to the above-mentioned plaque assay method, and the growth curve was drawn ( Figure 2 (B) The results showed that the YFV-17D 3'UTR deletion mutant had a similar overall growth trend to the prototype strain, but the mutant had a lower peak replication titer.

[0083] (3) 1.5×10 4Vero cells were cultured at 37°C and 5% CO2. After 20 hours, 100 μl of diluted YFV-17D 3'UTR deletion mutant or prototype strain was added to each well at an MOI of 0.05. The cells were incubated in a 37°C, 5% CO2 incubator for 8 days. The amount of lactate dehydrogenase released from damaged cells into the culture supernatant was then detected using a cytotoxicity detection kit (purchased from Dongren Chemical) to quantify the damage of the virus to the cells ( Figure 2 The results showed that YFV-17D 3'UTR deletion mutants caused less cell damage than the prototype strain.

[0084] Example 3:

[0085] Comparison of pathogenicity between the YFV-17D 3'UTR deletion mutant and the prototype strain in AG129 mice provided by the present invention:

[0086] YFV-17D 3'UTR deletion mutant and prototype strain were compared according to 10 4 PFU / 100 μl was intraperitoneally injected into 6-week-old AG129 (interferon α / β / γ receptor-deficient) mice. Orbital blood was collected on days 1-4 to detect the live viral load in the serum. The mice were dissected on days 2, 4, and 6 after infection. Figure 3 A), a small piece of each of the mesenteric lymph nodes, liver, spleen, bone marrow, and brain of the mice was cut and placed in a grinding tube containing 1 ml of DMEM stock solution. The tissue was then ground and centrifuged at 10,000 g for 5 minutes. The supernatant was collected and the amount of live virus per gram of tissue or per lymph node was determined by plaque assay according to the method described in Example 2. The health status of other infected mice was observed for 30 consecutive days, and the weight of the mice was recorded every day ( Figure 3 (A) When the weight of mice dropped below 80% of their initial weight, they were euthanized and the weight change curve and survival curve were plotted. The results showed that compared with the prototype vaccine strain, the viral load in the blood and tissues of AG129 mice infected with the Δ10 and Δ77 mutants was significantly reduced ( Figure 3 B, C, and E), the mortality rate of mice caused by the mutant strains was significantly reduced. No live virus was detected in the blood and tissues of mice infected with the mutant strains Δ20, Δ30, and Δ50, and no mice died ( Figure 3 (B, C, E).

[0087] Example 4:

[0088] Comparison of the immunogenicity of the YFV-17D 3'UTR deletion mutant and the prototype strain in mice provided by the present invention:

[0089] (1) Comparison of humoral immunity differences between the YFV-17D 3'UTR deletion mutant and the prototype strain in A129 mice provided by the present invention: The YFV-17D 3'UTR deletion mutant and the prototype strain were compared according to 10 4 PFU / 100 μl was injected subcutaneously into 4-week-old A129 (interferon α / β / γ receptor deficient) mice. Blood was collected 4 weeks after immunization and the blood was centrifuged at 3000 g for 10 min to obtain serum. The serum was heated at 56°C for 30 min to inactivate. Vero cells were cultured at 1.5×10 5 / 100μl / well in a black-walled, transparent-bottomed 96-well plate; DMEM maintenance medium was used to dilute the test serum in a 96-well plate starting from 100 times and 3 times, and each sample was diluted twice. The final serum dilution gradient was: 100, 300, 900, 2700, 8100, 24300 times. The final volume of each well after dilution was 70μl. DMEM was used to replace serum in the control wells; DMEM maintenance medium was used to dilute YFV-17D-mScarlet (YFV-17D expressing a red fluorescent reporter gene constructed in this laboratory) to 1.5×10 5 PFU / ml; take 70μl of virus dilution solution and add it to the diluted serum in the 96-well plate, mix well, and then incubate in a 37°C incubator for 1h; after incubation, add 100μl of the serum-virus mixture to each well of the 96-well cell culture plate and incubate in a cell culture incubator for 48h; discard the supernatant in the well, add 50μl of 4% paraformaldehyde to each well to fix the cells for more than 15min, then use the EVOS fluorescence imaging system to take pictures, and use the system's built-in Evos Analysis software to count fluorescence units; calculate the inhibition rate of serum on the virus at different dilution factors based on the fluorescence signal value; use GraphPad Prism8.0 to calculate IC 50 The results showed that compared with YFV-17D, the humoral immune response levels induced by Δ10 and Δ77 mutants were comparable, while the humoral immune response levels induced by Δ20, Δ30, and Δ50 mutants were lower ( Figure 4 Middle A).

[0090] (2) Comparison of the differences in cellular immunity between the YFV-17D 3'UTR deletion mutant and the prototype strain in BALB / c mice: The YFV-17D 3'UTR deletion mutant and the prototype strain were compared according to 10 4PFU / 100 μl was injected subcutaneously into 6-8 week old BALB / c mice, and the spleens of the mice were removed by dissection 8 days after immunization. Before grinding the spleen, the plate was blocked and the ELISpot plate of the Mouse IFN-γ ELISpot PLUS kit (purchased from Mabtech) was washed 4 times with sterile PBS, 200 μl / well, 2 min / time, and tapped on absorbent paper a few times for the last time to absorb as much liquid as possible; 200 μl RPMI 1640 complete medium was added to each well to block the plate and incubated at room temperature for at least 30 min; the fresh spleen was placed in a cell strainer in a 6 cm cell culture dish, 2 ml RPMI 1640 stock solution was added, and the spleen was carefully squeezed and ground with the tail of a 5 ml syringe needle plug until there was no large tissue, and all the cell suspension in the dish was transferred to a 15 ml centrifuge tube, centrifuged at 4 ° C, 1000 rpm, and the supernatant was carefully discarded, leaving a small amount of liquid; the cells were resuspended by tapping the bottom of the tube, 2 ml red blood cell lysis buffer was added to each tube, the lysis time was controlled within 4 minutes, and then 10 ml containing 10% To stop the lysis, centrifuge at 1000 rpm for 5 min at 4°C, carefully discard the supernatant, add 1 ml of RPMI 1640 medium containing 10% FBS to each tube to resuspend the cells, take 20 μl of the cell suspension and dilute it 50 times for counting; adjust the number of cells in each tube to 10 according to the counting results with RPMI 1640 medium containing 10% FBS. 7 / ml; discard the blocking solution in the ELISpot plate, pat the plate dry on absorbent paper, add 50 μl of diluted peptide stimulant to each well, followed by 50 μl of diluted cell suspension. Add only cell suspension to the negative control wells, and 10 μl of PMA + Ionomycin to the positive control wells. All control wells are filled to 100 μl with RPMI1640 medium containing 10% FBS; place the plate in a 37°C, 5% CO2 incubator and incubate for 20-24 hours without moving the plate; incubate R4-6A2-biotin and Streptavidin-ALP in sequence according to the instructions, then add color development solution and incubate in the dark until obvious brown spots appear, then rinse the plate with running water to terminate color development; dry the plate, and read the number of spots in each well using an ELISpot plate reader (AID, Germany); a greater number of spots indicates a stronger cellular immune response. The results showed that all mutant viruses could induce the same level of cellular immune response in BALB / c mice as YFV-17D ( Figure 4 Middle B).

[0091] Example 5:

[0092] The application of YFV-17D-Δ77 provided by the present invention in the preparation of attenuated vaccines:

[0093] Based on the above results, and because the Δ10 mutant has a higher lethality rate in mice than Δ77, and the plaque size produced by the Δ10 mutant on BHK-21 is uneven, we passaged the mutant virus on Vero cells and sequenced to verify the stability of the mutation. We found that the deletion mutation of the Δ10 mutant had been restored by the third generation, while the corresponding mutation of the Δ77 mutant was still retained, so the Δ10 mutant was excluded.

[0094] This example examines the immune protection of YFV-17D-Δ77 in the A129 mouse model:

[0095] (1) Because YFV-17D-Δ77 has strong replication ability ( Figure 2 Medium C), low toxicity ( Figure 3 ), strong immunogenicity ( Figure 4 ), good genetic stability ( Figure 7 ) were selected for the evaluation of immune protection effect as they have the advantages of attenuated vaccines.

[0096] YFV-17D-Δ77 was added at 10 4 Four-week-old A129 mice were subcutaneously immunized with two doses of PFU and 10PFU. The same dose of YFV-17D was used as an immune positive control, and PBS was used as an immune negative control. On the 28th day, the blood of the mice was collected, and the neutralizing antibody titer in the mouse serum was detected according to the method in Example 4. To increase credibility, the ability of mouse immune serum to neutralize YFV-Asibi was also detected. The serum was diluted according to the method in Example 4, and the serum was mixed with equal volumes of diluted YFV-Asibi (1000PFU / ml). The serum was incubated at 37°C for 1 hour, and 100μl of the incubation solution was taken as the sample to be tested. The virus titer was determined by the plaque assay described in Example 2. The inhibition rate of the serum on the virus at different dilution multiples was calculated using the number of spots; GraphPadPrism 8.0 was used to calculate the IC 50 The results showed that the serum neutralization titers of YFV-17D-Δ77 and YFV-17D high and low dose groups were similar ( Figure 5 (B, C).

[0097] (2) On the 30th day after immunization, mice were intraperitoneally injected with 10 6 PFU / 500μl YFV-Asibi. On the second day after infection, blood was collected from mice, and the live virus load in the serum was detected by plaque assay. On the sixth day, the mice were dissected, and the brain, spleen, liver, and bone marrow were obtained for grinding and centrifugation. 140μl of the supernatant was used. Viral RNA Mini Kit (QIAGEN) was used to extract RNA according to the instructions and used as a template. HiScript II One Step qRT-PCR Probe Kit from Novozymes was used with the primers and probes listed in Table 3 and the in vitro transcribed YFV-Asibi RNA standard (concentration gradient: 5 × 10 11 , 5×10 10 , 5×10 9 , 5×10 8 , 5×10 7 , 5×10 6 , 5×10 5 , 5×10 4 , 5×10 3 , 5×10 2 , 5×10 1 , 5×10 0 Quantitative RT-PCR was performed using 1000 copies / μl as a reference. The reaction system was prepared according to the instructions of the kit. The reaction system was mixed on ice, centrifuged briefly, and the following program was run on a BIO-RAD CFX96 fluorescent quantitative PCR instrument:

[0098]

[0099] The number of viral RNA copies per gram of tissue was calculated based on the quantitative relationship between the sample Cq value and the Cq value displayed by the standard and the RNA copy number. Another group of mice challenged with YFV-Asibi were observed for 14 days, with their weight recorded daily. Mice were euthanized when their weight dropped to 80% of their weight on the day of infection. Figure 5 D and Figure 5 Middle E shows that no virus was detected in the serum and tissues of mice immunized with high and low doses of YFV-17D-Δ77 and the immune-positive group, while high viremia and tissue viral loads were detected in the immune-negative mice; Figure 5 Figures F and G show that mice immunized with high and low doses of YFV-17D-Δ77 and the immune-positive group did not lose weight after infection and all survived, while the immune-negative mice continued to lose weight from the second day after challenge, began to die on the sixth day, and all died on the eighth day. This shows that both high and low doses of YFV-17D-Δ77 can achieve the same immune protection effect as YFV-17D on A129 mice.

[0100] Table 3. qRT-PCR primer and probe information

[0101]

[0102]

[0103] Example 6:

[0104] The application of YFV-17D-Δ77 provided by the present invention in the preparation of attenuated vaccines:

[0105] This example examines the long-term immune effect of YFV-17D-Δ77 in the A129 mouse model:

[0106] YFV-17D-Δ77 was administered at a high dose (i.e., 10 4 Four-week-old A129 mice were immunized subcutaneously with YFV-17D (PFU) at the same dose as the positive immune control and PBS as the negative immune control. Blood was collected from the mice at 8, 16, 32, and 50 weeks after immunization, and the neutralizing antibody titer in the serum was detected according to the method described in Example 4. Two days after the last blood collection, the mice were intraperitoneally injected with 10 6 PFU YFV-Asibi, the health status of the mice was observed every day, and blood was collected on the second day of the challenge to detect viremia. At the same time, YFV-17D-Δ77 was subcutaneously immunized with 6-8 week old BALB / c mice at a high dose, and the cellular immunity level was detected by the method described in Example 4 after 6 months. The results showed that the serum neutralizing antibodies of mice immunized with YFV-17D-Δ77 were maintained at a stable level for a long time (at least 50 weeks), and the titer was not lower than the serum neutralizing titer of YFV-17D immunization ( Figure 6 Middle B); the cellular immunity level of YFV-17D-Δ77 after immunization for half a year was not lower than that of YFV-17D ( Figure 6 YFV-17D-Δ77 can protect mice from lethal challenge with YFV-Asibi for a long time ( Figure 6 D, E and F).

[0107] Example 7:

[0108] The application of YFV-17D-Δ77 provided by the present invention in the preparation of attenuated vaccines:

[0109] This example examines the stability of YFV-17D-Δ77 as an attenuated vaccine:

[0110] (1) Take 100 μl of P0 YFV-17D-Δ77 to infect 80% confluent Vero cells in T25. After 4-5 days, collect the supernatant as P1 virus. Take 100 μl of P1 virus to infect new Vero cells. After 4-5 days, collect the supernatant as P2 virus. Take P2 virus to infect new Vero cells..., and repeat this process 20 times for 3 independent passages. Viral RNA Mini Kit (QIAGEN) was used to extract viral RNA from three strains of P20 according to the manufacturer's instructions. RT-PCR was then performed using the primers listed in Table 4 and a one-step RT-PCR kit (Invitrogen) with RNA as the template. The reaction procedure was as follows:

[0111]

[0112] The PCR products were subjected to Sanger sequencing (Qingke Biotechnology). Table 5 shows that the three strains of P20 YFV-17D-Δ77 had relatively consistent new mutations (named P20-1, P20-2, and P20-3, respectively); the sequence of P20-1 YFV-17D-Δ77 is shown in SEQ ID NO. 2, the sequence of P20-2 YFV-17D-Δ77 is shown in SEQ ID NO. 3, and the sequence of P20-3 YFV-17D-Δ77 is shown in SEQ ID NO. 4.

[0113] The growth curves of the three strains P20 YFV-17D-Δ77 were measured on Vero cells according to the method described in Example 2. Figure 7 Figure A shows that the plaque morphology of the three strains P20 YFV-17D-Δ77 is similar to that of the P0 generation YFV-17D-Δ77. Figure 7 Middle B shows that the three strains P20YFV-17D-Δ77 have similar replication rates on Vero cells. In the early stage of replication, they are faster than the P0 generation YFV-17D-Δ77, but the gap gradually narrows. P20-2 and P20-3, which contain more new mutations, were evaluated for their pathogenicity to AG129 mice according to the method in Example 3. Figure 7 Middle C shows that 100% of mice infected with P20-2 and P20-3 survived, indicating that the virus pathogenicity did not recover after passage. Then, P20-2 was selected to immunize A129 mice and challenged with the virus according to the method in Example 5. The serum neutralization titer, viremia, tissue viral load, mouse survival rate and body weight change were tested. Figure 7 Figures D, E, F, G, and H collectively show that both high and low doses of P20-2 YFV-17D-Δ77 can protect A129 mice from lethal challenge with YFV-Asibi.

[0114] Table 4. Primer information for RT-PCR amplification of P20 YFV-17D-Δ77

[0115] Primer name Sequence (5'-3') YFV-1FF agtaaatcctgtgtgctaattgaggtgcattggtct YFV-3278R tcacttctagtggtacctgcatcca YFV-3129F ggccactgacacatacgattggaa YFV-6599R agaggctttcactattgatgcaagcttcacaggatct YFV-6460F tgtgctgagtgaactccctgat YF-10862R agtggttttgtgtttgtcatc

[0116] Table 5. Summary of mutations in P20 YFV-17D-Δ77

[0117]

[0118] a The number before the brackets is the amino acid site mutation, and the number inside the brackets is the nucleotide site mutation

[0119] b The blue font indicates that the sequencing results are double peaks.

Claims

1. A recombinant virus of a 3'UTR deletion mutant of a yellow fever virus vaccine strain, wherein the recombinant virus is shown in SEQ ID NO.

1.

2. Other effective mutant recombinant viruses obtained after passaging the recombinant virus according to claim 1, the mutant virus has similar plaque morphology to the recombinant virus according to claim 1, has a similar replication rate on Vero cells to the recombinant virus according to claim 1, and is non-pathogenic to mice, and the sequence of the other effective mutant recombinant virus is shown in SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

3. Use of the recombinant virus according to claim 1 or 2 in the preparation of yellow fever virus vaccine.

4. Use of the recombinant virus according to claim 1 or 2 in the preparation of a medicament for treating or preventing a disease caused by yellow fever virus infection.

Images